Starting /dee2/code/volunteer_pipeline.sh SRR7168965 current disk space = 3058585309184 free memory = 1452540844 SRR7168965 SRAfilesize a2d6fe5f7a61029e73a34988ef731e55 SRR7168965.sra SRR7168965.sra file validated SRR7168965 is paired end SRR7168965 is conventional basespace SRR7168965 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168965_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.82625 34.0 33.0 34.0 25.0 34.0 2 32.739 34.0 33.0 34.0 28.0 34.0 3 32.94475 34.0 33.0 34.0 32.0 34.0 4 33.18425 34.0 33.0 34.0 32.0 34.0 5 33.13325 34.0 33.0 34.0 32.0 34.0 6 36.7545 38.0 37.0 38.0 35.0 38.0 7 37.14725 38.0 38.0 38.0 36.0 38.0 8 37.2635 38.0 38.0 38.0 36.0 38.0 9 37.315 38.0 38.0 38.0 37.0 38.0 10-14 37.24445 38.0 38.0 38.0 36.8 38.0 15-19 37.266149999999996 38.0 38.0 38.0 36.8 38.0 20-24 37.2467 38.0 38.0 38.0 36.8 38.0 25-29 37.15755 38.0 38.0 38.0 36.0 38.0 30-34 37.12765 38.0 38.0 38.0 36.2 38.0 35-39 37.138850000000005 38.0 38.0 38.0 36.2 38.0 40-44 36.87695 38.0 38.0 38.0 35.0 38.0 45-49 36.77825 38.0 38.0 38.0 34.8 38.0 50-54 36.64335 38.0 38.0 38.0 34.2 38.0 55-59 36.602599999999995 38.0 38.0 38.0 34.0 38.0 60-64 36.4674 38.0 38.0 38.0 33.8 38.0 65-69 36.390699999999995 38.0 37.6 38.0 34.0 38.0 70-74 36.3472 38.0 37.0 38.0 33.6 38.0 75-79 36.210300000000004 38.0 37.0 38.0 33.0 38.0 80-84 35.988150000000005 38.0 37.0 38.0 31.8 38.0 85-89 36.00165 38.0 37.0 38.0 32.6 38.0 90-94 35.812050000000006 38.0 37.0 38.0 31.0 38.0 95-99 35.48299999999999 38.0 36.4 38.0 29.4 38.0 100-104 35.08155 38.0 36.0 38.0 27.8 38.0 105-109 34.94795 38.0 36.0 38.0 27.2 38.0 110-114 34.787150000000004 38.0 35.4 38.0 26.8 38.0 115-119 34.4022 38.0 35.0 38.0 24.2 38.0 120-124 33.676849999999995 38.0 33.8 38.0 19.4 38.0 125-129 33.311099999999996 38.0 34.0 38.0 16.2 38.0 130-134 33.511700000000005 38.0 34.0 38.0 19.8 38.0 135-139 32.91105 37.8 33.4 38.0 15.0 38.0 140-144 32.2563 37.2 32.6 38.0 14.4 38.0 145-149 30.628899999999998 36.0 30.4 38.0 6.4 38.0 150-151 27.328 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 0.0 14 3.0 15 6.0 16 0.0 17 6.0 18 7.0 19 10.0 20 9.0 21 15.0 22 16.0 23 21.0 24 28.0 25 22.0 26 27.0 27 33.0 28 47.0 29 52.0 30 71.0 31 105.0 32 120.0 33 179.0 34 248.0 35 395.0 36 939.0 37 1639.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.05742787813427 13.777298463197626 7.95362631437045 35.21164734429765 2 23.35 17.025000000000002 35.15 24.474999999999998 3 20.200000000000003 22.175 27.750000000000004 29.875 4 23.45 30.9 22.125 23.525 5 21.360680340170084 35.042521260630316 23.911955977988995 19.684842421210604 6 18.325 37.35 24.725 19.6 7 14.325 26.575 41.125 17.974999999999998 8 18.7 25.374999999999996 30.349999999999998 25.575 9 17.0 24.6 33.85 24.55 10-14 20.595 30.259999999999998 26.200000000000003 22.945 15-19 20.21 29.28 27.52 22.99 20-24 20.175 28.970000000000002 27.735 23.119999999999997 25-29 20.11 28.95 27.3 23.64 30-34 20.22 28.904999999999998 27.58 23.294999999999998 35-39 20.765 29.165000000000003 26.795 23.275000000000002 40-44 20.7 28.794999999999998 26.685 23.82 45-49 19.91 28.725 27.925 23.44 50-54 20.39 28.965000000000003 27.27 23.375 55-59 20.57 28.555000000000003 27.13 23.745 60-64 20.53 28.405 27.175 23.89 65-69 20.54 28.499999999999996 27.310000000000002 23.65 70-74 20.43 29.37 26.875 23.325000000000003 75-79 20.355 28.544999999999998 27.075 24.025 80-84 20.39 28.810000000000002 27.415 23.385 85-89 20.905 28.63 26.705000000000002 23.76 90-94 20.66 28.96 26.775 23.605 95-99 20.455000000000002 28.28 27.77 23.494999999999997 100-104 20.335 28.884999999999998 27.389999999999997 23.39 105-109 20.28 28.43 27.415 23.875 110-114 21.0 28.060000000000002 27.025 23.915 115-119 20.985 28.46 26.935 23.62 120-124 20.885 28.725 27.325 23.064999999999998 125-129 20.580000000000002 28.694999999999997 27.925 22.8 130-134 21.09 28.444999999999997 27.415 23.05 135-139 20.835 29.07 26.5 23.595 140-144 21.015 28.575 27.389999999999997 23.02 145-149 21.245 28.005000000000003 27.305 23.445 150-151 20.2125 28.9875 27.0625 23.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 1.5 22 0.5 23 2.0 24 2.5 25 1.5 26 2.5 27 8.5 28 15.0 29 16.0 30 14.5 31 23.0 32 40.0 33 48.5 34 55.5 35 64.0 36 84.5 37 114.0 38 126.5 39 147.0 40 188.5 41 220.0 42 239.5 43 251.5 44 256.0 45 265.0 46 272.0 47 259.5 48 229.0 49 192.5 50 179.5 51 167.5 52 136.0 53 101.5 54 69.5 55 50.5 56 35.0 57 29.0 58 25.0 59 16.5 60 12.0 61 6.0 62 4.0 63 5.0 64 4.5 65 4.0 66 2.5 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.2749999999999995 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.8999999999999999 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.5125000000000002 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.8 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.3375000000000004 0.0 0.0 0.0 0.0 138-139 2.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168965 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168965_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.639 33.0 33.0 34.0 32.0 34.0 2 32.661 33.0 33.0 34.0 32.0 34.0 3 32.68375 34.0 33.0 34.0 32.0 34.0 4 32.59925 34.0 33.0 34.0 32.0 34.0 5 32.5875 34.0 33.0 34.0 32.0 34.0 6 36.83825 38.0 38.0 38.0 36.0 38.0 7 36.8665 38.0 38.0 38.0 36.0 38.0 8 36.84825 38.0 38.0 38.0 36.0 38.0 9 36.84275 38.0 38.0 38.0 36.0 38.0 10-14 36.81455 38.0 38.0 38.0 36.0 38.0 15-19 36.747350000000004 38.0 38.0 38.0 35.8 38.0 20-24 36.7496 38.0 38.0 38.0 36.0 38.0 25-29 36.650400000000005 38.0 38.0 38.0 35.6 38.0 30-34 36.54145 38.0 38.0 38.0 35.0 38.0 35-39 36.58845 38.0 38.0 38.0 35.2 38.0 40-44 36.5784 38.0 38.0 38.0 35.0 38.0 45-49 36.55255 38.0 38.0 38.0 35.0 38.0 50-54 36.552350000000004 38.0 38.0 38.0 35.0 38.0 55-59 36.4354 38.0 38.0 38.0 34.6 38.0 60-64 36.39405000000001 38.0 38.0 38.0 34.2 38.0 65-69 36.197 38.0 38.0 38.0 34.0 38.0 70-74 36.1422 38.0 38.0 38.0 33.2 38.0 75-79 36.125550000000004 38.0 38.0 38.0 33.8 38.0 80-84 36.007450000000006 38.0 38.0 38.0 33.0 38.0 85-89 35.90205 38.0 38.0 38.0 33.0 38.0 90-94 35.75975 38.0 38.0 38.0 31.8 38.0 95-99 35.58575 38.0 37.2 38.0 30.6 38.0 100-104 35.4605 38.0 37.0 38.0 30.2 38.0 105-109 35.43605 38.0 37.0 38.0 30.2 38.0 110-114 35.18925 38.0 36.8 38.0 28.6 38.0 115-119 34.92965 38.0 36.0 38.0 27.6 38.0 120-124 34.8327 38.0 36.0 38.0 27.0 38.0 125-129 34.39810000000001 38.0 35.6 38.0 24.2 38.0 130-134 33.93464999999999 38.0 35.0 38.0 22.2 38.0 135-139 33.66095 38.0 35.0 38.0 18.6 38.0 140-144 33.29045000000001 38.0 34.6 38.0 17.0 38.0 145-149 32.34035 38.0 33.6 38.0 11.0 38.0 150-151 27.886 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 5.0 4 2.0 5 1.0 6 5.0 7 1.0 8 2.0 9 2.0 10 0.0 11 6.0 12 2.0 13 7.0 14 5.0 15 4.0 16 8.0 17 8.0 18 8.0 19 7.0 20 15.0 21 16.0 22 10.0 23 20.0 24 12.0 25 26.0 26 31.0 27 34.0 28 44.0 29 57.0 30 57.0 31 60.0 32 87.0 33 102.0 34 162.0 35 261.0 36 545.0 37 2373.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.62406015037594 21.453634085213032 11.528822055137844 27.39348370927318 2 25.945404457801153 26.471324818432258 30.879038317054846 16.704232406711743 3 21.21212121212121 28.900576008014024 30.428249436513898 19.459053343350863 4 22.68970698722765 35.612321562734785 22.26396193338342 19.434009516654143 5 22.61457550713749 36.764337590783875 23.61632857500626 17.004758327072377 6 22.18609304652326 35.967983991996 24.212106053026513 17.63381690845423 7 19.929982495623904 21.10527631907977 39.45986496624156 19.504876219054765 8 20.41531148361271 24.49337002752064 28.646484863647736 26.444833625218916 9 22.116587440580435 24.468351263447584 30.34776082061546 23.067300475356518 10-14 23.650642789255162 28.307738482317042 26.336851583212447 21.70476714521535 15-19 23.27512883374193 27.567919147445842 27.97818582078351 21.17876619802872 20-24 23.39254440830623 27.350512884663498 28.256192144108084 21.000750562922192 25-29 23.675389002851855 27.497873617851603 27.73802971931756 21.088707659978986 30-34 22.84870922553532 27.816690014008405 27.821693015809483 21.51290774464679 35-39 23.301310917642347 27.92454718302812 27.934554187931553 20.83958771139798 40-44 23.58032721268825 27.17766548256367 28.21834192224946 21.023665382498624 45-49 23.632724543407555 27.92594445834376 27.66574931198399 20.7755816862647 50-54 23.200080052033822 28.0182118376945 28.023215089808375 20.758493020463302 55-59 23.417563172379285 27.31548661496122 28.166124593445087 21.10082561921441 60-64 23.112334250688015 28.276207155366524 27.705779334500875 20.905679259444586 65-69 23.013410728582866 27.997397918334666 28.057445956765413 20.93174539631705 70-74 23.398718975180145 27.39691753402722 28.10748598879103 21.0968775020016 75-79 23.51028168309401 27.682993946064943 28.128283384199733 20.678440986641316 80-84 23.477608206154617 27.380535401551164 28.056042031523642 21.085814360770577 85-89 23.18238679009257 27.9459594696022 28.04603452589442 20.82561921441081 90-94 23.596236612951657 27.13442097888099 28.44560104093684 20.823741367230507 95-99 23.59005154381224 27.923735174898663 28.108892558674874 20.377320722614222 100-104 23.489966471500775 27.598458689886403 27.9737777110544 20.937797127558426 105-109 23.114647450332786 27.66851824050443 28.309062703297805 20.907771605864987 110-114 23.41873498799039 27.331865492393913 28.267614091273018 20.981785428342675 115-119 23.36219408438016 27.67128772333717 28.211801211150593 20.754716981132077 120-124 23.785217434819597 27.54841615373067 27.733573537506878 20.93279287394285 125-129 23.535004754040934 27.718560776660162 27.823650102587198 20.922784366711706 130-134 23.817626745408138 27.20584555327561 28.487062709574097 20.489464991742153 135-139 23.448759007205762 27.632105684547636 28.012409927942354 20.906725380304245 140-144 23.78640776699029 27.52477229506556 27.669902912621357 21.01891702532279 145-149 24.447002302071866 28.065258732859572 27.254529076168556 20.23320988890001 150-151 24.174587293646823 27.801400700350175 26.96348174087044 21.060530265132567 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 2.5 28 2.5 29 8.5 30 15.5 31 17.0 32 18.5 33 25.5 34 34.5 35 54.5 36 76.5 37 97.5 38 129.0 39 164.5 40 200.0 41 227.0 42 259.5 43 273.0 44 272.0 45 289.0 46 284.5 47 283.0 48 269.0 49 212.0 50 165.0 51 138.0 52 126.0 53 91.0 54 63.0 55 54.0 56 38.5 57 27.5 58 17.0 59 17.5 60 12.0 61 4.5 62 5.0 63 4.5 64 4.5 65 3.0 66 0.5 67 0.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.05 7 0.025 8 0.075 9 0.075 10-14 0.045 15-19 0.065 20-24 0.075 25-29 0.065 30-34 0.06 35-39 0.06999999999999999 40-44 0.065 45-49 0.075 50-54 0.065 55-59 0.075 60-64 0.075 65-69 0.08 70-74 0.08 75-79 0.065 80-84 0.075 85-89 0.075 90-94 0.09 95-99 0.08499999999999999 100-104 0.08499999999999999 105-109 0.08499999999999999 110-114 0.08 115-119 0.095 120-124 0.08499999999999999 125-129 0.08499999999999999 130-134 0.095 135-139 0.08 140-144 0.09 145-149 0.09 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8500000000000001 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.3 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.6375000000000002 0.0 0.0 0.0 0.0 132-133 1.725 0.0 0.0 0.0 0.0 134-135 1.9625 0.0 0.0 0.0 0.0 136-137 2.2874999999999996 0.0 0.0 0.0 0.0 138-139 2.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATATG 10 0.006830828 145.0 4 >>END_MODULE Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900038 spots for SRR7168965.sra Written 900038 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra Read 900027 spots for SRR7168965.sra Written 900027 spots for SRR7168965.sra SRR ids: ['SRR7168965.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n64h6njh SRR7168965.sra spots: 18000551 blocks: [[1, 900027], [900028, 1800054], [1800055, 2700081], [2700082, 3600108], [3600109, 4500135], [4500136, 5400162], [5400163, 6300189], [6300190, 7200216], [7200217, 8100243], [8100244, 9000270], [9000271, 9900297], [9900298, 10800324], [10800325, 11700351], [11700352, 12600378], [12600379, 13500405], [13500406, 14400432], [14400433, 15300459], [15300460, 16200486], [16200487, 17100513], [17100514, 18000551]] SRR7168965 file size 6078095 SRR7168965 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168965 SRR7168965_1.fastq SRR7168965_2.fastq Input file: SRR7168965_1.fastq Paired file: SRR7168965_2.fastq trimmed: SRR7168965-trimmed-pair1.fastq, SRR7168965-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:37:59 2025 >> started Mon Feb 10 12:38:22 2025 >> done (23.340s) 18000551 read pairs processed; of these: 31247 ( 0.17%) short read pairs filtered out after trimming by size control 71121 ( 0.40%) empty read pairs filtered out after trimming by size control 17898183 (99.43%) read pairs available; of these: 8645345 (48.30%) trimmed read pairs available after processing 9252838 (51.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 4 0.00% 20 4 0.00% 21 5 0.00% 22 5 0.00% 23 6 0.00% 24 4 0.00% 25 11 0.00% 26 7 0.00% 27 11 0.00% 28 8 0.00% 29 7 0.00% 30 9 0.00% 31 8 0.00% 32 10 0.00% 33 4 0.00% 34 11 0.00% 35 11 0.00% 36 9 0.00% 37 9 0.00% 38 16 0.00% 39 15 0.00% 40 18 0.00% 41 16 0.00% 42 20 0.00% 43 23 0.00% 44 21 0.00% 45 19 0.00% 46 20 0.00% 47 35 0.00% 48 30 0.00% 49 32 0.00% 50 38 0.00% 51 49 0.00% 52 39 0.00% 53 41 0.00% 54 77 0.00% 55 48 0.00% 56 70 0.00% 57 77 0.00% 58 87 0.00% 59 91 0.00% 60 92 0.00% 61 141 0.00% 62 156 0.00% 63 145 0.00% 64 195 0.00% 65 186 0.00% 66 243 0.00% 67 249 0.00% 68 259 0.00% 69 289 0.00% 70 395 0.00% 71 410 0.00% 72 437 0.00% 73 475 0.00% 74 546 0.00% 75 595 0.00% 76 667 0.00% 77 785 0.00% 78 833 0.00% 79 1028 0.01% 80 1081 0.01% 81 1278 0.01% 82 1453 0.01% 83 1692 0.01% 84 2907 0.02% 85 3505 0.02% 86 3736 0.02% 87 3795 0.02% 88 3850 0.02% 89 4014 0.02% 90 4021 0.02% 91 4388 0.02% 92 4913 0.03% 93 5130 0.03% 94 5261 0.03% 95 5516 0.03% 96 5800 0.03% 97 6102 0.03% 98 6443 0.04% 99 6802 0.04% 100 7302 0.04% 101 7781 0.04% 102 8260 0.05% 103 9204 0.05% 104 9564 0.05% 105 10513 0.06% 106 10807 0.06% 107 11384 0.06% 108 12205 0.07% 109 12924 0.07% 110 13531 0.08% 111 14376 0.08% 112 15674 0.09% 113 16721 0.09% 114 17767 0.10% 115 18760 0.10% 116 19826 0.11% 117 21162 0.12% 118 22059 0.12% 119 23161 0.13% 120 24331 0.14% 121 25841 0.14% 122 27693 0.15% 123 29481 0.16% 124 31642 0.18% 125 33614 0.19% 126 35961 0.20% 127 37982 0.21% 128 40541 0.23% 129 42590 0.24% 130 45931 0.26% 131 48779 0.27% 132 52435 0.29% 133 56544 0.32% 134 61054 0.34% 135 64986 0.36% 136 70751 0.40% 137 76408 0.43% 138 82781 0.46% 139 89433 0.50% 140 99104 0.55% 141 110933 0.62% 142 124980 0.70% 143 142924 0.80% 144 166121 0.93% 145 201886 1.13% 146 253027 1.41% 147 341904 1.91% 148 519415 2.90% 149 996385 5.57% 150 4336057 24.23% 151 9252838 51.70% 17898183 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=35 prefix-density=0.23 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=9 fanout-score=29.19 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=10.7 sequence=TTCTCATCAAGGT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.15 sequence-density-rank=19 fanout-score=41.05 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=11.5 sequence=TGTTGGTGGTGG SRR7168965 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:39:05 Started mapping on | Feb 10 12:39:05 Finished on | Feb 10 12:41:19 Mapping speed, Million of reads per hour | 480.85 Number of input reads | 17898183 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16741910 Uniquely mapped reads % | 93.54% Average mapped length | 295.54 Number of splices: Total | 15344426 Number of splices: Annotated (sjdb) | 15099958 Number of splices: GT/AG | 15143017 Number of splices: GC/AG | 158704 Number of splices: AT/AC | 11607 Number of splices: Non-canonical | 31098 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303771 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 63894 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.34% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 876856 876856 876856 N_multimapping 303771 303771 303771 N_noFeature 386862 16531148 466707 N_ambiguous 201214 956 69584 UnstrandedReadsAssigned:16153834 PositiveStrandReadsAssigned:209806 NegativeStrandReadsAssigned:16205619 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168965 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168965-trimmed-pair1.fastq SRR7168965-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,898,183 reads, 16,143,863 reads pseudoaligned [quant] estimated average fragment length: 259.077 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,246 rounds 52401 SRR7168965.ke.tsv 34699 SRR7168965.se.tsv 87100 total ==> SRR7168965.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.92 337 11.6303 Potri.005G024800.1.v4.1 1035 776.923 19 1.48535 Potri.004G059700.1.v4.1 961 702.995 1 0.0863976 Potri.007G009000.2.v4.1 1416 1157.92 0 0 Potri.003G141000.2.v4.1 2943 2684.92 220.044 4.97774 Potri.016G087400.1.v4.1 270 68.8953 1004 885.111 Potri.015G069301.1.v4.1 564 311.913 0 0 Potri.010G195200.1.v4.1 1773 1514.92 25 1.00231 Potri.012G127500.1.v4.1 977 718.969 3063 258.756 ==> SRR7168965.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1920 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 180 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7168965 completed mapping pipeline successfully