Starting /dee2/code/volunteer_pipeline.sh SRR7168967 current disk space = 3058646638592 free memory = 1202988156 SRR7168967 SRAfilesize 2a8625bdbe897cd3cc8aa01b5c44ccfb SRR7168967.sra SRR7168967.sra file validated SRR7168967 is paired end SRR7168967 is conventional basespace SRR7168967 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168967_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2645 34.0 34.0 34.0 33.0 34.0 2 33.50725 34.0 34.0 34.0 33.0 34.0 3 33.539 34.0 34.0 34.0 33.0 34.0 4 33.57175 34.0 34.0 34.0 33.0 34.0 5 33.5995 34.0 34.0 34.0 33.0 34.0 6 37.2915 38.0 38.0 38.0 37.0 38.0 7 37.5345 38.0 38.0 38.0 37.0 38.0 8 37.54475 38.0 38.0 38.0 38.0 38.0 9 37.578 38.0 38.0 38.0 38.0 38.0 10-14 37.60635 38.0 38.0 38.0 38.0 38.0 15-19 37.63685 38.0 38.0 38.0 38.0 38.0 20-24 37.60985 38.0 38.0 38.0 38.0 38.0 25-29 37.592400000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.56955 38.0 38.0 38.0 38.0 38.0 35-39 37.40785 38.0 38.0 38.0 37.2 38.0 40-44 37.3662 38.0 38.0 38.0 37.0 38.0 45-49 37.30635 38.0 38.0 38.0 37.0 38.0 50-54 37.31135 38.0 38.0 38.0 37.0 38.0 55-59 37.256150000000005 38.0 38.0 38.0 36.8 38.0 60-64 37.231849999999994 38.0 38.0 38.0 36.8 38.0 65-69 37.174850000000006 38.0 38.0 38.0 36.2 38.0 70-74 37.138799999999996 38.0 38.0 38.0 36.0 38.0 75-79 37.0595 38.0 38.0 38.0 36.0 38.0 80-84 36.8445 38.0 38.0 38.0 35.4 38.0 85-89 36.74175 38.0 38.0 38.0 34.8 38.0 90-94 36.61795 38.0 38.0 38.0 34.0 38.0 95-99 36.44035 38.0 38.0 38.0 33.4 38.0 100-104 36.146249999999995 38.0 37.0 38.0 32.4 38.0 105-109 35.9245 38.0 37.0 38.0 31.8 38.0 110-114 35.476150000000004 38.0 37.0 38.0 29.2 38.0 115-119 35.208549999999995 38.0 36.4 38.0 29.0 38.0 120-124 34.5792 38.0 35.0 38.0 26.6 38.0 125-129 34.2974 38.0 34.0 38.0 25.2 38.0 130-134 33.63505 38.0 33.2 38.0 21.4 38.0 135-139 32.67295 38.0 32.6 38.0 15.0 38.0 140-144 31.453250000000004 37.2 29.8 38.0 13.0 38.0 145-149 29.849699999999995 36.0 28.0 38.0 5.6 38.0 150-151 22.034 27.0 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 0.0 18 3.0 19 5.0 20 9.0 21 8.0 22 16.0 23 6.0 24 14.0 25 10.0 26 23.0 27 29.0 28 36.0 29 39.0 30 46.0 31 71.0 32 89.0 33 125.0 34 209.0 35 446.0 36 1124.0 37 1686.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.61123708742757 10.808767951625095 6.651549508692366 35.92844545225498 2 21.725 10.9 36.425000000000004 30.95 3 17.9 22.125 27.825 32.15 4 23.125 27.800000000000004 23.625 25.45 5 23.280820205051263 32.13303325831458 25.806451612903224 18.779694923730933 6 20.5 33.300000000000004 23.775 22.425 7 14.549999999999999 29.775000000000002 40.65 15.024999999999999 8 17.675 22.45 35.25 24.625 9 17.8 21.5 36.325 24.375 10-14 19.655 30.285 28.050000000000004 22.009999999999998 15-19 20.01 28.634999999999998 27.884999999999998 23.47 20-24 20.369999999999997 28.22 27.305 24.104999999999997 25-29 20.485 28.51 27.845 23.16 30-34 20.105 28.77 27.515 23.61 35-39 20.86 27.875 27.755000000000003 23.51 40-44 20.085 28.625 27.339999999999996 23.95 45-49 20.72 28.51 27.26 23.51 50-54 19.845 28.7 27.185 24.27 55-59 20.175 29.025000000000002 26.529999999999998 24.27 60-64 19.830000000000002 29.095 27.034999999999997 24.04 65-69 20.465 28.02 27.229999999999997 24.285 70-74 20.435 28.51 27.375 23.68 75-79 20.445 27.96 27.665 23.93 80-84 20.335 28.475 27.615000000000002 23.575 85-89 20.495 28.544999999999998 27.034999999999997 23.925 90-94 20.62 28.475 27.13 23.775 95-99 20.665 28.144999999999996 27.51 23.68 100-104 20.805 27.92 27.83 23.445 105-109 21.105 28.375 26.950000000000003 23.57 110-114 20.515 28.244999999999997 27.755000000000003 23.485 115-119 20.45 28.235 27.750000000000004 23.565 120-124 20.794999999999998 28.660000000000004 26.900000000000002 23.645 125-129 21.015 27.77 27.345000000000002 23.87 130-134 21.425 27.950000000000003 27.455000000000002 23.169999999999998 135-139 20.74 28.194999999999997 27.565 23.5 140-144 21.195 28.134999999999998 27.084999999999997 23.585 145-149 21.64 28.095 26.784999999999997 23.48 150-151 20.825 27.474999999999998 28.1875 23.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 2.0 24 2.0 25 4.5 26 7.0 27 9.0 28 10.0 29 12.5 30 18.5 31 24.5 32 39.0 33 45.0 34 51.5 35 65.0 36 79.5 37 108.0 38 132.0 39 144.0 40 162.5 41 196.5 42 232.0 43 260.5 44 263.0 45 263.0 46 273.5 47 268.0 48 250.5 49 211.5 50 170.0 51 140.0 52 122.5 53 104.5 54 78.0 55 58.5 56 40.0 57 34.0 58 30.5 59 18.0 60 15.0 61 13.0 62 8.0 63 6.5 64 6.0 65 6.5 66 3.0 67 2.0 68 2.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.3250000000000002 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 1.9625 0.0 0.0 0.0 0.0 136-137 2.1500000000000004 0.0 0.0 0.0 0.0 138-139 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACCTC 10 0.006832588 144.9875 145 TTGGCTT 10 0.006832588 144.9875 8 >>END_MODULE SRR7168967 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168967_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88275 33.0 33.0 34.0 32.0 34.0 2 32.93875 33.0 33.0 34.0 32.0 34.0 3 32.86375 34.0 33.0 34.0 31.0 34.0 4 32.87675 34.0 33.0 34.0 32.0 34.0 5 32.848 34.0 33.0 34.0 31.0 34.0 6 37.0485 38.0 38.0 38.0 37.0 38.0 7 37.089 38.0 38.0 38.0 37.0 38.0 8 37.12675 38.0 38.0 38.0 37.0 38.0 9 37.168 38.0 38.0 38.0 37.0 38.0 10-14 37.10025 38.0 38.0 38.0 37.0 38.0 15-19 37.08200000000001 38.0 38.0 38.0 36.8 38.0 20-24 37.02015 38.0 38.0 38.0 36.6 38.0 25-29 36.938849999999995 38.0 38.0 38.0 36.0 38.0 30-34 36.893 38.0 38.0 38.0 36.0 38.0 35-39 36.79655 38.0 38.0 38.0 35.8 38.0 40-44 36.761900000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.6817 38.0 38.0 38.0 35.6 38.0 50-54 36.4106 38.0 38.0 38.0 34.2 38.0 55-59 36.33055 38.0 38.0 38.0 34.0 38.0 60-64 36.28675 38.0 38.0 38.0 33.8 38.0 65-69 36.13525 38.0 37.6 38.0 33.2 38.0 70-74 35.96665 38.0 37.0 38.0 33.0 38.0 75-79 35.6612 38.0 37.0 38.0 31.0 38.0 80-84 35.457350000000005 38.0 36.8 38.0 29.8 38.0 85-89 35.297549999999994 38.0 36.2 38.0 29.0 38.0 90-94 34.8764 38.0 35.8 38.0 28.0 38.0 95-99 34.61405 38.0 35.2 38.0 26.4 38.0 100-104 33.918150000000004 38.0 34.4 38.0 21.6 38.0 105-109 33.3325 38.0 33.0 38.0 17.4 38.0 110-114 32.856500000000004 37.8 32.2 38.0 14.8 38.0 115-119 31.924400000000002 37.0 30.4 38.0 13.8 38.0 120-124 30.71895 36.6 28.0 38.0 12.6 38.0 125-129 29.669400000000003 36.0 25.2 38.0 11.8 38.0 130-134 28.5132 33.8 21.8 38.0 5.6 38.0 135-139 27.534550000000003 33.0 19.0 38.0 2.0 38.0 140-144 25.8065 32.6 14.0 38.0 2.0 38.0 145-149 23.01905 30.4 4.0 37.8 2.0 38.0 150-151 16.387249999999998 15.0 2.0 32.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 3.0 5 1.0 6 5.0 7 2.0 8 2.0 9 0.0 10 4.0 11 1.0 12 5.0 13 4.0 14 4.0 15 5.0 16 10.0 17 10.0 18 18.0 19 8.0 20 19.0 21 25.0 22 34.0 23 28.0 24 39.0 25 42.0 26 62.0 27 48.0 28 57.0 29 62.0 30 102.0 31 160.0 32 229.0 33 272.0 34 496.0 35 764.0 36 995.0 37 471.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.800000000000004 14.825 12.025 28.349999999999998 2 27.72079059294471 17.988491368526393 32.724543407555664 21.56617463097323 3 17.926890335503252 22.033049574361545 41.011517275913874 19.028542814221332 4 23.15973960941412 32.323485227841765 24.236354531797698 20.28042063094642 5 24.887330996494743 36.80520781171758 20.330495743615423 17.97696544817226 6 19.204801200300075 37.109277319329834 23.355838959739934 20.330082520630157 7 21.030257564391096 20.38009502375594 39.58489622405602 19.004751187796952 8 19.954988747186796 25.331332833208304 28.132033008252062 26.581645411352838 9 20.655163790947736 22.83070767691923 29.957489372343087 26.556639159789945 10-14 22.692269226922694 28.59285928592859 27.16771677167717 21.547154715471546 15-19 22.95729572957296 27.597759775977597 27.917791779177918 21.527152715271527 20-24 22.754550910182036 28.180636127225444 27.450490098019603 21.614322864572916 25-29 22.794558911782357 28.100620124024804 27.600520104020802 21.504300860172034 30-34 22.680670167541887 27.451862965741437 28.097024256064017 21.770442610652662 35-39 22.21222122212221 27.952795279527955 28.332833283328334 21.5021502150215 40-44 22.7022702270227 28.17781778177818 27.747774777477748 21.372137213721373 45-49 23.10577644411103 27.60690172543136 28.192048012003003 21.09527381845461 50-54 22.58338750812622 27.414112116817524 28.364254638195728 21.63824573686053 55-59 23.359671934386878 27.420484096819365 27.835567113422684 21.384276855371073 60-64 23.54235423542354 27.27272727272727 28.05780578057806 21.127112711271128 65-69 23.1973197319732 27.25272527252725 28.002800280028 21.547154715471546 70-74 23.54353152972946 27.784167625143773 27.47912186828024 21.19317897684653 75-79 22.943441516227434 27.524128619292892 28.04420663099465 21.488223233485023 80-84 23.104620924184836 27.675535107021403 27.615523104620927 21.604320864172834 85-89 23.448517277591638 27.74916237435615 27.74916237435615 21.053157973696056 90-94 23.54235423542354 27.057705770577055 28.227822782278228 21.172117211721172 95-99 23.406170308515424 27.60138006900345 27.521376068803438 21.471073553677684 100-104 23.571178558927947 27.9813990699535 27.44137206860343 21.006050302515124 105-109 22.972297229722972 27.487748774877485 27.86278627862786 21.677167716771677 110-114 23.256162808140406 27.02135106755338 28.196409820491024 21.52607630381519 115-119 23.549709941988397 27.805561112222442 27.48049609921984 21.164232846569313 120-124 23.31082770692673 27.66191547886972 27.366841710427607 21.660415103775943 125-129 22.925731432858214 27.976994248562143 27.611902975743934 21.48537134283571 130-134 23.86477295459092 27.130426085217042 27.615523104620927 21.389277855571116 135-139 23.785946486621658 27.371842960740185 27.446861715428856 21.3953488372093 140-144 23.9747949589918 27.590518103620727 26.825365073014602 21.609321864372873 145-149 24.25621281064053 26.93134656732837 27.096354817740888 21.716085804290213 150-151 24.24053006625828 26.665833229153645 28.116014501812725 20.977622202775347 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 4.0 25 4.0 26 3.5 27 5.0 28 5.5 29 7.0 30 12.0 31 17.5 32 22.5 33 36.5 34 50.5 35 58.5 36 72.5 37 92.5 38 123.5 39 158.5 40 198.5 41 229.5 42 254.5 43 280.0 44 282.5 45 281.0 46 268.0 47 255.0 48 242.0 49 203.5 50 172.0 51 145.5 52 112.0 53 87.0 54 73.5 55 61.5 56 44.5 57 26.0 58 17.0 59 15.0 60 12.0 61 7.5 62 3.5 63 5.5 64 3.5 65 2.0 66 3.5 67 3.5 68 3.0 69 3.0 70 3.0 71 1.0 72 0.0 73 0.5 74 1.5 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 2.0 83 1.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 1.5 91 2.0 92 1.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.5 98 2.0 99 1.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.15 4 0.15 5 0.15 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.01 15-19 0.01 20-24 0.02 25-29 0.02 30-34 0.025 35-39 0.01 40-44 0.01 45-49 0.025 50-54 0.015 55-59 0.02 60-64 0.01 65-69 0.01 70-74 0.015 75-79 0.015 80-84 0.02 85-89 0.015 90-94 0.01 95-99 0.005 100-104 0.005 105-109 0.01 110-114 0.005 115-119 0.02 120-124 0.025 125-129 0.025 130-134 0.02 135-139 0.025 140-144 0.02 145-149 0.005 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49685534591195 98.875 2 0.42767295597484273 0.8500000000000001 3 0.025157232704402514 0.075 4 0.05031446540880503 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5875 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.7875 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 1.075 0.0 0.0 0.0 0.0 128-129 1.25 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.675 0.0 0.0 0.0 0.0 134-135 1.85 0.0 0.0 0.0 0.0 136-137 2.0250000000000004 0.0 0.0 0.0 0.0 138-139 2.1500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACAAA 10 0.006830828 145.0 5 ATTGATC 10 0.006830828 145.0 6 ACAGGAC 10 0.006830828 145.0 145 AAAAAAA 20 0.00593511 29.0 25-29 >>END_MODULE Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791815 spots for SRR7168967.sra Written 791815 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra Read 791814 spots for SRR7168967.sra Written 791814 spots for SRR7168967.sra SRR ids: ['SRR7168967.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z7t3bu7i SRR7168967.sra spots: 15836281 blocks: [[1, 791814], [791815, 1583628], [1583629, 2375442], [2375443, 3167256], [3167257, 3959070], [3959071, 4750884], [4750885, 5542698], [5542699, 6334512], [6334513, 7126326], [7126327, 7918140], [7918141, 8709954], [8709955, 9501768], [9501769, 10293582], [10293583, 11085396], [11085397, 11877210], [11877211, 12669024], [12669025, 13460838], [13460839, 14252652], [14252653, 15044466], [15044467, 15836281]] SRR7168967 file size 5344695 SRR7168967 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168967 SRR7168967_1.fastq SRR7168967_2.fastq Input file: SRR7168967_1.fastq Paired file: SRR7168967_2.fastq trimmed: SRR7168967-trimmed-pair1.fastq, SRR7168967-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:47:51 2025 >> started Mon Feb 10 12:48:09 2025 >> done (17.544s) 15836281 read pairs processed; of these: 11771 ( 0.07%) short read pairs filtered out after trimming by size control 8201 ( 0.05%) empty read pairs filtered out after trimming by size control 15816309 (99.87%) read pairs available; of these: 6678720 (42.23%) trimmed read pairs available after processing 9137589 (57.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 6 0.00% 21 3 0.00% 22 4 0.00% 23 2 0.00% 24 4 0.00% 25 2 0.00% 26 4 0.00% 27 1 0.00% 28 4 0.00% 29 4 0.00% 30 2 0.00% 31 5 0.00% 32 1 0.00% 33 5 0.00% 34 7 0.00% 35 5 0.00% 36 5 0.00% 37 6 0.00% 38 6 0.00% 39 8 0.00% 40 8 0.00% 41 4 0.00% 42 7 0.00% 43 10 0.00% 44 9 0.00% 45 7 0.00% 46 10 0.00% 47 10 0.00% 48 17 0.00% 49 15 0.00% 50 18 0.00% 51 12 0.00% 52 18 0.00% 53 20 0.00% 54 18 0.00% 55 20 0.00% 56 30 0.00% 57 34 0.00% 58 38 0.00% 59 30 0.00% 60 47 0.00% 61 75 0.00% 62 46 0.00% 63 63 0.00% 64 86 0.00% 65 88 0.00% 66 99 0.00% 67 125 0.00% 68 95 0.00% 69 192 0.00% 70 155 0.00% 71 238 0.00% 72 249 0.00% 73 276 0.00% 74 341 0.00% 75 331 0.00% 76 393 0.00% 77 400 0.00% 78 534 0.00% 79 533 0.00% 80 621 0.00% 81 794 0.01% 82 884 0.01% 83 1018 0.01% 84 1619 0.01% 85 1986 0.01% 86 2012 0.01% 87 2162 0.01% 88 2468 0.02% 89 2392 0.02% 90 2568 0.02% 91 2724 0.02% 92 3035 0.02% 93 3243 0.02% 94 3419 0.02% 95 3753 0.02% 96 3871 0.02% 97 4108 0.03% 98 4385 0.03% 99 4538 0.03% 100 4868 0.03% 101 5380 0.03% 102 5832 0.04% 103 6231 0.04% 104 6609 0.04% 105 7354 0.05% 106 7548 0.05% 107 7881 0.05% 108 8284 0.05% 109 8818 0.06% 110 9162 0.06% 111 9941 0.06% 112 10893 0.07% 113 11839 0.07% 114 12922 0.08% 115 13664 0.09% 116 14419 0.09% 117 15409 0.10% 118 16020 0.10% 119 16717 0.11% 120 17730 0.11% 121 19072 0.12% 122 20680 0.13% 123 22393 0.14% 124 24430 0.15% 125 26169 0.17% 126 27742 0.18% 127 28794 0.18% 128 30530 0.19% 129 32613 0.21% 130 34195 0.22% 131 36529 0.23% 132 39402 0.25% 133 42536 0.27% 134 45920 0.29% 135 49894 0.32% 136 54633 0.35% 137 59207 0.37% 138 64059 0.41% 139 68917 0.44% 140 75362 0.48% 141 84148 0.53% 142 93856 0.59% 143 107816 0.68% 144 127083 0.80% 145 153505 0.97% 146 192003 1.21% 147 260541 1.65% 148 387788 2.45% 149 730556 4.62% 150 3464436 21.90% 151 9137589 57.77% 15816309 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.25 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=238.14 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=13.9 sequence=CTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=223.93 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=27.1 sequence=AAGAAGAAGAAA SRR7168967 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:48:52 Started mapping on | Feb 10 12:48:52 Finished on | Feb 10 12:50:29 Mapping speed, Million of reads per hour | 587.00 Number of input reads | 15816309 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15025410 Uniquely mapped reads % | 95.00% Average mapped length | 296.47 Number of splices: Total | 14187811 Number of splices: Annotated (sjdb) | 13958607 Number of splices: GT/AG | 13975903 Number of splices: GC/AG | 166483 Number of splices: AT/AC | 13487 Number of splices: Non-canonical | 31938 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280227 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 106205 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 520787 520787 520787 N_multimapping 280227 280227 280227 N_noFeature 374393 14889117 426303 N_ambiguous 143526 1309 58034 UnstrandedReadsAssigned:14507491 PositiveStrandReadsAssigned:134984 NegativeStrandReadsAssigned:14541073 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168967 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168967-trimmed-pair1.fastq SRR7168967-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,816,309 reads, 14,508,190 reads pseudoaligned [quant] estimated average fragment length: 246.827 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52401 SRR7168967.ke.tsv 34699 SRR7168967.se.tsv 87100 total ==> SRR7168967.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.17 273 10.1056 Potri.005G024800.1.v4.1 1035 789.173 25 2.07814 Potri.004G059700.1.v4.1 961 715.182 7 0.642078 Potri.007G009000.2.v4.1 1416 1170.17 0 0 Potri.003G141000.2.v4.1 2943 2697.17 251.063 6.10633 Potri.016G087400.1.v4.1 270 68.9867 1422 1352.2 Potri.015G069301.1.v4.1 564 320.293 0 0 Potri.010G195200.1.v4.1 1773 1527.17 49 2.10482 Potri.012G127500.1.v4.1 977 731.182 8228 738.202 ==> SRR7168967.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1383 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 283 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168967 completed mapping pipeline successfully