Starting /dee2/code/volunteer_pipeline.sh SRR7168971 current disk space = 3058921426944 free memory = 1282726328 SRR7168971 SRAfilesize 9248b5926ffbe9f51db72ed19be52443 SRR7168971.sra SRR7168971.sra file validated SRR7168971 is paired end SRR7168971 is conventional basespace SRR7168971 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168971_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0675 34.0 34.0 34.0 33.0 34.0 2 33.4635 34.0 34.0 34.0 33.0 34.0 3 33.5225 34.0 34.0 34.0 33.0 34.0 4 33.534 34.0 34.0 34.0 33.0 34.0 5 33.54675 34.0 34.0 34.0 33.0 34.0 6 37.26475 38.0 38.0 38.0 36.0 38.0 7 37.52175 38.0 38.0 38.0 37.0 38.0 8 37.50725 38.0 38.0 38.0 38.0 38.0 9 37.589 38.0 38.0 38.0 38.0 38.0 10-14 37.58175 38.0 38.0 38.0 38.0 38.0 15-19 37.579750000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.5702 38.0 38.0 38.0 38.0 38.0 25-29 37.51585 38.0 38.0 38.0 38.0 38.0 30-34 37.50865 38.0 38.0 38.0 38.0 38.0 35-39 37.45054999999999 38.0 38.0 38.0 37.4 38.0 40-44 37.3274 38.0 38.0 38.0 37.0 38.0 45-49 37.31135 38.0 38.0 38.0 37.0 38.0 50-54 37.27565 38.0 38.0 38.0 37.0 38.0 55-59 37.263099999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.13205 38.0 38.0 38.0 36.0 38.0 65-69 37.088550000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.119200000000006 38.0 38.0 38.0 36.2 38.0 75-79 37.0084 38.0 38.0 38.0 36.0 38.0 80-84 37.001099999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.93325 38.0 38.0 38.0 35.8 38.0 90-94 36.8849 38.0 38.0 38.0 35.4 38.0 95-99 36.792350000000006 38.0 38.0 38.0 35.2 38.0 100-104 36.6522 38.0 38.0 38.0 34.4 38.0 105-109 36.5146 38.0 38.0 38.0 34.0 38.0 110-114 36.354499999999994 38.0 38.0 38.0 34.0 38.0 115-119 36.16995 38.0 37.2 38.0 33.4 38.0 120-124 36.05415 38.0 37.0 38.0 33.0 38.0 125-129 35.888850000000005 38.0 37.0 38.0 32.6 38.0 130-134 35.73025 38.0 36.4 38.0 31.8 38.0 135-139 35.451499999999996 38.0 36.0 38.0 31.0 38.0 140-144 35.070949999999996 38.0 35.8 38.0 29.2 38.0 145-149 34.5017 38.0 35.0 38.0 27.8 38.0 150-151 31.525 36.5 31.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 7.0 18 2.0 19 0.0 20 1.0 21 4.0 22 5.0 23 8.0 24 7.0 25 18.0 26 17.0 27 15.0 28 18.0 29 24.0 30 39.0 31 49.0 32 42.0 33 77.0 34 107.0 35 236.0 36 541.0 37 2780.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.81361097003555 12.62061960385983 8.760792280345353 35.80497714575927 2 21.45 17.125 35.925000000000004 25.5 3 19.25 22.400000000000002 27.3 31.05 4 21.65 29.825000000000003 24.025 24.5 5 22.18054513628407 33.908477119279816 23.95598899724931 19.954988747186796 6 19.35 35.775 24.7 20.175 7 15.45 25.75 40.050000000000004 18.75 8 17.7 25.05 31.8 25.45 9 17.625 24.075 32.0 26.3 10-14 19.650000000000002 29.82 26.865 23.665 15-19 20.265 28.384999999999998 27.74 23.61 20-24 19.689999999999998 28.345 27.26 24.705 25-29 20.169999999999998 29.095 26.534999999999997 24.2 30-34 19.930996549827494 29.166458322916146 27.58137906895345 23.321166058302914 35-39 20.358053708056207 28.749312396859526 27.00405060759114 23.888583287493123 40-44 20.29101455072754 29.091454572728637 27.411370568528426 23.2061603080154 45-49 20.46102305115256 28.151407570378517 27.501375068753436 23.886194309715485 50-54 20.169999999999998 28.455000000000002 27.33 24.044999999999998 55-59 20.261013050652533 28.491424571228563 27.431371568578427 23.816190809540476 60-64 20.115 28.125 27.785 23.974999999999998 65-69 20.29 28.76 26.924999999999997 24.025 70-74 20.345 27.935 27.785 23.935000000000002 75-79 19.885 28.58 27.589999999999996 23.945 80-84 20.136006800340017 29.071453572678635 27.04135206760338 23.751187559377968 85-89 20.236011800590028 28.086404320216012 28.021401070053503 23.656182809140457 90-94 20.29 28.59 27.115000000000002 24.005000000000003 95-99 20.61 28.804999999999996 27.224999999999998 23.36 100-104 20.395 28.249999999999996 27.55 23.805 105-109 20.585 28.035 27.334999999999997 24.044999999999998 110-114 20.580000000000002 28.49 27.310000000000002 23.62 115-119 20.665 28.51 26.745 24.08 120-124 21.05 28.04 27.365000000000002 23.544999999999998 125-129 20.34 28.42 27.505000000000003 23.735 130-134 20.615 27.815 27.544999999999998 24.025 135-139 21.161058052902646 28.496424821241064 27.191359567978402 23.151157557877895 140-144 21.22 28.15 27.105 23.525 145-149 21.025 28.275 27.365000000000002 23.335 150-151 20.375 28.375 27.400000000000002 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.5 24 2.0 25 2.5 26 4.0 27 9.0 28 9.0 29 6.5 30 14.0 31 29.0 32 40.5 33 50.0 34 60.5 35 69.5 36 89.5 37 92.5 38 106.0 39 145.5 40 200.5 41 225.0 42 229.0 43 274.5 44 271.5 45 251.0 46 256.0 47 256.0 48 237.0 49 206.0 50 176.0 51 145.5 52 115.0 53 98.5 54 84.0 55 61.0 56 45.5 57 33.5 58 22.5 59 18.0 60 17.5 61 8.0 62 5.5 63 4.5 64 3.0 65 5.5 66 6.0 67 4.0 68 3.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.015 40-44 0.005 45-49 0.005 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.1749999999999998 0.0 0.0 0.0 0.0 132-133 1.3250000000000002 0.0 0.0 0.0 0.0 134-135 1.45 0.0 0.0 0.0 0.0 136-137 1.7625 0.0 0.0 0.0 0.0 138-139 1.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGCTT 10 0.0068378756 144.95 145 TCTCAAG 10 0.0068378756 144.95 3 CTCAAGA 10 0.0068378756 144.95 4 >>END_MODULE SRR7168971 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168971_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99825 33.0 33.0 34.0 32.0 34.0 2 33.1265 34.0 33.0 34.0 33.0 34.0 3 33.14275 34.0 33.0 34.0 33.0 34.0 4 33.15 34.0 33.0 34.0 33.0 34.0 5 33.107 34.0 33.0 34.0 33.0 34.0 6 37.33925 38.0 38.0 38.0 37.0 38.0 7 37.379 38.0 38.0 38.0 37.0 38.0 8 37.31075 38.0 38.0 38.0 37.0 38.0 9 37.30475 38.0 38.0 38.0 37.0 38.0 10-14 37.28505 38.0 38.0 38.0 37.2 38.0 15-19 37.25945 38.0 38.0 38.0 37.0 38.0 20-24 37.24685 38.0 38.0 38.0 37.0 38.0 25-29 37.2401 38.0 38.0 38.0 37.0 38.0 30-34 37.239050000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.1799 38.0 38.0 38.0 37.0 38.0 40-44 37.17620000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.1315 38.0 38.0 38.0 37.0 38.0 50-54 37.089299999999994 38.0 38.0 38.0 36.4 38.0 55-59 37.0727 38.0 38.0 38.0 36.4 38.0 60-64 36.9816 38.0 38.0 38.0 36.0 38.0 65-69 36.852 38.0 38.0 38.0 35.8 38.0 70-74 36.82535 38.0 38.0 38.0 35.8 38.0 75-79 36.7736 38.0 38.0 38.0 35.8 38.0 80-84 36.67785 38.0 38.0 38.0 35.0 38.0 85-89 36.62395 38.0 38.0 38.0 35.2 38.0 90-94 36.5419 38.0 38.0 38.0 34.6 38.0 95-99 36.452600000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.2652 38.0 38.0 38.0 34.0 38.0 105-109 36.2118 38.0 38.0 38.0 34.0 38.0 110-114 35.988800000000005 38.0 37.6 38.0 33.0 38.0 115-119 35.821999999999996 38.0 37.0 38.0 32.2 38.0 120-124 35.487 38.0 36.6 38.0 30.2 38.0 125-129 35.35205 38.0 36.2 38.0 29.4 38.0 130-134 34.98485 38.0 36.0 38.0 28.6 38.0 135-139 34.634299999999996 38.0 35.4 38.0 26.8 38.0 140-144 34.1356 38.0 35.0 38.0 23.6 38.0 145-149 33.569050000000004 38.0 34.6 38.0 19.2 38.0 150-151 29.430625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 2.0 6 0.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 2.0 13 1.0 14 5.0 15 0.0 16 2.0 17 3.0 18 4.0 19 4.0 20 9.0 21 11.0 22 8.0 23 14.0 24 8.0 25 18.0 26 26.0 27 28.0 28 24.0 29 41.0 30 30.0 31 52.0 32 52.0 33 79.0 34 137.0 35 233.0 36 616.0 37 2582.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.525 22.325 12.55 27.6 2 25.3 27.500000000000004 30.425 16.775000000000002 3 19.675 28.4 31.075000000000003 20.849999999999998 4 22.15 34.875 23.425 19.55 5 25.025 36.95 21.475 16.55 6 20.7 37.724999999999994 22.95 18.625 7 19.875 20.3 38.35 21.475 8 21.224999999999998 25.3 26.575 26.900000000000002 9 20.674999999999997 24.099999999999998 30.375000000000004 24.85 10-14 22.95 28.249999999999996 26.76 22.040000000000003 15-19 22.185 27.975 28.105000000000004 21.735 20-24 22.725 28.544999999999998 27.700000000000003 21.029999999999998 25-29 22.84 27.875 28.18 21.105 30-34 22.78 27.825 27.96 21.435000000000002 35-39 22.655 27.76 28.15 21.435000000000002 40-44 23.13 27.839999999999996 28.345 20.685000000000002 45-49 22.555 27.935 28.134999999999998 21.375 50-54 22.465 28.38 27.894999999999996 21.26 55-59 23.474999999999998 28.09 27.785 20.65 60-64 22.384999999999998 28.189999999999998 28.305000000000003 21.12 65-69 23.3 27.865000000000002 27.495000000000005 21.34 70-74 23.385 28.475 27.825 20.315 75-79 23.544999999999998 27.775 27.839999999999996 20.84 80-84 23.78 28.705000000000002 27.139999999999997 20.375 85-89 23.59 28.360000000000003 27.325 20.724999999999998 90-94 23.1 28.660000000000004 27.18 21.060000000000002 95-99 23.445 27.85 27.839999999999996 20.865000000000002 100-104 23.77 27.955000000000002 27.72 20.555 105-109 23.66 27.63 27.794999999999998 20.915 110-114 23.935000000000002 27.334999999999997 27.685 21.044999999999998 115-119 23.44 28.1 27.884999999999998 20.575 120-124 23.16 27.675 28.16 21.005 125-129 23.799999999999997 27.845 27.889999999999997 20.465 130-134 23.97 27.565 27.450000000000003 21.015 135-139 23.830000000000002 27.395000000000003 27.825 20.95 140-144 23.580000000000002 27.92 27.445000000000004 21.055 145-149 24.39 27.87 27.284999999999997 20.455000000000002 150-151 23.7875 27.500000000000004 27.775 20.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 1.5 25 0.5 26 3.0 27 4.5 28 6.5 29 10.0 30 12.0 31 13.5 32 16.5 33 27.5 34 37.5 35 55.0 36 81.0 37 97.0 38 134.0 39 182.5 40 219.5 41 241.0 42 261.0 43 272.5 44 283.5 45 291.5 46 280.5 47 281.0 48 243.0 49 189.0 50 162.0 51 144.5 52 119.5 53 84.5 54 69.5 55 50.5 56 32.5 57 28.5 58 16.5 59 8.5 60 7.0 61 5.5 62 4.0 63 3.5 64 4.5 65 4.0 66 3.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.1749999999999998 0.0 0.0 0.0 0.0 132-133 1.2999999999999998 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.7375 0.0 0.0 0.0 0.0 138-139 1.9249999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra Read 660077 spots for SRR7168971.sra Written 660077 spots for SRR7168971.sra Read 660073 spots for SRR7168971.sra Written 660073 spots for SRR7168971.sra SRR ids: ['SRR7168971.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p65yph7r SRR7168971.sra spots: 13201464 blocks: [[1, 660073], [660074, 1320146], [1320147, 1980219], [1980220, 2640292], [2640293, 3300365], [3300366, 3960438], [3960439, 4620511], [4620512, 5280584], [5280585, 5940657], [5940658, 6600730], [6600731, 7260803], [7260804, 7920876], [7920877, 8580949], [8580950, 9241022], [9241023, 9901095], [9901096, 10561168], [10561169, 11221241], [11221242, 11881314], [11881315, 12541387], [12541388, 13201464]] SRR7168971 file size 4451842 SRR7168971 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168971 SRR7168971_1.fastq SRR7168971_2.fastq Input file: SRR7168971_1.fastq Paired file: SRR7168971_2.fastq trimmed: SRR7168971-trimmed-pair1.fastq, SRR7168971-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:21:19 2025 >> started Mon Feb 10 13:21:35 2025 >> done (15.845s) 13201464 read pairs processed; of these: 12352 ( 0.09%) short read pairs filtered out after trimming by size control 10718 ( 0.08%) empty read pairs filtered out after trimming by size control 13178394 (99.83%) read pairs available; of these: 5052409 (38.34%) trimmed read pairs available after processing 8125985 (61.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 5 0.00% 21 3 0.00% 22 10 0.00% 23 3 0.00% 24 3 0.00% 25 6 0.00% 26 6 0.00% 27 12 0.00% 28 5 0.00% 29 5 0.00% 30 4 0.00% 31 4 0.00% 32 6 0.00% 33 6 0.00% 34 6 0.00% 35 7 0.00% 36 11 0.00% 37 5 0.00% 38 10 0.00% 39 9 0.00% 40 7 0.00% 41 10 0.00% 42 16 0.00% 43 8 0.00% 44 8 0.00% 45 15 0.00% 46 11 0.00% 47 14 0.00% 48 16 0.00% 49 16 0.00% 50 22 0.00% 51 24 0.00% 52 16 0.00% 53 21 0.00% 54 28 0.00% 55 25 0.00% 56 32 0.00% 57 28 0.00% 58 48 0.00% 59 27 0.00% 60 42 0.00% 61 56 0.00% 62 66 0.00% 63 82 0.00% 64 76 0.00% 65 89 0.00% 66 93 0.00% 67 102 0.00% 68 117 0.00% 69 139 0.00% 70 142 0.00% 71 188 0.00% 72 164 0.00% 73 203 0.00% 74 239 0.00% 75 271 0.00% 76 269 0.00% 77 337 0.00% 78 342 0.00% 79 410 0.00% 80 479 0.00% 81 575 0.00% 82 635 0.00% 83 742 0.01% 84 1373 0.01% 85 1723 0.01% 86 1810 0.01% 87 1925 0.01% 88 2005 0.02% 89 2033 0.02% 90 2128 0.02% 91 2295 0.02% 92 2550 0.02% 93 2644 0.02% 94 2799 0.02% 95 3073 0.02% 96 3100 0.02% 97 3399 0.03% 98 3495 0.03% 99 3714 0.03% 100 4069 0.03% 101 4251 0.03% 102 4641 0.04% 103 5097 0.04% 104 5290 0.04% 105 5640 0.04% 106 5949 0.05% 107 6167 0.05% 108 6449 0.05% 109 6923 0.05% 110 7064 0.05% 111 7947 0.06% 112 8389 0.06% 113 9167 0.07% 114 9534 0.07% 115 10120 0.08% 116 10822 0.08% 117 11515 0.09% 118 11960 0.09% 119 12478 0.09% 120 13160 0.10% 121 13891 0.11% 122 14963 0.11% 123 16046 0.12% 124 16754 0.13% 125 18096 0.14% 126 19174 0.15% 127 20302 0.15% 128 21585 0.16% 129 22603 0.17% 130 23936 0.18% 131 25830 0.20% 132 27415 0.21% 133 29658 0.23% 134 32139 0.24% 135 34715 0.26% 136 37058 0.28% 137 40765 0.31% 138 44190 0.34% 139 47922 0.36% 140 52528 0.40% 141 58296 0.44% 142 65541 0.50% 143 74200 0.56% 144 87344 0.66% 145 103439 0.78% 146 128756 0.98% 147 174081 1.32% 148 264232 2.01% 149 522472 3.96% 150 2801389 21.26% 151 8125985 61.66% 13178394 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=44 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=47 fanout-score=265.23 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=33 prefix-density=0.26 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=227.80 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=28.8 sequence=AAGAAGAAGAAA SRR7168971 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:22:44 Started mapping on | Feb 10 13:22:44 Finished on | Feb 10 13:24:04 Mapping speed, Million of reads per hour | 593.03 Number of input reads | 13178394 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12470833 Uniquely mapped reads % | 94.63% Average mapped length | 297.01 Number of splices: Total | 11920151 Number of splices: Annotated (sjdb) | 11731958 Number of splices: GT/AG | 11748715 Number of splices: GC/AG | 135561 Number of splices: AT/AC | 9294 Number of splices: Non-canonical | 26581 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 242141 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 33273 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 477554 477554 477554 N_multimapping 242141 242141 242141 N_noFeature 282617 12335669 341340 N_ambiguous 126109 606 49265 UnstrandedReadsAssigned:12062107 PositiveStrandReadsAssigned:134558 NegativeStrandReadsAssigned:12080228 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168971 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168971-trimmed-pair1.fastq SRR7168971-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,178,394 reads, 12,001,149 reads pseudoaligned [quant] estimated average fragment length: 265.954 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 SRR7168971.ke.tsv 34699 SRR7168971.se.tsv 87100 total ==> SRR7168971.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.05 210 9.46028 Potri.005G024800.1.v4.1 1035 770.046 29 2.97412 Potri.004G059700.1.v4.1 961 696.114 3 0.340345 Potri.007G009000.2.v4.1 1416 1151.05 0 0 Potri.003G141000.2.v4.1 2943 2678.05 188 5.54393 Potri.016G087400.1.v4.1 270 65.819 1257 1508.21 Potri.015G069301.1.v4.1 564 305.604 0 0 Potri.010G195200.1.v4.1 1773 1508.05 10 0.523677 Potri.012G127500.1.v4.1 977 712.09 4568 506.605 ==> SRR7168971.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1087 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 147 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 3 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168971 completed mapping pipeline successfully