Starting /dee2/code/volunteer_pipeline.sh SRR7168966 current disk space = 3058588995584 free memory = 1338254812 SRR7168966 SRAfilesize 56e680dae619aeb46ce1f014441397fa SRR7168966.sra SRR7168966.sra file validated SRR7168966 is paired end SRR7168966 is conventional basespace SRR7168966 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168966_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.34075 34.0 34.0 34.0 33.0 34.0 2 33.5335 34.0 34.0 34.0 33.0 34.0 3 33.5305 34.0 34.0 34.0 33.0 34.0 4 33.6235 34.0 34.0 34.0 33.0 34.0 5 33.53225 34.0 34.0 34.0 33.0 34.0 6 37.1365 38.0 38.0 38.0 36.0 38.0 7 37.42525 38.0 38.0 38.0 37.0 38.0 8 37.5145 38.0 38.0 38.0 37.0 38.0 9 37.5385 38.0 38.0 38.0 38.0 38.0 10-14 37.57835 38.0 38.0 38.0 38.0 38.0 15-19 37.55515 38.0 38.0 38.0 38.0 38.0 20-24 37.553200000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.5224 38.0 38.0 38.0 38.0 38.0 30-34 37.4793 38.0 38.0 38.0 37.6 38.0 35-39 37.44715 38.0 38.0 38.0 37.0 38.0 40-44 37.3578 38.0 38.0 38.0 37.0 38.0 45-49 37.26685 38.0 38.0 38.0 36.6 38.0 50-54 37.206149999999994 38.0 38.0 38.0 36.2 38.0 55-59 37.1453 38.0 38.0 38.0 36.0 38.0 60-64 37.20805 38.0 38.0 38.0 36.2 38.0 65-69 37.14325000000001 38.0 38.0 38.0 36.0 38.0 70-74 37.08275 38.0 38.0 38.0 36.0 38.0 75-79 37.05195 38.0 38.0 38.0 36.0 38.0 80-84 36.96155 38.0 38.0 38.0 36.0 38.0 85-89 36.8432 38.0 38.0 38.0 35.2 38.0 90-94 36.69995000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.70020000000001 38.0 38.0 38.0 35.0 38.0 100-104 36.550850000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.416 38.0 38.0 38.0 34.0 38.0 110-114 36.3189 38.0 38.0 38.0 34.0 38.0 115-119 36.1839 38.0 37.8 38.0 33.8 38.0 120-124 36.0185 38.0 37.4 38.0 33.2 38.0 125-129 35.7292 38.0 36.8 38.0 31.4 38.0 130-134 35.6135 38.0 36.4 38.0 31.2 38.0 135-139 35.3729 38.0 36.0 38.0 31.0 38.0 140-144 34.9049 38.0 35.6 38.0 28.0 38.0 145-149 34.4439 38.0 35.0 38.0 27.6 38.0 150-151 31.78875 36.5 33.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 1.0 17 0.0 18 1.0 19 2.0 20 5.0 21 6.0 22 4.0 23 8.0 24 4.0 25 11.0 26 14.0 27 18.0 28 19.0 29 34.0 30 39.0 31 43.0 32 61.0 33 90.0 34 114.0 35 208.0 36 600.0 37 2711.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.463782696177063 10.035211267605634 15.191146881287725 43.309859154929576 2 20.424999999999997 14.424999999999999 34.55 30.599999999999998 3 20.8 19.400000000000002 24.725 35.075 4 22.8 26.700000000000003 22.325 28.175 5 23.075000000000003 31.874999999999996 23.5 21.55 6 20.275000000000002 36.375 23.075000000000003 20.275000000000002 7 14.649999999999999 27.1 41.0 17.25 8 18.35 26.400000000000002 30.825000000000003 24.425 9 18.375 24.15 32.574999999999996 24.9 10-14 19.759999999999998 30.03 26.834999999999997 23.375 15-19 19.53 28.765 27.555000000000003 24.15 20-24 19.45 28.794999999999998 27.525 24.23 25-29 19.905 28.645 27.35 24.099999999999998 30-34 19.415 28.585 27.775 24.224999999999998 35-39 20.175 28.125 27.405 24.295 40-44 19.1 28.634999999999998 27.99 24.275 45-49 19.99 28.599999999999998 27.375 24.035 50-54 19.759999999999998 28.910000000000004 27.495000000000005 23.835 55-59 20.455000000000002 28.449999999999996 27.24 23.855 60-64 19.545 28.645 27.46 24.349999999999998 65-69 19.645000000000003 28.225 27.85 24.279999999999998 70-74 19.865 28.799999999999997 27.615000000000002 23.72 75-79 20.135 28.28 27.555000000000003 24.03 80-84 20.080000000000002 28.335 27.060000000000002 24.525 85-89 20.185 28.965000000000003 27.125 23.724999999999998 90-94 19.875 28.075 27.034999999999997 25.014999999999997 95-99 20.575 28.76 27.045 23.62 100-104 20.810000000000002 28.48 26.915 23.794999999999998 105-109 21.325 27.855 27.229999999999997 23.59 110-114 20.294999999999998 27.91 27.560000000000002 24.235 115-119 20.77 28.439999999999998 26.724999999999998 24.065 120-124 20.794999999999998 28.275 27.495000000000005 23.435 125-129 20.815 27.755000000000003 27.375 24.055 130-134 21.04 28.645 26.565 23.75 135-139 20.52 27.77 27.0 24.709999999999997 140-144 21.005 28.050000000000004 27.215 23.73 145-149 21.38 28.025 26.91 23.685000000000002 150-151 20.525 28.175 27.3875 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 3.5 26 7.5 27 8.5 28 8.5 29 9.0 30 15.0 31 23.5 32 29.0 33 39.0 34 55.0 35 69.5 36 82.5 37 98.5 38 123.5 39 154.5 40 175.5 41 199.0 42 235.5 43 265.0 44 272.0 45 274.5 46 277.0 47 261.0 48 240.0 49 219.0 50 177.5 51 148.0 52 130.0 53 107.0 54 82.5 55 53.0 56 38.5 57 28.5 58 21.0 59 15.0 60 10.0 61 7.5 62 5.5 63 5.5 64 5.5 65 3.5 66 2.5 67 2.0 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.40221216691804923 0.8 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.2999999999999998 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.6375 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.0999999999999996 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.7875 0.0 0.0 0.0 0.0 136-137 3.0125 0.0 0.0 0.0 0.0 138-139 3.2750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTCA 10 0.006830828 145.0 5 >>END_MODULE SRR7168966 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168966_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90125 33.0 33.0 34.0 32.0 34.0 2 33.0835 34.0 33.0 34.0 33.0 34.0 3 33.10375 34.0 33.0 34.0 33.0 34.0 4 33.0725 34.0 33.0 34.0 33.0 34.0 5 33.1255 34.0 33.0 34.0 33.0 34.0 6 37.25025 38.0 38.0 38.0 37.0 38.0 7 37.3535 38.0 38.0 38.0 37.0 38.0 8 37.297 38.0 38.0 38.0 37.0 38.0 9 37.283 38.0 38.0 38.0 37.0 38.0 10-14 37.26819999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.2247 38.0 38.0 38.0 37.0 38.0 20-24 37.2002 38.0 38.0 38.0 37.0 38.0 25-29 37.227850000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.212399999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.192 38.0 38.0 38.0 37.0 38.0 40-44 37.1606 38.0 38.0 38.0 37.0 38.0 45-49 37.12035 38.0 38.0 38.0 36.8 38.0 50-54 37.14685 38.0 38.0 38.0 37.0 38.0 55-59 37.0758 38.0 38.0 38.0 36.6 38.0 60-64 37.000099999999996 38.0 38.0 38.0 36.2 38.0 65-69 36.95655000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.84715 38.0 38.0 38.0 36.0 38.0 75-79 36.835699999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.7394 38.0 38.0 38.0 35.6 38.0 85-89 36.6126 38.0 38.0 38.0 35.0 38.0 90-94 36.450250000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.39495000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.2851 38.0 38.0 38.0 34.0 38.0 105-109 36.1694 38.0 38.0 38.0 33.8 38.0 110-114 36.04155 38.0 38.0 38.0 33.6 38.0 115-119 35.824299999999994 38.0 37.4 38.0 32.4 38.0 120-124 35.65905 38.0 37.0 38.0 32.2 38.0 125-129 35.31410000000001 38.0 36.2 38.0 30.0 38.0 130-134 35.043350000000004 38.0 36.0 38.0 28.4 38.0 135-139 34.63289999999999 38.0 35.4 38.0 27.4 38.0 140-144 34.178999999999995 38.0 35.0 38.0 23.8 38.0 145-149 33.6222 38.0 35.0 38.0 20.4 38.0 150-151 30.105375 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 3.0 12 0.0 13 3.0 14 2.0 15 2.0 16 2.0 17 4.0 18 7.0 19 3.0 20 4.0 21 5.0 22 7.0 23 10.0 24 8.0 25 12.0 26 23.0 27 28.0 28 32.0 29 28.0 30 41.0 31 46.0 32 61.0 33 94.0 34 123.0 35 225.0 36 567.0 37 2643.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.75 17.474999999999998 23.075000000000003 33.7 2 25.924999999999997 23.225 32.0 18.85 3 21.83591795897949 25.362681340670335 31.540770385192594 21.260630315157577 4 23.83575363044567 30.996494742113168 24.536805207811717 20.630946419629446 5 25.78789394697349 33.41670835417709 23.686843421710854 17.10855427713857 6 20.275000000000002 37.875 23.35 18.5 7 20.0 20.349999999999998 40.075 19.575 8 22.475 24.15 27.200000000000003 26.174999999999997 9 22.675 24.15 30.675 22.5 10-14 23.07 28.15 27.310000000000002 21.47 15-19 22.846142307115354 27.94139706985349 28.091404570228512 21.12105605280264 20-24 23.62 27.665 27.21 21.505 25-29 23.3 28.24 27.57 20.89 30-34 22.99 28.185 27.744999999999997 21.08 35-39 23.415 27.900000000000002 27.22 21.465 40-44 23.69 27.450000000000003 28.055000000000003 20.805 45-49 23.3 27.775 27.384999999999998 21.54 50-54 23.425 27.965 27.310000000000002 21.3 55-59 23.400000000000002 27.834999999999997 27.77 20.995 60-64 23.465 27.32 28.29 20.925 65-69 23.625 27.855 27.625 20.895 70-74 23.96 26.68 28.22 21.14 75-79 23.46 26.905 28.849999999999998 20.785 80-84 23.34 27.76 28.43 20.47 85-89 24.275 27.435 27.815 20.474999999999998 90-94 23.53 28.78 27.095000000000002 20.595 95-99 23.995 27.889999999999997 27.48 20.635 100-104 24.19 27.605 27.525 20.68 105-109 23.919999999999998 28.065 27.57 20.445 110-114 23.945 27.79 27.694999999999997 20.57 115-119 24.085 27.68 27.975 20.26 120-124 23.745 27.52 28.42 20.315 125-129 24.81 27.305 27.884999999999998 20.0 130-134 23.73 27.615000000000002 27.625 21.029999999999998 135-139 24.57 27.63 27.665 20.135 140-144 24.85 27.235 27.55 20.365 145-149 24.795 27.87 27.29 20.044999999999998 150-151 23.7 27.962500000000002 27.712500000000002 20.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 2.0 26 4.0 27 5.0 28 6.0 29 6.0 30 9.5 31 16.0 32 23.5 33 29.0 34 40.0 35 55.0 36 78.0 37 99.5 38 108.0 39 145.0 40 198.5 41 223.0 42 248.0 43 270.0 44 285.5 45 291.0 46 273.0 47 269.0 48 264.5 49 234.0 50 179.5 51 149.5 52 120.0 53 82.0 54 63.5 55 44.0 56 39.0 57 30.0 58 18.5 59 22.0 60 21.5 61 13.0 62 8.5 63 7.5 64 3.5 65 1.0 66 1.5 67 1.5 68 1.5 69 0.5 70 1.0 71 2.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.15 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.7875000000000001 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.2625000000000002 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.95 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.65 0.0 0.0 0.0 0.0 134-135 2.8875 0.0 0.0 0.0 0.0 136-137 3.1125 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAAGGA 10 0.006830828 145.0 1 >>END_MODULE Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra Read 711808 spots for SRR7168966.sra Written 711808 spots for SRR7168966.sra SRR ids: ['SRR7168966.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2dfspocm SRR7168966.sra spots: 14236160 blocks: [[1, 711808], [711809, 1423616], [1423617, 2135424], [2135425, 2847232], [2847233, 3559040], [3559041, 4270848], [4270849, 4982656], [4982657, 5694464], [5694465, 6406272], [6406273, 7118080], [7118081, 7829888], [7829889, 8541696], [8541697, 9253504], [9253505, 9965312], [9965313, 10677120], [10677121, 11388928], [11388929, 12100736], [12100737, 12812544], [12812545, 13524352], [13524353, 14236160]] SRR7168966 file size 4802467 SRR7168966 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168966 SRR7168966_1.fastq SRR7168966_2.fastq Input file: SRR7168966_1.fastq Paired file: SRR7168966_2.fastq trimmed: SRR7168966-trimmed-pair1.fastq, SRR7168966-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:38:23 2025 >> started Mon Feb 10 12:38:39 2025 >> done (16.042s) 14236160 read pairs processed; of these: 15769 ( 0.11%) short read pairs filtered out after trimming by size control 32818 ( 0.23%) empty read pairs filtered out after trimming by size control 14187573 (99.66%) read pairs available; of these: 5680858 (40.04%) trimmed read pairs available after processing 8506715 (59.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 5 0.00% 21 8 0.00% 22 7 0.00% 23 4 0.00% 24 7 0.00% 25 3 0.00% 26 8 0.00% 27 6 0.00% 28 3 0.00% 29 2 0.00% 30 8 0.00% 31 5 0.00% 32 8 0.00% 33 5 0.00% 34 7 0.00% 35 10 0.00% 36 8 0.00% 37 10 0.00% 38 10 0.00% 39 21 0.00% 40 13 0.00% 41 7 0.00% 42 11 0.00% 43 16 0.00% 44 13 0.00% 45 21 0.00% 46 25 0.00% 47 25 0.00% 48 37 0.00% 49 33 0.00% 50 32 0.00% 51 29 0.00% 52 41 0.00% 53 46 0.00% 54 39 0.00% 55 39 0.00% 56 54 0.00% 57 58 0.00% 58 78 0.00% 59 116 0.00% 60 95 0.00% 61 130 0.00% 62 109 0.00% 63 109 0.00% 64 141 0.00% 65 148 0.00% 66 147 0.00% 67 144 0.00% 68 227 0.00% 69 299 0.00% 70 336 0.00% 71 314 0.00% 72 324 0.00% 73 367 0.00% 74 423 0.00% 75 463 0.00% 76 457 0.00% 77 537 0.00% 78 572 0.00% 79 673 0.00% 80 700 0.00% 81 822 0.01% 82 901 0.01% 83 1162 0.01% 84 1793 0.01% 85 2199 0.02% 86 2422 0.02% 87 2506 0.02% 88 2693 0.02% 89 2742 0.02% 90 2907 0.02% 91 3073 0.02% 92 3254 0.02% 93 3470 0.02% 94 3789 0.03% 95 4118 0.03% 96 4312 0.03% 97 4621 0.03% 98 4871 0.03% 99 5116 0.04% 100 5412 0.04% 101 5815 0.04% 102 6214 0.04% 103 6589 0.05% 104 7009 0.05% 105 7636 0.05% 106 8078 0.06% 107 8496 0.06% 108 8873 0.06% 109 9551 0.07% 110 10243 0.07% 111 10470 0.07% 112 11210 0.08% 113 11932 0.08% 114 12787 0.09% 115 13661 0.10% 116 14448 0.10% 117 15156 0.11% 118 16121 0.11% 119 16988 0.12% 120 17750 0.13% 121 18746 0.13% 122 19729 0.14% 123 20788 0.15% 124 21839 0.15% 125 23146 0.16% 126 24941 0.18% 127 26473 0.19% 128 28207 0.20% 129 29609 0.21% 130 31365 0.22% 131 33503 0.24% 132 35243 0.25% 133 38013 0.27% 134 40258 0.28% 135 43059 0.30% 136 46552 0.33% 137 50500 0.36% 138 54880 0.39% 139 59925 0.42% 140 64688 0.46% 141 71758 0.51% 142 78542 0.55% 143 89413 0.63% 144 102836 0.72% 145 123181 0.87% 146 150489 1.06% 147 203748 1.44% 148 303376 2.14% 149 593032 4.18% 150 2964202 20.89% 151 8506715 59.96% 14187573 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=38 prefix-density=0.21 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=178.85 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=36 prefix-density=0.27 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=39 fanout-score=68.51 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.4 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7168966 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:39:30 Started mapping on | Feb 10 12:39:31 Finished on | Feb 10 12:40:59 Mapping speed, Million of reads per hour | 580.40 Number of input reads | 14187573 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13268911 Uniquely mapped reads % | 93.52% Average mapped length | 296.44 Number of splices: Total | 12520466 Number of splices: Annotated (sjdb) | 12309435 Number of splices: GT/AG | 12345572 Number of splices: GC/AG | 140055 Number of splices: AT/AC | 10369 Number of splices: Non-canonical | 24470 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267149 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 379272 % of reads mapped to too many loci | 2.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.56% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 663286 663286 663286 N_multimapping 267149 267149 267149 N_noFeature 320289 13111145 387789 N_ambiguous 146082 968 55171 UnstrandedReadsAssigned:12802540 PositiveStrandReadsAssigned:156798 NegativeStrandReadsAssigned:12825951 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168966 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168966-trimmed-pair1.fastq SRR7168966-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,187,573 reads, 12,998,828 reads pseudoaligned [quant] estimated average fragment length: 256.538 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR7168966.ke.tsv 34699 SRR7168966.se.tsv 87100 total ==> SRR7168966.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.46 301 12.2584 Potri.005G024800.1.v4.1 1035 779.462 16 1.47337 Potri.004G059700.1.v4.1 961 705.532 6 0.610409 Potri.007G009000.2.v4.1 1416 1160.46 0 0 Potri.003G141000.2.v4.1 2943 2687.46 228.063 6.09114 Potri.016G087400.1.v4.1 270 70.3591 1495 1525.13 Potri.015G069301.1.v4.1 564 314.433 0 0 Potri.010G195200.1.v4.1 1773 1517.46 26 1.22982 Potri.012G127500.1.v4.1 977 721.5 3153 313.671 ==> SRR7168966.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1165 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 209 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168966 completed mapping pipeline successfully