Starting /dee2/code/volunteer_pipeline.sh SRR7168970 current disk space = 3059037782016 free memory = 1453195440 SRR7168970 SRAfilesize cc7042f8820fd802385f87da3eeaff54 SRR7168970.sra SRR7168970.sra file validated SRR7168970 is paired end SRR7168970 is conventional basespace SRR7168970 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168970_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.62175 34.0 34.0 34.0 33.0 34.0 2 33.69625 34.0 34.0 34.0 33.0 34.0 3 33.74525 34.0 34.0 34.0 33.0 34.0 4 33.72475 34.0 34.0 34.0 33.0 34.0 5 33.75825 34.0 34.0 34.0 33.0 34.0 6 37.52975 38.0 38.0 38.0 37.0 38.0 7 37.68775 38.0 38.0 38.0 38.0 38.0 8 37.717 38.0 38.0 38.0 38.0 38.0 9 37.587 38.0 38.0 38.0 38.0 38.0 10-14 37.7032 38.0 38.0 38.0 38.0 38.0 15-19 37.77735 38.0 38.0 38.0 38.0 38.0 20-24 37.73805 38.0 38.0 38.0 38.0 38.0 25-29 37.69525 38.0 38.0 38.0 38.0 38.0 30-34 37.66355 38.0 38.0 38.0 38.0 38.0 35-39 37.55105000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.43955 38.0 38.0 38.0 37.8 38.0 45-49 37.437 38.0 38.0 38.0 37.2 38.0 50-54 37.396300000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.35645 38.0 38.0 38.0 37.0 38.0 60-64 37.33425 38.0 38.0 38.0 37.0 38.0 65-69 37.3026 38.0 38.0 38.0 37.0 38.0 70-74 37.23105 38.0 38.0 38.0 37.0 38.0 75-79 37.1433 38.0 38.0 38.0 36.2 38.0 80-84 37.06725 38.0 38.0 38.0 36.2 38.0 85-89 37.05045 38.0 38.0 38.0 36.0 38.0 90-94 36.9269 38.0 38.0 38.0 36.0 38.0 95-99 36.90595 38.0 38.0 38.0 36.0 38.0 100-104 36.77130000000001 38.0 38.0 38.0 35.0 38.0 105-109 36.66585 38.0 38.0 38.0 35.0 38.0 110-114 36.5635 38.0 38.0 38.0 34.4 38.0 115-119 36.376999999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.2333 38.0 38.0 38.0 34.0 38.0 125-129 35.996700000000004 38.0 37.8 38.0 33.4 38.0 130-134 35.8052 38.0 37.0 38.0 33.0 38.0 135-139 35.565250000000006 38.0 36.8 38.0 31.8 38.0 140-144 35.2692 38.0 36.0 38.0 31.0 38.0 145-149 34.9051 38.0 36.0 38.0 30.0 38.0 150-151 31.763375000000003 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 3.0 17 3.0 18 2.0 19 3.0 20 5.0 21 3.0 22 8.0 23 5.0 24 3.0 25 18.0 26 13.0 27 16.0 28 16.0 29 28.0 30 28.0 31 30.0 32 39.0 33 52.0 34 85.0 35 143.0 36 453.0 37 3038.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.98495863624969 15.11657056906493 11.682125846076712 33.21634494860867 2 21.83591795897949 16.65832916458229 32.96648324162081 28.53926963481741 3 18.25 21.925 26.85 32.975 4 21.025 27.425 25.650000000000002 25.900000000000002 5 23.0 30.975 24.65 21.375 6 19.925 34.925 26.0 19.15 7 14.625 28.9 39.25 17.224999999999998 8 17.474999999999998 28.449999999999996 31.025000000000002 23.05 9 16.950000000000003 27.0 33.300000000000004 22.75 10-14 19.155 31.165 27.384999999999998 22.295 15-19 18.955 30.9 27.1 23.044999999999998 20-24 18.755 30.56 27.689999999999998 22.994999999999997 25-29 18.775 30.259999999999998 27.425 23.54 30-34 18.459999999999997 30.365 27.860000000000003 23.315 35-39 19.125 30.165 27.52 23.189999999999998 40-44 19.285 29.825000000000003 27.694999999999997 23.195 45-49 19.655 30.259999999999998 26.939999999999998 23.145 50-54 18.785 30.425 27.169999999999998 23.62 55-59 19.285 30.195 26.695 23.825 60-64 19.13 30.15 27.41 23.31 65-69 19.63 29.549999999999997 27.284999999999997 23.535 70-74 18.955 30.25 26.979999999999997 23.815 75-79 19.89 29.189999999999998 27.435 23.485 80-84 19.905 29.385 27.13 23.580000000000002 85-89 19.785 29.775000000000002 27.305 23.135 90-94 19.7 28.955 27.68 23.665 95-99 20.615 29.235 26.865 23.285 100-104 19.99 29.709999999999997 26.77 23.53 105-109 20.09 29.03 27.139999999999997 23.74 110-114 20.294999999999998 29.060000000000002 27.26 23.385 115-119 20.119999999999997 28.535 27.750000000000004 23.595 120-124 20.19 29.049999999999997 26.93 23.830000000000002 125-129 20.01 28.804999999999996 27.04 24.145 130-134 20.485 28.835 26.900000000000002 23.78 135-139 20.24 28.32 27.435 24.005000000000003 140-144 20.48 28.71 27.3 23.51 145-149 20.525 28.235 27.42 23.82 150-151 21.0625 28.125 26.5125 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.5 21 2.5 22 5.0 23 6.0 24 6.0 25 5.5 26 8.0 27 14.5 28 19.5 29 21.0 30 31.5 31 49.5 32 69.5 33 89.0 34 91.0 35 108.5 36 130.0 37 142.0 38 153.5 39 154.0 40 172.5 41 205.5 42 225.5 43 240.5 44 256.5 45 237.5 46 217.0 47 213.0 48 204.5 49 183.5 50 141.5 51 118.5 52 101.5 53 81.0 54 70.0 55 50.5 56 33.5 57 26.5 58 22.0 59 16.5 60 10.5 61 10.5 62 11.0 63 8.0 64 6.5 65 5.5 66 4.0 67 4.0 68 4.5 69 3.5 70 1.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.2 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.1500000000000004 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138-139 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168970 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168970_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.22675 34.0 33.0 34.0 33.0 34.0 2 33.30975 34.0 33.0 34.0 33.0 34.0 3 33.29075 34.0 33.0 34.0 33.0 34.0 4 33.29375 34.0 33.0 34.0 33.0 34.0 5 33.2605 34.0 33.0 34.0 33.0 34.0 6 37.4435 38.0 38.0 38.0 38.0 38.0 7 37.4385 38.0 38.0 38.0 38.0 38.0 8 37.402 38.0 38.0 38.0 38.0 38.0 9 37.4215 38.0 38.0 38.0 38.0 38.0 10-14 37.400400000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.28775 38.0 38.0 38.0 38.0 38.0 20-24 37.324749999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.30795 38.0 38.0 38.0 38.0 38.0 30-34 37.2704 38.0 38.0 38.0 38.0 38.0 35-39 37.2749 38.0 38.0 38.0 38.0 38.0 40-44 37.252750000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.1882 38.0 38.0 38.0 38.0 38.0 50-54 37.16375 38.0 38.0 38.0 37.6 38.0 55-59 37.154849999999996 38.0 38.0 38.0 37.8 38.0 60-64 37.07555000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.0634 38.0 38.0 38.0 37.0 38.0 70-74 36.9585 38.0 38.0 38.0 37.0 38.0 75-79 36.9358 38.0 38.0 38.0 36.8 38.0 80-84 36.86055 38.0 38.0 38.0 36.4 38.0 85-89 36.791450000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.71995 38.0 38.0 38.0 36.0 38.0 95-99 36.557050000000004 38.0 38.0 38.0 35.6 38.0 100-104 36.44115000000001 38.0 38.0 38.0 35.0 38.0 105-109 36.335950000000004 38.0 38.0 38.0 34.6 38.0 110-114 36.192899999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.0443 38.0 38.0 38.0 34.0 38.0 120-124 35.66415 38.0 37.8 38.0 32.6 38.0 125-129 35.46645 38.0 37.0 38.0 31.2 38.0 130-134 35.31805 38.0 37.2 38.0 31.0 38.0 135-139 34.8024 38.0 36.0 38.0 28.2 38.0 140-144 34.25365 38.0 35.4 38.0 25.0 38.0 145-149 33.631299999999996 38.0 34.0 38.0 20.4 38.0 150-151 29.757875 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 3.0 4 4.0 5 0.0 6 1.0 7 2.0 8 3.0 9 1.0 10 0.0 11 4.0 12 3.0 13 5.0 14 0.0 15 3.0 16 4.0 17 1.0 18 4.0 19 3.0 20 5.0 21 10.0 22 6.0 23 7.0 24 14.0 25 12.0 26 18.0 27 22.0 28 21.0 29 19.0 30 25.0 31 35.0 32 49.0 33 65.0 34 99.0 35 171.0 36 447.0 37 2919.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.703277458093574 22.59194395796848 15.161371028271203 24.54340755566675 2 26.275 27.775 28.999999999999996 16.950000000000003 3 20.575 30.525000000000002 29.549999999999997 19.35 4 24.349999999999998 32.800000000000004 23.849999999999998 19.0 5 24.65 34.925 22.25 18.175 6 21.4 35.975 24.6 18.025 7 22.05 20.424999999999997 37.625 19.900000000000002 8 21.9 24.775 27.250000000000004 26.075 9 20.8 25.724999999999998 29.549999999999997 23.925 10-14 24.425 28.265 25.785000000000004 21.525 15-19 23.150000000000002 27.565 27.485 21.8 20-24 22.985 27.76 27.994999999999997 21.26 25-29 24.18 27.765 27.345000000000002 20.71 30-34 23.150000000000002 27.775 27.985 21.09 35-39 23.46 27.950000000000003 27.61 20.979999999999997 40-44 23.485 28.21 27.41 20.895 45-49 23.94 27.445000000000004 27.42 21.195 50-54 23.305 27.944999999999997 28.075 20.674999999999997 55-59 24.255 27.384999999999998 27.805000000000003 20.555 60-64 23.244999999999997 27.905 28.17 20.68 65-69 23.69 28.655 27.029999999999998 20.625 70-74 24.13 28.015 26.55 21.305 75-79 23.665 27.345000000000002 27.845 21.145 80-84 23.54 28.28 27.88 20.3 85-89 24.175 27.800000000000004 27.655 20.369999999999997 90-94 23.855 27.875 28.115000000000002 20.155 95-99 23.455000000000002 27.889999999999997 28.175 20.48 100-104 23.64 27.694999999999997 28.044999999999998 20.62 105-109 23.555 27.939999999999998 27.99 20.515 110-114 23.544999999999998 28.075 27.905 20.474999999999998 115-119 23.785 27.68 28.775000000000002 19.759999999999998 120-124 23.79 27.694999999999997 28.585 19.93 125-129 23.665 27.73 28.375 20.23 130-134 23.275000000000002 27.435 28.720000000000002 20.57 135-139 23.69 27.62 28.82 19.869999999999997 140-144 24.215 28.67 27.515 19.6 145-149 24.325 27.705000000000002 28.1 19.869999999999997 150-151 24.6625 26.687499999999996 28.8875 19.7625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 1.0 25 2.0 26 3.5 27 4.5 28 5.5 29 8.5 30 17.0 31 21.5 32 22.5 33 36.0 34 51.0 35 61.5 36 78.5 37 95.0 38 116.0 39 151.0 40 194.0 41 225.0 42 252.5 43 283.5 44 284.0 45 264.5 46 238.5 47 248.5 48 249.0 49 206.5 50 180.5 51 150.0 52 115.5 53 94.5 54 79.0 55 64.0 56 50.5 57 34.5 58 21.5 59 19.0 60 13.0 61 7.5 62 8.0 63 8.0 64 8.0 65 4.5 66 1.5 67 0.5 68 1.5 69 2.0 70 0.5 71 1.0 72 2.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 1.1124999999999998 0.0 0.0 0.0 0.0 120-121 1.2 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.1125 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.4749999999999996 0.0 0.0 0.0 0.0 138-139 2.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACTA 10 0.006830828 145.0 8 CAACTAA 10 0.006830828 145.0 9 >>END_MODULE Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680225 spots for SRR7168970.sra Written 680225 spots for SRR7168970.sra Read 680235 spots for SRR7168970.sra Written 680235 spots for SRR7168970.sra SRR ids: ['SRR7168970.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_po8m3ks1 SRR7168970.sra spots: 13604510 blocks: [[1, 680225], [680226, 1360450], [1360451, 2040675], [2040676, 2720900], [2720901, 3401125], [3401126, 4081350], [4081351, 4761575], [4761576, 5441800], [5441801, 6122025], [6122026, 6802250], [6802251, 7482475], [7482476, 8162700], [8162701, 8842925], [8842926, 9523150], [9523151, 10203375], [10203376, 10883600], [10883601, 11563825], [11563826, 12244050], [12244051, 12924275], [12924276, 13604510]] SRR7168970 file size 4588421 SRR7168970 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168970 SRR7168970_1.fastq SRR7168970_2.fastq Input file: SRR7168970_1.fastq Paired file: SRR7168970_2.fastq trimmed: SRR7168970-trimmed-pair1.fastq, SRR7168970-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:45:51 2025 >> started Mon Feb 10 13:46:07 2025 >> done (15.761s) 13604510 read pairs processed; of these: 25108 ( 0.18%) short read pairs filtered out after trimming by size control 17002 ( 0.12%) empty read pairs filtered out after trimming by size control 13562400 (99.69%) read pairs available; of these: 5243374 (38.66%) trimmed read pairs available after processing 8319026 (61.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 17 0.00% 20 7 0.00% 21 8 0.00% 22 12 0.00% 23 13 0.00% 24 17 0.00% 25 9 0.00% 26 10 0.00% 27 6 0.00% 28 9 0.00% 29 9 0.00% 30 12 0.00% 31 16 0.00% 32 5 0.00% 33 9 0.00% 34 19 0.00% 35 12 0.00% 36 10 0.00% 37 9 0.00% 38 21 0.00% 39 10 0.00% 40 11 0.00% 41 10 0.00% 42 17 0.00% 43 11 0.00% 44 18 0.00% 45 25 0.00% 46 29 0.00% 47 29 0.00% 48 17 0.00% 49 24 0.00% 50 22 0.00% 51 21 0.00% 52 38 0.00% 53 29 0.00% 54 40 0.00% 55 29 0.00% 56 45 0.00% 57 40 0.00% 58 54 0.00% 59 48 0.00% 60 65 0.00% 61 60 0.00% 62 85 0.00% 63 73 0.00% 64 95 0.00% 65 106 0.00% 66 89 0.00% 67 123 0.00% 68 165 0.00% 69 227 0.00% 70 325 0.00% 71 269 0.00% 72 245 0.00% 73 226 0.00% 74 263 0.00% 75 311 0.00% 76 337 0.00% 77 376 0.00% 78 385 0.00% 79 454 0.00% 80 548 0.00% 81 590 0.00% 82 666 0.00% 83 907 0.01% 84 1976 0.01% 85 2619 0.02% 86 2887 0.02% 87 3009 0.02% 88 3190 0.02% 89 3084 0.02% 90 3284 0.02% 91 3275 0.02% 92 3405 0.03% 93 3628 0.03% 94 3842 0.03% 95 3994 0.03% 96 4190 0.03% 97 4560 0.03% 98 4737 0.03% 99 4732 0.03% 100 5255 0.04% 101 5500 0.04% 102 5958 0.04% 103 6321 0.05% 104 6751 0.05% 105 7352 0.05% 106 7790 0.06% 107 8172 0.06% 108 8373 0.06% 109 8895 0.07% 110 9421 0.07% 111 9929 0.07% 112 10705 0.08% 113 11508 0.08% 114 12305 0.09% 115 12882 0.09% 116 13239 0.10% 117 14215 0.10% 118 14912 0.11% 119 15376 0.11% 120 15869 0.12% 121 16393 0.12% 122 17637 0.13% 123 18625 0.14% 124 20320 0.15% 125 21421 0.16% 126 22466 0.17% 127 23668 0.17% 128 24876 0.18% 129 26077 0.19% 130 27793 0.20% 131 28944 0.21% 132 31084 0.23% 133 33650 0.25% 134 36564 0.27% 135 39204 0.29% 136 41668 0.31% 137 45464 0.34% 138 48479 0.36% 139 51867 0.38% 140 56390 0.42% 141 60724 0.45% 142 66476 0.49% 143 74736 0.55% 144 86110 0.63% 145 102824 0.76% 146 125608 0.93% 147 166808 1.23% 148 255892 1.89% 149 501744 3.70% 150 2894925 21.35% 151 8319026 61.34% 13562400 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.92 fanout-score-rank=27 prefix-density=0.20 prefix-fanout=2.9 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=134.48 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=22.4 sequence=TCATCTTCACAAAC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.33 fanout-score-rank=23 prefix-density=0.33 prefix-fanout=3.3 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=295.24 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=28.9 sequence=AAGAAGAAGAAG SRR7168970 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:46:54 Started mapping on | Feb 10 13:46:55 Finished on | Feb 10 13:48:28 Mapping speed, Million of reads per hour | 525.00 Number of input reads | 13562400 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12762606 Uniquely mapped reads % | 94.10% Average mapped length | 296.50 Number of splices: Total | 10380098 Number of splices: Annotated (sjdb) | 10182042 Number of splices: GT/AG | 10210421 Number of splices: GC/AG | 129929 Number of splices: AT/AC | 9664 Number of splices: Non-canonical | 30084 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.68 Insertion rate per base | 0.03% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255033 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 80835 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 568837 568837 568837 N_multimapping 255033 255033 255033 N_noFeature 355023 12593743 422445 N_ambiguous 160212 950 58169 UnstrandedReadsAssigned:12247371 PositiveStrandReadsAssigned:167913 NegativeStrandReadsAssigned:12281992 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168970 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168970-trimmed-pair1.fastq SRR7168970-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,562,400 reads, 12,303,053 reads pseudoaligned [quant] estimated average fragment length: 248.092 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR7168970.ke.tsv 34699 SRR7168970.se.tsv 87100 total ==> SRR7168970.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.91 244 9.87517 Potri.005G024800.1.v4.1 1035 787.908 94 8.55073 Potri.004G059700.1.v4.1 961 713.931 3 0.301173 Potri.007G009000.2.v4.1 1416 1168.91 0 0 Potri.003G141000.2.v4.1 2943 2695.91 205 5.45004 Potri.016G087400.1.v4.1 270 68.7833 1375 1432.75 Potri.015G069301.1.v4.1 564 319.858 0 0 Potri.010G195200.1.v4.1 1773 1525.91 99 4.65005 Potri.012G127500.1.v4.1 977 729.914 8405 825.31 ==> SRR7168970.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1768 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 335 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7168970 completed mapping pipeline successfully