Starting /dee2/code/volunteer_pipeline.sh SRR7168968 current disk space = 3058877382656 free memory = 1297496956 SRR7168968 SRAfilesize c8c4c2474fabcd977c84472a3d9d11dd SRR7168968.sra SRR7168968.sra file validated SRR7168968 is paired end SRR7168968 is conventional basespace SRR7168968 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168968_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2845 34.0 34.0 34.0 33.0 34.0 2 33.5055 34.0 34.0 34.0 33.0 34.0 3 33.54275 34.0 34.0 34.0 33.0 34.0 4 33.54125 34.0 34.0 34.0 33.0 34.0 5 33.5065 34.0 34.0 34.0 33.0 34.0 6 37.26675 38.0 38.0 38.0 36.0 38.0 7 37.405 38.0 38.0 38.0 37.0 38.0 8 37.5265 38.0 38.0 38.0 37.0 38.0 9 37.5045 38.0 38.0 38.0 37.0 38.0 10-14 37.569 38.0 38.0 38.0 37.8 38.0 15-19 37.5829 38.0 38.0 38.0 38.0 38.0 20-24 37.559 38.0 38.0 38.0 38.0 38.0 25-29 37.53465 38.0 38.0 38.0 38.0 38.0 30-34 37.5465 38.0 38.0 38.0 38.0 38.0 35-39 37.35445 38.0 38.0 38.0 37.0 38.0 40-44 37.3079 38.0 38.0 38.0 37.0 38.0 45-49 37.298700000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.204899999999995 38.0 38.0 38.0 36.4 38.0 55-59 37.13325 38.0 38.0 38.0 36.0 38.0 60-64 37.1136 38.0 38.0 38.0 36.0 38.0 65-69 37.0135 38.0 38.0 38.0 36.0 38.0 70-74 36.96165 38.0 38.0 38.0 36.0 38.0 75-79 36.8506 38.0 38.0 38.0 35.2 38.0 80-84 36.705200000000005 38.0 38.0 38.0 34.8 38.0 85-89 36.619150000000005 38.0 38.0 38.0 34.4 38.0 90-94 36.4368 38.0 38.0 38.0 33.8 38.0 95-99 36.33125 38.0 37.6 38.0 33.4 38.0 100-104 35.99249999999999 38.0 37.0 38.0 31.6 38.0 105-109 35.723400000000005 38.0 37.0 38.0 30.8 38.0 110-114 35.16795 38.0 36.4 38.0 28.8 38.0 115-119 34.89705 38.0 36.0 38.0 27.8 38.0 120-124 34.2467 38.0 34.6 38.0 24.8 38.0 125-129 33.88915 38.0 34.0 38.0 22.2 38.0 130-134 33.228699999999996 38.0 33.0 38.0 19.6 38.0 135-139 32.29395 38.0 31.8 38.0 14.4 38.0 140-144 31.177450000000004 36.2 29.2 38.0 12.8 38.0 145-149 29.392899999999997 36.0 27.4 38.0 3.8 38.0 150-151 21.4225 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 5.0 17 2.0 18 1.0 19 10.0 20 12.0 21 6.0 22 12.0 23 14.0 24 19.0 25 22.0 26 12.0 27 36.0 28 38.0 29 42.0 30 57.0 31 83.0 32 101.0 33 146.0 34 223.0 35 495.0 36 1053.0 37 1609.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.48374086211243 11.066296949836147 9.301739349634484 36.148222838416935 2 23.375 11.700000000000001 36.05 28.875 3 18.925 22.95 27.05 31.075000000000003 4 23.150000000000002 28.799999999999997 23.150000000000002 24.9 5 23.71056584877316 33.24987481221833 24.161241862794192 18.87831747621432 6 20.724999999999998 32.625 25.775 20.875 7 13.700000000000001 27.6 43.775 14.924999999999999 8 18.675 22.85 32.5 25.974999999999998 9 17.150000000000002 23.575 34.0 25.275 10-14 19.400000000000002 30.320000000000004 27.474999999999998 22.805 15-19 20.615 28.04 27.655 23.69 20-24 19.945 28.17 27.750000000000004 24.135 25-29 20.055 28.575 27.97 23.400000000000002 30-34 19.77 28.485 27.495000000000005 24.25 35-39 20.3 28.689999999999998 26.85 24.16 40-44 20.119999999999997 28.57 27.544999999999998 23.765 45-49 20.549999999999997 28.035 27.705000000000002 23.71 50-54 20.52 28.585 27.735 23.16 55-59 20.375 28.794999999999998 27.195000000000004 23.635 60-64 20.225 28.294999999999998 27.544999999999998 23.935000000000002 65-69 20.895 28.485 26.779999999999998 23.84 70-74 20.695 27.965 27.495000000000005 23.845 75-79 20.495 28.544999999999998 27.27 23.69 80-84 20.36 28.075 27.544999999999998 24.02 85-89 20.68 27.73 27.625 23.965 90-94 20.76 27.92 27.834999999999997 23.485 95-99 20.77 28.03 27.85 23.35 100-104 21.095 28.005000000000003 27.515 23.385 105-109 20.7 27.79 27.794999999999998 23.715 110-114 20.72 27.950000000000003 28.084999999999997 23.244999999999997 115-119 20.72 27.785 27.755000000000003 23.74 120-124 20.565 27.915 27.73 23.79 125-129 21.245 27.474999999999998 27.810000000000002 23.47 130-134 20.935000000000002 27.694999999999997 27.750000000000004 23.62 135-139 21.25 28.244999999999997 26.974999999999998 23.53 140-144 21.435000000000002 27.785 27.605 23.175 145-149 21.535 27.83 27.365000000000002 23.27 150-151 21.4 28.0625 27.224999999999998 23.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 1.0 24 2.5 25 3.5 26 3.5 27 6.5 28 9.0 29 7.0 30 10.0 31 22.0 32 38.0 33 46.0 34 44.5 35 61.0 36 99.5 37 121.5 38 136.0 39 151.0 40 175.5 41 220.0 42 236.5 43 247.5 44 265.5 45 263.0 46 267.5 47 260.0 48 221.0 49 193.0 50 175.0 51 150.0 52 119.5 53 98.0 54 81.0 55 57.5 56 44.0 57 37.0 58 28.5 59 19.0 60 13.5 61 11.5 62 12.0 63 9.5 64 5.0 65 4.0 66 4.5 67 4.0 68 4.0 69 4.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.425 0.0 0.0 0.0 0.0 124-125 1.7000000000000002 0.0 0.0 0.0 0.0 126-127 1.9625000000000001 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.525 0.0 0.0 0.0 0.0 134-135 2.7874999999999996 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACTA 10 0.006830828 145.0 8 TGAAACT 10 0.006830828 145.0 7 >>END_MODULE SRR7168968 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168968_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91175 33.0 33.0 34.0 32.0 34.0 2 33.00525 34.0 33.0 34.0 32.0 34.0 3 32.9205 34.0 33.0 34.0 31.0 34.0 4 32.9615 34.0 33.0 34.0 32.0 34.0 5 32.88325 34.0 33.0 34.0 31.0 34.0 6 37.13225 38.0 38.0 38.0 37.0 38.0 7 37.16875 38.0 38.0 38.0 37.0 38.0 8 37.2415 38.0 38.0 38.0 37.0 38.0 9 37.2295 38.0 38.0 38.0 37.0 38.0 10-14 37.146699999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.115649999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.06314999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.00255 38.0 38.0 38.0 36.6 38.0 30-34 36.923950000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.896 38.0 38.0 38.0 36.0 38.0 40-44 36.85875 38.0 38.0 38.0 36.0 38.0 45-49 36.75125 38.0 38.0 38.0 35.6 38.0 50-54 36.5951 38.0 38.0 38.0 34.8 38.0 55-59 36.51925000000001 38.0 38.0 38.0 34.8 38.0 60-64 36.39515 38.0 38.0 38.0 34.0 38.0 65-69 36.25945 38.0 38.0 38.0 34.0 38.0 70-74 36.15410000000001 38.0 37.6 38.0 33.6 38.0 75-79 35.9594 38.0 37.0 38.0 32.8 38.0 80-84 35.77995 38.0 37.0 38.0 31.8 38.0 85-89 35.6197 38.0 37.0 38.0 30.6 38.0 90-94 35.2022 38.0 36.0 38.0 28.8 38.0 95-99 34.999649999999995 38.0 36.0 38.0 28.6 38.0 100-104 34.2685 38.0 34.4 38.0 24.2 38.0 105-109 33.74705 38.0 33.2 38.0 22.0 38.0 110-114 33.140049999999995 38.0 33.0 38.0 16.8 38.0 115-119 32.38735 38.0 31.6 38.0 14.0 38.0 120-124 31.3077 37.0 28.8 38.0 13.2 38.0 125-129 30.14255 36.2 26.8 38.0 11.8 38.0 130-134 28.916950000000003 34.6 22.6 38.0 9.2 38.0 135-139 28.095999999999997 33.4 20.8 38.0 2.0 38.0 140-144 26.39655 33.0 13.4 38.0 2.0 38.0 145-149 24.037200000000002 31.8 6.4 38.0 2.0 38.0 150-151 17.19225 16.0 2.0 33.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 1.0 4 2.0 5 3.0 6 1.0 7 2.0 8 0.0 9 3.0 10 2.0 11 0.0 12 0.0 13 3.0 14 1.0 15 8.0 16 4.0 17 13.0 18 12.0 19 15.0 20 19.0 21 23.0 22 29.0 23 17.0 24 37.0 25 39.0 26 39.0 27 46.0 28 72.0 29 62.0 30 99.0 31 138.0 32 193.0 33 269.0 34 461.0 35 704.0 36 1049.0 37 616.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.75 12.25 15.5 28.499999999999996 2 31.721373089451266 15.960912052117262 30.74417439238286 21.57354046604861 3 18.931795386158477 24.247743229689068 36.55967903711134 20.260782347041122 4 23.846539618856568 32.34704112337011 23.37011033099298 20.43630892678034 5 24.805618259342864 35.54050664660146 21.29420617005267 18.35966892400301 6 20.085149010768845 37.94139744552968 22.33909341347358 19.634360130227897 7 20.06010518407213 20.31054345103932 39.644377660906585 19.984973703981968 8 21.91334835962935 24.993739043325817 27.498121712997747 25.59479088404708 9 21.337340345604808 24.142248935637365 30.40320560981718 24.117205108940645 10-14 22.66793377682189 29.035162306807383 26.824388535987598 21.472515380383133 15-19 23.1519455836751 28.21346403921176 27.493247974392315 21.141342402720817 20-24 23.065371909100012 28.035839423365704 27.169886875563122 21.728901791971168 25-29 22.91374824894937 28.46708024814889 27.736641985191113 20.882529517710626 30-34 23.036098733289943 28.228107945726734 27.807540179241975 20.92825314174135 35-39 23.12656328164082 28.029014507253624 27.71885942971486 21.125562781390695 40-44 23.152734003702037 28.11046075341438 27.565160838461157 21.171644404422434 45-49 22.58823529411765 27.709637046307883 27.774718397997493 21.927409261576972 50-54 22.788673203922354 28.447068240944567 27.556533920352212 21.20772463478087 55-59 23.382213102447324 27.08573144487263 27.646263950753212 21.88579150192683 60-64 22.64745610085547 28.495672619940965 27.485116814247835 21.371754464955725 65-69 23.01575393848462 27.701925481370342 27.47686921730433 21.80545136284071 70-74 23.547660745559167 28.241180885664246 27.420565424068048 20.79059294470853 75-79 23.280132085855808 27.923150047530893 27.55290939110422 21.24380847550908 80-84 23.677758318739052 28.096072054040533 27.350512884663498 20.875656742556917 85-89 23.941547392653387 27.91011910719648 27.13442097888099 21.013912521269145 90-94 23.3631771119892 27.35957585154804 28.304906717351074 20.97234031911169 95-99 23.567356735673567 28.192819281928195 27.142714271427142 21.097109710971097 100-104 23.467346734673466 27.95779577957796 27.742774277427745 20.83208320832083 105-109 23.86954781912765 27.3359343737495 27.55602240896359 21.238495398159262 110-114 23.868580287043056 28.02420363054458 27.099064859728962 21.008151222683402 115-119 23.823823823823822 28.303303303303302 27.027027027027028 20.845845845845844 120-124 22.663995993990987 28.212318477716575 28.012018027040558 21.111667501251876 125-129 22.973649934876264 28.44905320108206 26.996292956617573 21.58100390742411 130-134 24.172798718526305 27.331431145817692 27.211292986934975 21.284477148721027 135-139 24.086495144659125 28.14095505055561 26.859545500050054 20.913004304735207 140-144 23.2986389111289 27.91232986389111 27.527021617293833 21.26200960768615 145-149 24.70994198839768 27.820564112822566 26.630326065213044 20.839167833566712 150-151 24.359134675503313 28.02300862823559 27.022633487557833 20.595223208703263 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 2.5 22 3.0 23 1.5 24 2.0 25 2.0 26 3.0 27 4.0 28 5.0 29 11.0 30 16.0 31 18.0 32 25.5 33 30.0 34 36.5 35 51.0 36 67.5 37 98.5 38 133.5 39 156.5 40 195.0 41 230.0 42 245.5 43 261.5 44 273.0 45 276.5 46 276.0 47 259.5 48 233.0 49 206.5 50 171.5 51 157.0 52 139.5 53 105.5 54 73.0 55 48.5 56 35.0 57 26.0 58 24.5 59 20.5 60 13.5 61 10.5 62 6.0 63 5.0 64 6.5 65 5.0 66 3.0 67 1.5 68 1.5 69 2.5 70 2.5 71 1.0 72 0.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 1.5 97 1.5 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.3 4 0.3 5 0.325 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-14 0.034999999999999996 15-19 0.03 20-24 0.11 25-29 0.06 30-34 0.135 35-39 0.05 40-44 0.055 45-49 0.125 50-54 0.06 55-59 0.095 60-64 0.055 65-69 0.025 70-74 0.075 75-79 0.065 80-84 0.075 85-89 0.09 90-94 0.034999999999999996 95-99 0.01 100-104 0.01 105-109 0.04 110-114 0.015 115-119 0.1 120-124 0.15 125-129 0.19 130-134 0.11499999999999999 135-139 0.11 140-144 0.08 145-149 0.02 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.5031446540880503 1.0 3 0.025157232704402514 0.075 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.2625 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.7375 0.0 0.0 0.0 0.0 128-129 1.9874999999999998 0.0 0.0 0.0 0.0 130-131 2.1 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.675 0.0 0.0 0.0 0.0 138-139 2.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGGAAG 10 0.006830828 145.0 9 ATAGGAA 10 0.006830828 145.0 8 >>END_MODULE Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814007 spots for SRR7168968.sra Written 814007 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra Read 814006 spots for SRR7168968.sra Written 814006 spots for SRR7168968.sra SRR ids: ['SRR7168968.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zaf1cwwl SRR7168968.sra spots: 16280121 blocks: [[1, 814006], [814007, 1628012], [1628013, 2442018], [2442019, 3256024], [3256025, 4070030], [4070031, 4884036], [4884037, 5698042], [5698043, 6512048], [6512049, 7326054], [7326055, 8140060], [8140061, 8954066], [8954067, 9768072], [9768073, 10582078], [10582079, 11396084], [11396085, 12210090], [12210091, 13024096], [13024097, 13838102], [13838103, 14652108], [14652109, 15466114], [15466115, 16280121]] SRR7168968 file size 5495098 SRR7168968 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168968 SRR7168968_1.fastq SRR7168968_2.fastq Input file: SRR7168968_1.fastq Paired file: SRR7168968_2.fastq trimmed: SRR7168968-trimmed-pair1.fastq, SRR7168968-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:12:45 2025 >> started Mon Feb 10 13:13:04 2025 >> done (18.956s) 16280121 read pairs processed; of these: 15250 ( 0.09%) short read pairs filtered out after trimming by size control 10080 ( 0.06%) empty read pairs filtered out after trimming by size control 16254791 (99.84%) read pairs available; of these: 6890990 (42.39%) trimmed read pairs available after processing 9363801 (57.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 3 0.00% 21 6 0.00% 22 7 0.00% 23 4 0.00% 24 5 0.00% 25 0 0.00% 26 2 0.00% 27 5 0.00% 28 3 0.00% 29 8 0.00% 30 5 0.00% 31 4 0.00% 32 2 0.00% 33 4 0.00% 34 5 0.00% 35 0 0.00% 36 7 0.00% 37 4 0.00% 38 4 0.00% 39 4 0.00% 40 9 0.00% 41 11 0.00% 42 6 0.00% 43 6 0.00% 44 4 0.00% 45 6 0.00% 46 12 0.00% 47 10 0.00% 48 8 0.00% 49 18 0.00% 50 12 0.00% 51 18 0.00% 52 28 0.00% 53 25 0.00% 54 35 0.00% 55 42 0.00% 56 38 0.00% 57 41 0.00% 58 47 0.00% 59 68 0.00% 60 58 0.00% 61 73 0.00% 62 103 0.00% 63 90 0.00% 64 102 0.00% 65 109 0.00% 66 138 0.00% 67 164 0.00% 68 186 0.00% 69 212 0.00% 70 248 0.00% 71 302 0.00% 72 344 0.00% 73 420 0.00% 74 493 0.00% 75 466 0.00% 76 542 0.00% 77 573 0.00% 78 636 0.00% 79 748 0.00% 80 843 0.01% 81 1081 0.01% 82 1140 0.01% 83 1352 0.01% 84 2158 0.01% 85 2534 0.02% 86 2572 0.02% 87 2741 0.02% 88 2910 0.02% 89 3120 0.02% 90 3231 0.02% 91 3570 0.02% 92 3701 0.02% 93 4143 0.03% 94 4572 0.03% 95 4612 0.03% 96 4828 0.03% 97 5083 0.03% 98 5360 0.03% 99 5755 0.04% 100 6156 0.04% 101 6600 0.04% 102 7186 0.04% 103 7903 0.05% 104 8484 0.05% 105 8914 0.05% 106 9479 0.06% 107 9568 0.06% 108 9977 0.06% 109 10630 0.07% 110 11092 0.07% 111 12030 0.07% 112 13063 0.08% 113 14209 0.09% 114 15175 0.09% 115 16292 0.10% 116 17038 0.10% 117 17949 0.11% 118 18518 0.11% 119 19357 0.12% 120 20878 0.13% 121 21938 0.13% 122 23658 0.15% 123 25557 0.16% 124 27511 0.17% 125 29409 0.18% 126 31233 0.19% 127 32584 0.20% 128 33774 0.21% 129 35710 0.22% 130 37588 0.23% 131 39720 0.24% 132 43018 0.26% 133 46593 0.29% 134 49837 0.31% 135 53884 0.33% 136 58005 0.36% 137 62439 0.38% 138 67244 0.41% 139 71972 0.44% 140 78368 0.48% 141 86568 0.53% 142 97210 0.60% 143 111090 0.68% 144 130503 0.80% 145 157120 0.97% 146 195420 1.20% 147 263162 1.62% 148 390132 2.40% 149 736909 4.53% 150 3520485 21.66% 151 9363801 57.61% 16254791 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=33 prefix-density=0.17 prefix-fanout=3.1 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=9 fanout-score=247.15 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=30.5 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=33 prefix-density=0.29 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=293.89 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=28.9 sequence=AAGAAGAAGAAG SRR7168968 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:13:53 Started mapping on | Feb 10 13:13:54 Finished on | Feb 10 13:15:25 Mapping speed, Million of reads per hour | 643.05 Number of input reads | 16254791 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15465976 Uniquely mapped reads % | 95.15% Average mapped length | 296.06 Number of splices: Total | 14816586 Number of splices: Annotated (sjdb) | 14565403 Number of splices: GT/AG | 14584677 Number of splices: GC/AG | 184516 Number of splices: AT/AC | 13242 Number of splices: Non-canonical | 34151 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286260 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 32469 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 516125 516125 516125 N_multimapping 286260 286260 286260 N_noFeature 436911 15335510 488170 N_ambiguous 146496 2292 65251 UnstrandedReadsAssigned:14882569 PositiveStrandReadsAssigned:128174 NegativeStrandReadsAssigned:14912555 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168968 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168968-trimmed-pair1.fastq SRR7168968-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,254,791 reads, 14,790,860 reads pseudoaligned [quant] estimated average fragment length: 242.492 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,263 rounds 52401 SRR7168968.ke.tsv 34699 SRR7168968.se.tsv 87100 total ==> SRR7168968.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.51 363 14.7153 Potri.005G024800.1.v4.1 1035 793.508 47 4.26557 Potri.004G059700.1.v4.1 961 719.53 8 0.800704 Potri.007G009000.2.v4.1 1416 1174.51 0 0 Potri.003G141000.2.v4.1 2943 2701.51 248.066 6.6129 Potri.016G087400.1.v4.1 270 71.672 900 904.322 Potri.015G069301.1.v4.1 564 324.671 0 0 Potri.010G195200.1.v4.1 1773 1531.51 65 3.0565 Potri.012G127500.1.v4.1 977 735.513 7901 773.61 ==> SRR7168968.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1552 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 327 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 31 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168968 completed mapping pipeline successfully