Starting /dee2/code/volunteer_pipeline.sh SRR7168969 current disk space = 3058840637440 free memory = 1461383972 SRR7168969 SRAfilesize 493d2ad37d2681b4f7848f81885351df SRR7168969.sra SRR7168969.sra file validated SRR7168969 is paired end SRR7168969 is conventional basespace SRR7168969 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168969_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9835 34.0 33.0 34.0 33.0 34.0 2 33.3685 34.0 34.0 34.0 33.0 34.0 3 33.4735 34.0 34.0 34.0 33.0 34.0 4 33.49775 34.0 34.0 34.0 33.0 34.0 5 33.47125 34.0 34.0 34.0 33.0 34.0 6 37.239 38.0 38.0 38.0 36.0 38.0 7 37.4355 38.0 38.0 38.0 37.0 38.0 8 37.5485 38.0 38.0 38.0 37.0 38.0 9 37.5825 38.0 38.0 38.0 38.0 38.0 10-14 37.5647 38.0 38.0 38.0 38.0 38.0 15-19 37.55735 38.0 38.0 38.0 38.0 38.0 20-24 37.52765 38.0 38.0 38.0 38.0 38.0 25-29 37.4899 38.0 38.0 38.0 37.8 38.0 30-34 37.48185 38.0 38.0 38.0 38.0 38.0 35-39 37.43685 38.0 38.0 38.0 37.4 38.0 40-44 37.303200000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.2471 38.0 38.0 38.0 37.0 38.0 50-54 37.1853 38.0 38.0 38.0 36.8 38.0 55-59 37.21935 38.0 38.0 38.0 36.8 38.0 60-64 37.07455 38.0 38.0 38.0 36.0 38.0 65-69 37.111000000000004 38.0 38.0 38.0 36.2 38.0 70-74 37.08925 38.0 38.0 38.0 36.0 38.0 75-79 37.008700000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.97709999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.8973 38.0 38.0 38.0 35.8 38.0 90-94 36.8592 38.0 38.0 38.0 35.6 38.0 95-99 36.704499999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.5625 38.0 38.0 38.0 34.4 38.0 105-109 36.41475 38.0 38.0 38.0 34.0 38.0 110-114 36.27175 38.0 37.8 38.0 34.0 38.0 115-119 36.15044999999999 38.0 37.6 38.0 33.6 38.0 120-124 35.958000000000006 38.0 37.0 38.0 33.0 38.0 125-129 35.81995 38.0 37.0 38.0 32.2 38.0 130-134 35.6094 38.0 36.4 38.0 31.2 38.0 135-139 35.32144999999999 38.0 36.0 38.0 30.6 38.0 140-144 35.04665 38.0 35.8 38.0 29.4 38.0 145-149 34.47475 38.0 35.0 38.0 27.8 38.0 150-151 31.418125 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 0.0 16 3.0 17 2.0 18 0.0 19 4.0 20 7.0 21 1.0 22 0.0 23 11.0 24 5.0 25 10.0 26 18.0 27 27.0 28 15.0 29 34.0 30 33.0 31 66.0 32 55.0 33 78.0 34 137.0 35 194.0 36 548.0 37 2748.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.60991105463786 14.891994917407878 10.927573062261754 33.5705209656925 2 22.6 18.0 34.225 25.174999999999997 3 19.625 23.775 28.575 28.025 4 21.575 32.074999999999996 22.95 23.400000000000002 5 21.930482620655166 35.35883970992748 23.93098274568642 18.779694923730933 6 19.475 34.75 25.05 20.724999999999998 7 14.725 26.075 41.65 17.549999999999997 8 18.15 25.5 29.325000000000003 27.025 9 17.125 25.525 32.025 25.324999999999996 10-14 19.950000000000003 30.395 26.205000000000002 23.45 15-19 19.939999999999998 29.325000000000003 27.095000000000002 23.64 20-24 19.775000000000002 29.080000000000002 27.51 23.635 25-29 19.54 29.744999999999997 27.015 23.7 30-34 19.742961444216633 29.64444666700005 27.13407011051658 23.47852177826674 35-39 20.322112739458813 28.98514480068024 26.844395538438455 23.848346921422497 40-44 20.405 28.470000000000002 27.865000000000002 23.26 45-49 20.445 28.499999999999996 26.805 24.25 50-54 19.665 28.915000000000003 26.790000000000003 24.63 55-59 20.501025051252565 29.236461823091155 27.211360568028404 23.051152557627884 60-64 20.424999999999997 29.09 26.974999999999998 23.51 65-69 20.419999999999998 28.985 27.445000000000004 23.150000000000002 70-74 20.13 28.38 27.61 23.880000000000003 75-79 20.43 28.299999999999997 27.175 24.095 80-84 19.869999999999997 28.74 27.355 24.035 85-89 20.64 28.955 27.26 23.145 90-94 20.34 28.845 26.85 23.965 95-99 20.195 28.985 26.985 23.835 100-104 20.169999999999998 29.294999999999998 26.889999999999997 23.645 105-109 20.575 28.194999999999997 27.16 24.07 110-114 20.375 28.53 27.685 23.41 115-119 21.08 28.725 26.735 23.46 120-124 20.885 28.884999999999998 26.595000000000002 23.635 125-129 21.215 28.005000000000003 26.91 23.87 130-134 21.01 28.12 27.205000000000002 23.665 135-139 20.99209920992099 28.12281228122812 27.562756275627564 23.32233223322332 140-144 20.580000000000002 28.205000000000002 27.55 23.665 145-149 20.815 28.249999999999996 27.065 23.87 150-151 20.325 28.449999999999996 27.3625 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 1.0 21 0.5 22 0.5 23 0.0 24 1.0 25 2.5 26 7.0 27 10.5 28 11.5 29 14.0 30 20.5 31 28.0 32 36.0 33 44.0 34 56.5 35 69.5 36 80.5 37 112.0 38 140.0 39 150.5 40 181.5 41 223.5 42 246.0 43 255.5 44 268.0 45 277.5 46 260.5 47 245.0 48 231.0 49 211.0 50 177.0 51 137.0 52 118.5 53 98.5 54 70.0 55 50.5 56 43.5 57 34.5 58 23.5 59 15.5 60 12.0 61 9.5 62 5.5 63 1.0 64 2.0 65 4.0 66 3.0 67 2.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.034999999999999996 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.725 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.2625 0.0 0.0 0.0 0.0 136-137 1.2999999999999998 0.0 0.0 0.0 0.0 138-139 1.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168969 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168969_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88 33.0 33.0 34.0 32.0 34.0 2 33.0255 34.0 33.0 34.0 32.0 34.0 3 33.05525 34.0 33.0 34.0 32.0 34.0 4 32.96275 34.0 33.0 34.0 32.0 34.0 5 32.9385 34.0 33.0 34.0 32.0 34.0 6 37.133 38.0 38.0 38.0 37.0 38.0 7 37.1645 38.0 38.0 38.0 37.0 38.0 8 37.10375 38.0 38.0 38.0 37.0 38.0 9 37.14225 38.0 38.0 38.0 37.0 38.0 10-14 37.08535 38.0 38.0 38.0 36.8 38.0 15-19 37.0362 38.0 38.0 38.0 36.8 38.0 20-24 36.978300000000004 38.0 38.0 38.0 36.4 38.0 25-29 37.007349999999995 38.0 38.0 38.0 36.8 38.0 30-34 37.02185 38.0 38.0 38.0 36.8 38.0 35-39 36.95805 38.0 38.0 38.0 36.0 38.0 40-44 36.95575 38.0 38.0 38.0 36.0 38.0 45-49 36.89355 38.0 38.0 38.0 36.0 38.0 50-54 36.89045 38.0 38.0 38.0 36.0 38.0 55-59 36.8378 38.0 38.0 38.0 35.6 38.0 60-64 36.71915 38.0 38.0 38.0 35.4 38.0 65-69 36.60365 38.0 38.0 38.0 34.8 38.0 70-74 36.605399999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.50075 38.0 38.0 38.0 34.4 38.0 80-84 36.387750000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.326100000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.1314 38.0 38.0 38.0 33.0 38.0 95-99 35.99955 38.0 37.6 38.0 33.2 38.0 100-104 35.7725 38.0 37.0 38.0 31.4 38.0 105-109 35.73135 38.0 37.0 38.0 31.0 38.0 110-114 35.486749999999994 38.0 37.0 38.0 30.2 38.0 115-119 35.2769 38.0 36.8 38.0 29.2 38.0 120-124 35.015699999999995 38.0 36.0 38.0 28.0 38.0 125-129 34.75235 38.0 35.8 38.0 27.6 38.0 130-134 34.40475 38.0 35.2 38.0 24.6 38.0 135-139 34.033 38.0 35.0 38.0 22.6 38.0 140-144 33.59855 38.0 34.6 38.0 19.8 38.0 145-149 32.78125 38.0 34.0 38.0 14.0 38.0 150-151 28.823500000000003 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 3.0 9 2.0 10 1.0 11 3.0 12 1.0 13 4.0 14 4.0 15 2.0 16 2.0 17 5.0 18 7.0 19 6.0 20 11.0 21 13.0 22 13.0 23 15.0 24 21.0 25 21.0 26 25.0 27 30.0 28 42.0 29 44.0 30 53.0 31 53.0 32 75.0 33 100.0 34 149.0 35 281.0 36 605.0 37 2401.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.975 22.55 12.975 24.5 2 27.1 25.6 29.325000000000003 17.974999999999998 3 20.0 29.7 31.15 19.15 4 24.525 34.025 22.8 18.65 5 24.925 34.475 21.95 18.65 6 21.15 37.925 23.325000000000003 17.599999999999998 7 20.599999999999998 20.5 37.875 21.025 8 22.6 25.624999999999996 25.624999999999996 26.150000000000002 9 21.85 24.625 28.625 24.9 10-14 24.104999999999997 28.51 25.8 21.584999999999997 15-19 23.125 27.51 27.544999999999998 21.82 20-24 23.25 28.12 27.35 21.279999999999998 25-29 22.99 28.23 27.175 21.605 30-34 22.865 28.060000000000002 27.76 21.315 35-39 23.244999999999997 27.985 27.310000000000002 21.46 40-44 23.095 27.48 27.529999999999998 21.895 45-49 22.74 27.92 27.994999999999997 21.345 50-54 23.119999999999997 28.255000000000003 27.41 21.215 55-59 23.525 27.46 28.29 20.724999999999998 60-64 23.395 27.66 28.384999999999998 20.560000000000002 65-69 23.21 28.110000000000003 27.944999999999997 20.735 70-74 23.315 27.605 27.925 21.154999999999998 75-79 23.45 26.86 27.99 21.7 80-84 23.07 27.91 27.884999999999998 21.135 85-89 23.715 27.295 27.515 21.475 90-94 23.52 27.334999999999997 28.265 20.880000000000003 95-99 23.155 27.235 28.525 21.085 100-104 23.815 27.315 27.965 20.905 105-109 23.225 27.450000000000003 28.24 21.085 110-114 23.605 27.43 27.994999999999997 20.97 115-119 24.285 27.58 27.43 20.705000000000002 120-124 23.945 27.605 27.36 21.09 125-129 23.474999999999998 27.61 28.349999999999998 20.565 130-134 23.485 27.650000000000002 28.315 20.549999999999997 135-139 24.215 27.58 27.825 20.380000000000003 140-144 24.48 26.705000000000002 27.839999999999996 20.974999999999998 145-149 23.285 27.195000000000004 28.43 21.09 150-151 24.212500000000002 26.35 28.125 21.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 3.0 27 4.5 28 5.0 29 7.0 30 8.0 31 11.0 32 16.5 33 22.5 34 39.0 35 56.0 36 66.5 37 83.0 38 116.0 39 167.0 40 188.0 41 217.0 42 254.5 43 278.0 44 292.5 45 292.0 46 281.0 47 271.0 48 258.5 49 220.5 50 184.5 51 145.0 52 111.0 53 95.5 54 76.0 55 59.0 56 44.5 57 30.5 58 26.5 59 18.0 60 11.0 61 6.0 62 6.0 63 8.5 64 6.5 65 2.5 66 1.5 67 1.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.36250000000000004 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7875 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 1.0750000000000002 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.225 0.0 0.0 0.0 0.0 138-139 1.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAATAT 10 0.006830828 145.0 3 CAATATA 10 0.006830828 145.0 4 ATATGGA 10 0.006830828 145.0 6 AATATAG 10 0.006830828 145.0 5 TGAACAA 10 0.006830828 145.0 5 >>END_MODULE Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714874 spots for SRR7168969.sra Written 714874 spots for SRR7168969.sra Read 714888 spots for SRR7168969.sra Written 714888 spots for SRR7168969.sra SRR ids: ['SRR7168969.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kebtao38 SRR7168969.sra spots: 14297494 blocks: [[1, 714874], [714875, 1429748], [1429749, 2144622], [2144623, 2859496], [2859497, 3574370], [3574371, 4289244], [4289245, 5004118], [5004119, 5718992], [5718993, 6433866], [6433867, 7148740], [7148741, 7863614], [7863615, 8578488], [8578489, 9293362], [9293363, 10008236], [10008237, 10723110], [10723111, 11437984], [11437985, 12152858], [12152859, 12867732], [12867733, 13582606], [13582607, 14297494]] SRR7168969 file size 4823251 SRR7168969 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168969 SRR7168969_1.fastq SRR7168969_2.fastq Input file: SRR7168969_1.fastq Paired file: SRR7168969_2.fastq trimmed: SRR7168969-trimmed-pair1.fastq, SRR7168969-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:09:41 2025 >> started Mon Feb 10 13:09:58 2025 >> done (16.501s) 14297494 read pairs processed; of these: 15839 ( 0.11%) short read pairs filtered out after trimming by size control 11703 ( 0.08%) empty read pairs filtered out after trimming by size control 14269952 (99.81%) read pairs available; of these: 5549813 (38.89%) trimmed read pairs available after processing 8720139 (61.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 5 0.00% 21 5 0.00% 22 6 0.00% 23 6 0.00% 24 2 0.00% 25 4 0.00% 26 3 0.00% 27 2 0.00% 28 1 0.00% 29 3 0.00% 30 5 0.00% 31 5 0.00% 32 6 0.00% 33 6 0.00% 34 4 0.00% 35 5 0.00% 36 8 0.00% 37 4 0.00% 38 7 0.00% 39 8 0.00% 40 9 0.00% 41 5 0.00% 42 7 0.00% 43 7 0.00% 44 9 0.00% 45 11 0.00% 46 12 0.00% 47 15 0.00% 48 18 0.00% 49 20 0.00% 50 14 0.00% 51 8 0.00% 52 24 0.00% 53 22 0.00% 54 39 0.00% 55 29 0.00% 56 28 0.00% 57 26 0.00% 58 37 0.00% 59 31 0.00% 60 45 0.00% 61 50 0.00% 62 61 0.00% 63 65 0.00% 64 65 0.00% 65 78 0.00% 66 83 0.00% 67 94 0.00% 68 117 0.00% 69 147 0.00% 70 139 0.00% 71 179 0.00% 72 167 0.00% 73 196 0.00% 74 221 0.00% 75 265 0.00% 76 298 0.00% 77 323 0.00% 78 379 0.00% 79 427 0.00% 80 436 0.00% 81 556 0.00% 82 616 0.00% 83 747 0.01% 84 1403 0.01% 85 1853 0.01% 86 1999 0.01% 87 2070 0.01% 88 2196 0.02% 89 2244 0.02% 90 2290 0.02% 91 2444 0.02% 92 2648 0.02% 93 2637 0.02% 94 2898 0.02% 95 3013 0.02% 96 3095 0.02% 97 3327 0.02% 98 3433 0.02% 99 3737 0.03% 100 3948 0.03% 101 4189 0.03% 102 4490 0.03% 103 4793 0.03% 104 5218 0.04% 105 5624 0.04% 106 6017 0.04% 107 6310 0.04% 108 6694 0.05% 109 7031 0.05% 110 7446 0.05% 111 7849 0.06% 112 8462 0.06% 113 9048 0.06% 114 9918 0.07% 115 10336 0.07% 116 11106 0.08% 117 11703 0.08% 118 12257 0.09% 119 13011 0.09% 120 13672 0.10% 121 14374 0.10% 122 15394 0.11% 123 16697 0.12% 124 17891 0.13% 125 18917 0.13% 126 20490 0.14% 127 21422 0.15% 128 22683 0.16% 129 24226 0.17% 130 25777 0.18% 131 27896 0.20% 132 30107 0.21% 133 32972 0.23% 134 35712 0.25% 135 38440 0.27% 136 41863 0.29% 137 44607 0.31% 138 49035 0.34% 139 53391 0.37% 140 59063 0.41% 141 65854 0.46% 142 74109 0.52% 143 84756 0.59% 144 98890 0.69% 145 117833 0.83% 146 146465 1.03% 147 197073 1.38% 148 299867 2.10% 149 584263 4.09% 150 3053104 21.40% 151 8720139 61.11% 14269952 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=36 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.14 sequence-density-rank=7 fanout-score=93.76 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=17.1 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=38 prefix-density=0.21 prefix-fanout=2.4 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=10 fanout-score=52.17 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=13.3 sequence=TGTTGGTGGTGG SRR7168969 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:10:44 Started mapping on | Feb 10 13:10:45 Finished on | Feb 10 13:12:10 Mapping speed, Million of reads per hour | 604.37 Number of input reads | 14269952 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13341140 Uniquely mapped reads % | 93.49% Average mapped length | 297.11 Number of splices: Total | 12623829 Number of splices: Annotated (sjdb) | 12422295 Number of splices: GT/AG | 12446487 Number of splices: GC/AG | 142140 Number of splices: AT/AC | 10035 Number of splices: Non-canonical | 25167 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254317 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 63338 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.21% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 690107 690107 690107 N_multimapping 254317 254317 254317 N_noFeature 279879 13196209 331277 N_ambiguous 149144 770 55070 UnstrandedReadsAssigned:12912117 PositiveStrandReadsAssigned:144161 NegativeStrandReadsAssigned:12954793 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7168969 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168969-trimmed-pair1.fastq SRR7168969-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,269,952 reads, 12,895,186 reads pseudoaligned [quant] estimated average fragment length: 273.54 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR7168969.ke.tsv 34699 SRR7168969.se.tsv 87100 total ==> SRR7168969.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.46 238 9.75963 Potri.005G024800.1.v4.1 1035 762.46 27 2.53462 Potri.004G059700.1.v4.1 961 688.515 4 0.415827 Potri.007G009000.2.v4.1 1416 1143.46 0 0 Potri.003G141000.2.v4.1 2943 2670.46 201.025 5.38803 Potri.016G087400.1.v4.1 270 63.7903 899.521 1009.31 Potri.015G069301.1.v4.1 564 300.254 0 0 Potri.010G195200.1.v4.1 1773 1500.46 10 0.477026 Potri.012G127500.1.v4.1 977 704.492 4535 460.753 ==> SRR7168969.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 937 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 228 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168969 completed mapping pipeline successfully