Starting /dee2/code/volunteer_pipeline.sh SRR7168972 current disk space = 3058954715136 free memory = 1328054824 SRR7168972 SRAfilesize b862976db6b8cc89f980b97c4d9d601b SRR7168972.sra SRR7168972.sra file validated SRR7168972 is paired end SRR7168972 is conventional basespace SRR7168972 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168972_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4355 34.0 33.0 34.0 32.0 34.0 2 33.05375 34.0 33.0 34.0 32.0 34.0 3 33.0895 34.0 33.0 34.0 32.0 34.0 4 33.16975 34.0 33.0 34.0 32.0 34.0 5 33.117 34.0 33.0 34.0 32.0 34.0 6 36.8915 38.0 37.0 38.0 35.0 38.0 7 37.20275 38.0 38.0 38.0 36.0 38.0 8 37.34475 38.0 38.0 38.0 37.0 38.0 9 37.4265 38.0 38.0 38.0 37.0 38.0 10-14 37.441649999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.35979999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.223749999999995 38.0 38.0 38.0 36.2 38.0 25-29 37.12165 38.0 38.0 38.0 36.0 38.0 30-34 37.09085 38.0 38.0 38.0 36.0 38.0 35-39 36.979150000000004 38.0 38.0 38.0 35.8 38.0 40-44 36.80965 38.0 38.0 38.0 35.0 38.0 45-49 36.86110000000001 38.0 38.0 38.0 35.0 38.0 50-54 36.863800000000005 38.0 38.0 38.0 35.2 38.0 55-59 36.552800000000005 38.0 38.0 38.0 34.0 38.0 60-64 36.5788 38.0 38.0 38.0 34.0 38.0 65-69 36.600350000000006 38.0 38.0 38.0 34.0 38.0 70-74 36.54065 38.0 38.0 38.0 34.0 38.0 75-79 36.449200000000005 38.0 37.6 38.0 34.0 38.0 80-84 35.75605 38.0 36.8 38.0 31.0 38.0 85-89 35.78915000000001 38.0 37.0 38.0 31.8 38.0 90-94 35.42395 38.0 36.4 38.0 29.6 38.0 95-99 35.31985 38.0 36.2 38.0 29.0 38.0 100-104 35.07785 38.0 36.0 38.0 28.2 38.0 105-109 35.14655 38.0 36.0 38.0 28.4 38.0 110-114 34.7995 38.0 35.2 38.0 26.6 38.0 115-119 34.4876 38.0 35.0 38.0 25.2 38.0 120-124 34.01755000000001 37.8 34.2 38.0 23.0 38.0 125-129 33.167649999999995 37.2 33.2 38.0 18.2 38.0 130-134 32.5286 37.0 32.0 38.0 15.0 38.0 135-139 33.16519999999999 38.0 33.8 38.0 17.4 38.0 140-144 32.7847 38.0 32.8 38.0 15.0 38.0 145-149 31.57385 36.8 31.8 38.0 11.2 38.0 150-151 26.79725 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 3.0 15 0.0 16 0.0 17 2.0 18 3.0 19 14.0 20 7.0 21 2.0 22 11.0 23 19.0 24 16.0 25 29.0 26 42.0 27 48.0 28 46.0 29 53.0 30 71.0 31 76.0 32 145.0 33 188.0 34 255.0 35 445.0 36 916.0 37 1606.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.687979539641944 12.531969309462914 8.567774936061381 37.212276214833764 2 22.325 16.5 33.775 27.400000000000002 3 19.55 21.275 26.275 32.9 4 21.45 29.549999999999997 24.474999999999998 24.525 5 22.48062015503876 33.65841460365091 22.155538884721178 21.705426356589147 6 20.175 35.55 24.925 19.35 7 15.024999999999999 26.3 39.875 18.8 8 18.125 26.55 29.425 25.900000000000002 9 17.7 23.849999999999998 33.45 25.0 10-14 20.135 29.635 26.790000000000003 23.44 15-19 19.830000000000002 28.955 27.650000000000002 23.565 20-24 19.855 28.994999999999997 27.79 23.36 25-29 20.01 28.705000000000002 27.54 23.745 30-34 19.965 28.765 27.794999999999998 23.474999999999998 35-39 19.702881152460986 29.011604641856742 27.70608243297319 23.579431772709082 40-44 20.495 28.73 27.32 23.455000000000002 45-49 19.95899179835967 29.390878175635127 26.835367073414684 23.814762952590517 50-54 20.064999999999998 29.095 27.279999999999998 23.56 55-59 20.155 28.915000000000003 27.055 23.875 60-64 20.455000000000002 29.025000000000002 27.005000000000003 23.515 65-69 20.26 29.15 26.939999999999998 23.65 70-74 20.683102465369803 28.749312396859526 27.254088113216984 23.313497024553683 75-79 19.935 29.335 27.105 23.625 80-84 19.57374082637981 29.637076505479037 27.460540866592943 23.328641801548205 85-89 19.852276153150434 28.122801728469497 28.208220279368906 23.816701839011152 90-94 20.48216976393772 28.628829733802107 27.031642390758414 23.85735811150176 95-99 20.374754445172012 28.33828640507732 27.66836246411122 23.61859668563945 100-104 20.131532707465233 29.102866609769567 26.868818715798987 23.896781966966213 105-109 20.667303150595448 28.19456308728205 27.43078237274509 23.70735138937742 110-114 20.190763052208833 28.418674698795183 27.459839357429715 23.930722891566266 115-119 20.30849620660202 28.573581872079583 27.417977189368436 23.699944731949955 120-124 20.766038301915096 28.88644432221611 27.071353567678386 23.276163808190407 125-129 20.744494055084534 27.667686750614557 28.164350574424326 23.423468619876587 130-134 20.741002473373378 27.984453081621318 27.848165160769266 23.426379284236027 135-139 20.935873465056346 28.495628884733943 27.242407398049423 23.32609025216029 140-144 20.63723030607125 28.956347215253388 26.954340190667338 23.45208228800803 145-149 20.83396435963451 28.532485233984552 26.669695592912312 23.963854813468625 150-151 20.130522088353413 28.589357429718877 27.77359437751004 23.50652610441767 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 0.5 24 0.0 25 1.0 26 4.0 27 7.5 28 9.5 29 16.0 30 24.0 31 28.0 32 32.0 33 43.5 34 58.5 35 66.5 36 90.5 37 124.0 38 133.0 39 144.5 40 185.0 41 219.0 42 243.0 43 265.0 44 264.5 45 271.5 46 287.0 47 257.0 48 219.5 49 194.5 50 167.0 51 153.5 52 128.5 53 90.5 54 69.0 55 56.0 56 39.5 57 30.0 58 21.0 59 14.5 60 10.5 61 7.0 62 4.0 63 1.5 64 2.5 65 2.5 66 2.0 67 1.5 68 1.0 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.04 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 0.0 80-84 0.53 85-89 0.49 90-94 0.44999999999999996 95-99 0.735 100-104 0.40499999999999997 105-109 0.49500000000000005 110-114 0.4 115-119 0.485 120-124 0.005 125-129 0.335 130-134 0.9450000000000001 135-139 1.055 140-144 0.35000000000000003 145-149 0.955 150-151 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.11249999999999999 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 0.9125 0.0 0.0 0.0 0.0 130-131 1.0125 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.25 0.0 0.0 0.0 0.0 136-137 1.3875000000000002 0.0 0.0 0.0 0.0 138-139 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGATG 10 0.0068449317 144.90001 7 >>END_MODULE SRR7168972 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168972_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.845 33.0 33.0 34.0 32.0 34.0 2 32.8985 34.0 33.0 34.0 32.0 34.0 3 32.933 34.0 33.0 34.0 32.0 34.0 4 32.85175 34.0 33.0 34.0 32.0 34.0 5 32.8615 34.0 33.0 34.0 32.0 34.0 6 36.78625 38.0 38.0 38.0 36.0 38.0 7 36.77325 38.0 38.0 38.0 36.0 38.0 8 36.256 38.0 38.0 38.0 35.0 38.0 9 36.62875 38.0 38.0 38.0 35.0 38.0 10-14 35.936499999999995 38.0 38.0 38.0 32.4 38.0 15-19 35.6799 38.0 38.0 38.0 33.0 38.0 20-24 36.04615 38.0 38.0 38.0 33.8 38.0 25-29 36.3292 38.0 38.0 38.0 34.8 38.0 30-34 36.27425000000001 38.0 38.0 38.0 35.2 38.0 35-39 36.3377 38.0 38.0 38.0 35.0 38.0 40-44 36.34425 38.0 38.0 38.0 35.4 38.0 45-49 36.33985 38.0 38.0 38.0 35.0 38.0 50-54 35.7476 38.0 38.0 38.0 32.8 38.0 55-59 34.915 38.0 38.0 38.0 28.0 38.0 60-64 35.0117 38.0 38.0 38.0 28.4 38.0 65-69 35.407 38.0 38.0 38.0 31.6 38.0 70-74 35.094849999999994 38.0 37.8 38.0 28.8 38.0 75-79 35.07225 38.0 38.0 38.0 28.8 38.0 80-84 35.2956 38.0 38.0 38.0 31.0 38.0 85-89 35.2748 38.0 38.0 38.0 30.8 38.0 90-94 35.0656 38.0 38.0 38.0 29.4 38.0 95-99 35.02445 38.0 37.8 38.0 29.0 38.0 100-104 34.43625 38.0 37.0 38.0 25.4 38.0 105-109 34.457550000000005 38.0 37.0 38.0 24.4 38.0 110-114 34.23375 38.0 36.8 38.0 21.8 38.0 115-119 34.267100000000006 38.0 36.4 38.0 23.4 38.0 120-124 34.2906 38.0 36.2 38.0 23.8 38.0 125-129 34.10275 38.0 36.0 38.0 23.2 38.0 130-134 33.675 38.0 35.0 38.0 20.8 38.0 135-139 33.03145 38.0 34.2 38.0 15.8 38.0 140-144 32.8482 38.0 34.6 38.0 14.0 38.0 145-149 31.903549999999996 38.0 33.6 38.0 8.6 38.0 150-151 28.319875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 34.0 4 10.0 5 3.0 6 3.0 7 7.0 8 19.0 9 9.0 10 20.0 11 21.0 12 16.0 13 1.0 14 5.0 15 4.0 16 3.0 17 6.0 18 6.0 19 6.0 20 7.0 21 10.0 22 20.0 23 20.0 24 23.0 25 29.0 26 33.0 27 25.0 28 41.0 29 48.0 30 51.0 31 59.0 32 81.0 33 110.0 34 157.0 35 223.0 36 439.0 37 2441.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.150000000000006 21.099999999999998 12.975 25.775 2 26.25 26.650000000000002 30.075000000000003 17.025000000000002 3 21.099999999999998 26.900000000000002 31.35 20.65 4 23.680920230057513 34.83370842710677 23.080770192548137 18.404601150287572 5 23.992994746059544 36.25218914185639 22.81711283462597 16.937703277458095 6 20.571285392132296 37.334001503382616 24.354798296166376 17.739914808318716 7 19.789050728277246 21.62230035158212 40.15570065293822 18.432948267202413 8 22.595419847328245 25.34351145038168 28.091603053435115 23.969465648854964 9 21.929824561403507 24.285714285714285 30.451127819548873 23.333333333333332 10-14 23.4225035736165 28.711455993465385 26.603022258525627 21.263018174392485 15-19 22.80375761329617 28.099514813667803 27.91886032827501 21.17786724476102 20-24 22.65692393565738 28.132135789313438 28.218399553458163 20.992540721571014 25-29 23.02410665062898 28.852804089610583 27.384353230090714 20.738736029669724 30-34 22.84528569259578 28.164380788501443 27.870843666177436 21.11948985272534 35-39 23.087004738380884 28.465571126121585 27.59350741002117 20.85391672547636 40-44 23.210870659285355 27.674886763965777 28.158027176648215 20.956215400100653 45-49 22.858580775037744 28.06240563663815 27.876195269250125 21.202818319073984 50-54 23.355162181520516 28.588969610150418 27.371329172209148 20.684539036119922 55-59 23.518682578560636 28.214080983897023 27.421960498202097 20.845275939340247 60-64 23.22171381031614 28.07300332778702 28.468178036605657 20.23710482529118 65-69 23.07731668628153 27.743949240137134 28.322161387709155 20.85657268587218 70-74 23.386930529787673 27.93753865182437 28.21583178726036 20.459699031127602 75-79 22.887722548111558 27.95101368735206 28.254605330863434 20.906658433672945 80-84 23.652925737224024 27.512737378415935 28.433945756780403 20.40039112757964 85-89 23.581905836496052 27.633603446507333 28.1721202174582 20.612370499538414 90-94 23.168531216167448 27.787802237459402 28.17445996803629 20.869206578336858 95-99 22.847648261758692 27.556237218813905 28.675869120654397 20.92024539877301 100-104 23.855885874941425 27.719060759098248 28.12516270109856 20.29989066486177 105-109 24.200278164116828 27.98124967805079 27.77520218410344 20.043269973728943 110-114 23.389689866196452 27.652733118971064 28.430660719842336 20.526916294990148 115-119 24.071207430340557 28.199174406604747 27.37874097007224 20.350877192982455 120-124 23.534803197718826 28.24991089159326 27.64906563470645 20.566220275981465 125-129 23.77871733482757 28.103509754979367 27.47694972237787 20.64082318781519 130-134 23.600535089524595 28.123070590656514 27.510804692323525 20.76558962749537 135-139 23.976398152898923 27.521806054386865 27.875833760903028 20.625962031811184 140-144 24.664514176167895 27.25759257390778 27.58046614872364 20.497427101200685 145-149 24.100354789660415 27.997972630511907 27.62797769893563 20.273694880892045 150-151 24.795396419437342 27.340153452685424 27.42966751918158 20.434782608695652 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 1.0 5 1.5 6 0.5 7 0.0 8 1.5 9 6.5 10 6.5 11 5.0 12 8.5 13 7.5 14 7.0 15 9.5 16 5.5 17 4.0 18 5.0 19 3.5 20 4.0 21 4.5 22 3.5 23 5.0 24 7.0 25 5.0 26 6.5 27 7.0 28 6.0 29 9.0 30 14.5 31 25.0 32 23.5 33 25.5 34 44.0 35 67.0 36 91.0 37 116.5 38 154.5 39 180.5 40 200.5 41 215.0 42 255.5 43 280.5 44 266.5 45 266.0 46 255.0 47 248.5 48 235.5 49 196.5 50 156.5 51 130.5 52 108.5 53 87.0 54 61.5 55 43.0 56 34.5 57 23.5 58 15.5 59 9.5 60 6.5 61 7.5 62 8.0 63 6.0 64 3.0 65 2.0 66 1.0 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.075 6 0.22499999999999998 7 0.44999999999999996 8 1.7500000000000002 9 0.25 10-14 2.06 15-19 3.1300000000000003 20-24 1.465 25-29 0.23500000000000001 30-34 1.205 35-39 0.8099999999999999 40-44 0.65 45-49 0.65 50-54 2.27 55-59 4.055000000000001 60-64 3.84 65-69 2.2849999999999997 70-74 2.98 75-79 2.83 80-84 2.8449999999999998 85-89 2.5100000000000002 90-94 3.015 95-99 2.1999999999999997 100-104 3.965 105-109 2.935 110-114 3.5900000000000003 115-119 3.1 120-124 1.805 125-129 1.8450000000000002 130-134 2.82 135-139 2.55 140-144 0.89 145-149 1.35 150-151 2.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.11249999999999999 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 0.9125 0.0 0.0 0.0 0.0 130-131 1.0125 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.3624999999999998 0.0 0.0 0.0 0.0 138-139 1.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra Read 891853 spots for SRR7168972.sra Written 891853 spots for SRR7168972.sra Read 891850 spots for SRR7168972.sra Written 891850 spots for SRR7168972.sra SRR ids: ['SRR7168972.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lt_i_q4x SRR7168972.sra spots: 17837003 blocks: [[1, 891850], [891851, 1783700], [1783701, 2675550], [2675551, 3567400], [3567401, 4459250], [4459251, 5351100], [5351101, 6242950], [6242951, 7134800], [7134801, 8026650], [8026651, 8918500], [8918501, 9810350], [9810351, 10702200], [10702201, 11594050], [11594051, 12485900], [12485901, 13377750], [13377751, 14269600], [14269601, 15161450], [15161451, 16053300], [16053301, 16945150], [16945151, 17837003]] SRR7168972 file size 6022674 SRR7168972 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168972 SRR7168972_1.fastq SRR7168972_2.fastq Input file: SRR7168972_1.fastq Paired file: SRR7168972_2.fastq trimmed: SRR7168972-trimmed-pair1.fastq, SRR7168972-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:26:54 2025 >> started Mon Feb 10 13:27:15 2025 >> done (20.408s) 17837003 read pairs processed; of these: 30790 ( 0.17%) short read pairs filtered out after trimming by size control 19578 ( 0.11%) empty read pairs filtered out after trimming by size control 17786635 (99.72%) read pairs available; of these: 8185279 (46.02%) trimmed read pairs available after processing 9601356 (53.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 3 0.00% 21 8 0.00% 22 5 0.00% 23 8 0.00% 24 5 0.00% 25 5 0.00% 26 6 0.00% 27 6 0.00% 28 5 0.00% 29 6 0.00% 30 4 0.00% 31 2 0.00% 32 9 0.00% 33 5 0.00% 34 4 0.00% 35 6 0.00% 36 7 0.00% 37 12 0.00% 38 12 0.00% 39 8 0.00% 40 10 0.00% 41 12 0.00% 42 13 0.00% 43 14 0.00% 44 15 0.00% 45 14 0.00% 46 12 0.00% 47 22 0.00% 48 21 0.00% 49 17 0.00% 50 32 0.00% 51 24 0.00% 52 24 0.00% 53 30 0.00% 54 43 0.00% 55 34 0.00% 56 37 0.00% 57 46 0.00% 58 56 0.00% 59 53 0.00% 60 68 0.00% 61 89 0.00% 62 93 0.00% 63 97 0.00% 64 108 0.00% 65 130 0.00% 66 138 0.00% 67 159 0.00% 68 181 0.00% 69 206 0.00% 70 227 0.00% 71 284 0.00% 72 304 0.00% 73 280 0.00% 74 407 0.00% 75 438 0.00% 76 518 0.00% 77 525 0.00% 78 603 0.00% 79 678 0.00% 80 780 0.00% 81 865 0.00% 82 1136 0.01% 83 1248 0.01% 84 2028 0.01% 85 2510 0.01% 86 2714 0.02% 87 2640 0.01% 88 3076 0.02% 89 3075 0.02% 90 3188 0.02% 91 3255 0.02% 92 3631 0.02% 93 3579 0.02% 94 3800 0.02% 95 4059 0.02% 96 4412 0.02% 97 4723 0.03% 98 5096 0.03% 99 5124 0.03% 100 6144 0.03% 101 6542 0.04% 102 6737 0.04% 103 6912 0.04% 104 7385 0.04% 105 7841 0.04% 106 8321 0.05% 107 8568 0.05% 108 9434 0.05% 109 9795 0.06% 110 10003 0.06% 111 10839 0.06% 112 11262 0.06% 113 12324 0.07% 114 12900 0.07% 115 13839 0.08% 116 14482 0.08% 117 15443 0.09% 118 16314 0.09% 119 17107 0.10% 120 17821 0.10% 121 19195 0.11% 122 20197 0.11% 123 21728 0.12% 124 23062 0.13% 125 25082 0.14% 126 26896 0.15% 127 27843 0.16% 128 29577 0.17% 129 31690 0.18% 130 33896 0.19% 131 36203 0.20% 132 39207 0.22% 133 42542 0.24% 134 45971 0.26% 135 49724 0.28% 136 54424 0.31% 137 59053 0.33% 138 64798 0.36% 139 71336 0.40% 140 79076 0.44% 141 89292 0.50% 142 103107 0.58% 143 120475 0.68% 144 144768 0.81% 145 178268 1.00% 146 228375 1.28% 147 322533 1.81% 148 495049 2.78% 149 970365 5.46% 150 4434400 24.93% 151 9601356 53.98% 17786635 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=14.90 fanout-score-rank=8 prefix-density=0.33 prefix-fanout=7.0 sequence=GGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGTTATCAGTGTAGATAGTGCCGGATACGCTTGTATTTGTAAGCCCTGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=5 fanout-score=92.26 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=18.3 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=36 prefix-density=0.29 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=255.16 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=30.2 sequence=AAGAAGAAGAAA SRR7168972 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:27:59 Started mapping on | Feb 10 13:27:59 Finished on | Feb 10 13:29:37 Mapping speed, Million of reads per hour | 653.39 Number of input reads | 17786635 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16832452 Uniquely mapped reads % | 94.64% Average mapped length | 296.63 Number of splices: Total | 16202244 Number of splices: Annotated (sjdb) | 15958214 Number of splices: GT/AG | 15970802 Number of splices: GC/AG | 186275 Number of splices: AT/AC | 12448 Number of splices: Non-canonical | 32719 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304339 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 25955 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 670578 670578 670578 N_multimapping 304339 304339 304339 N_noFeature 382214 16651023 464594 N_ambiguous 170365 1049 70590 UnstrandedReadsAssigned:16279873 PositiveStrandReadsAssigned:180380 NegativeStrandReadsAssigned:16297268 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168972 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168972-trimmed-pair1.fastq SRR7168972-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,786,635 reads, 16,190,468 reads pseudoaligned [quant] estimated average fragment length: 272.214 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR7168972.ke.tsv 34699 SRR7168972.se.tsv 87100 total ==> SRR7168972.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.79 389 13.5293 Potri.005G024800.1.v4.1 1035 763.786 31 2.46579 Potri.004G059700.1.v4.1 961 689.819 7 0.616493 Potri.007G009000.2.v4.1 1416 1144.79 0 0 Potri.003G141000.2.v4.1 2943 2671.79 294.114 6.68775 Potri.016G087400.1.v4.1 270 65.2657 1359 1265.03 Potri.015G069301.1.v4.1 564 300.683 0 0 Potri.010G195200.1.v4.1 1773 1501.79 9 0.364083 Potri.012G127500.1.v4.1 977 705.797 6169 531.007 ==> SRR7168972.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1044 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168972 completed mapping pipeline successfully