Starting /dee2/code/volunteer_pipeline.sh SRR7168973 current disk space = 3058742251520 free memory = 1213109784 SRR7168973 SRAfilesize db53fba908516bc69c4da0f3303f1e22 SRR7168973.sra SRR7168973.sra file validated SRR7168973 is paired end SRR7168973 is conventional basespace SRR7168973 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168973_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68425 34.0 33.0 34.0 32.0 34.0 2 33.137 34.0 33.0 34.0 32.0 34.0 3 33.17975 34.0 33.0 34.0 32.0 34.0 4 33.11 34.0 33.0 34.0 32.0 34.0 5 33.157 34.0 33.0 34.0 32.0 34.0 6 36.8155 38.0 37.0 38.0 35.0 38.0 7 37.16875 38.0 38.0 38.0 36.0 38.0 8 37.375 38.0 38.0 38.0 37.0 38.0 9 37.369 38.0 38.0 38.0 37.0 38.0 10-14 37.35020000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.25020000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.1798 38.0 38.0 38.0 36.0 38.0 25-29 37.142399999999995 38.0 38.0 38.0 36.0 38.0 30-34 37.02795 38.0 38.0 38.0 36.0 38.0 35-39 36.9101 38.0 38.0 38.0 35.6 38.0 40-44 36.71085 38.0 38.0 38.0 34.6 38.0 45-49 36.851600000000005 38.0 38.0 38.0 35.0 38.0 50-54 36.7769 38.0 38.0 38.0 35.0 38.0 55-59 36.53634999999999 38.0 38.0 38.0 34.0 38.0 60-64 36.56400000000001 38.0 38.0 38.0 34.0 38.0 65-69 36.51325 38.0 38.0 38.0 34.0 38.0 70-74 36.56865 38.0 38.0 38.0 34.0 38.0 75-79 36.302299999999995 38.0 37.2 38.0 33.4 38.0 80-84 35.75984999999999 38.0 36.8 38.0 31.0 38.0 85-89 35.67115 38.0 37.0 38.0 30.4 38.0 90-94 35.36995 38.0 36.4 38.0 29.4 38.0 95-99 35.3684 38.0 36.0 38.0 29.4 38.0 100-104 35.13095 38.0 36.0 38.0 28.4 38.0 105-109 35.0899 38.0 36.0 38.0 28.4 38.0 110-114 34.6419 38.0 35.2 38.0 26.4 38.0 115-119 34.3415 38.0 34.8 38.0 24.6 38.0 120-124 33.92385 37.8 33.8 38.0 22.8 38.0 125-129 33.189 37.8 33.6 38.0 17.8 38.0 130-134 32.43535 36.8 31.4 38.0 16.0 38.0 135-139 33.072250000000004 38.0 33.8 38.0 17.4 38.0 140-144 32.76855 38.0 33.0 38.0 14.4 38.0 145-149 31.589199999999998 37.0 31.8 38.0 11.2 38.0 150-151 27.00525 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 2.0 16 5.0 17 7.0 18 8.0 19 12.0 20 14.0 21 7.0 22 16.0 23 12.0 24 20.0 25 19.0 26 34.0 27 49.0 28 49.0 29 50.0 30 77.0 31 89.0 32 130.0 33 161.0 34 284.0 35 409.0 36 927.0 37 1618.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.59756097560975 13.719512195121952 10.035569105691057 32.64735772357724 2 21.475 16.675 31.7 30.15 3 20.525 21.625 26.5 31.35 4 22.625 29.325000000000003 22.675 25.374999999999996 5 22.330582645661416 33.50837709427357 22.705676419104776 21.45536384096024 6 19.25 35.475 25.374999999999996 19.900000000000002 7 15.375 27.55 39.0 18.075 8 18.45 26.150000000000002 30.349999999999998 25.05 9 18.275 24.8 33.775 23.150000000000002 10-14 19.52597629881494 29.641482074103703 26.94634731736587 23.886194309715485 15-19 19.845 29.25 27.305 23.599999999999998 20-24 19.755 28.95 27.555000000000003 23.74 25-29 19.895 28.915000000000003 27.415 23.775 30-34 19.62 28.544999999999998 27.55 24.285 35-39 20.103041216486595 28.671468587434973 27.165866346538614 24.059623849539815 40-44 19.85 29.815 26.755000000000003 23.580000000000002 45-49 20.07700770077008 28.927892789278932 26.897689768976896 24.097409740974097 50-54 20.515 29.24 26.724999999999998 23.52 55-59 20.585 28.815 26.685 23.915 60-64 20.415 28.87 27.47 23.244999999999997 65-69 20.572057205720572 27.82278227822782 27.687768776877686 23.91739173917392 70-74 20.166049814944483 28.55856757027108 27.093127938381517 24.18225467640292 75-79 20.419999999999998 28.42 27.47 23.69 80-84 20.781242154943016 28.6790179243862 26.65059998995833 23.889139930712457 85-89 20.313205842493602 28.47964663956232 27.325202027807055 23.881945490137028 90-94 21.156933574152117 28.316275336142887 27.051976720850895 23.474814368854105 95-99 20.803580408327466 28.53766468872574 27.23021220959469 23.428542693352107 100-104 20.538534824249112 28.240485383342527 27.55854184425613 23.662437948152235 105-109 20.401606425702813 28.55421686746988 27.068273092369477 23.97590361445783 110-114 20.41236079060901 28.17798735828233 27.6863650045149 23.723286846593762 115-119 20.378172334236133 29.140335038619718 26.25639482395426 24.22509780318989 120-124 20.66119835950785 28.633590077023108 26.808042412723815 23.897169150745224 125-129 20.234574708034685 27.898350959851637 27.577565034334118 24.28950929777956 130-134 20.81778763739034 27.80578804073813 27.654532620752242 23.72189170111929 135-139 20.81696383600282 28.749874080789766 26.568953359524528 23.864208723682882 140-144 21.104872668939244 27.752155604571886 26.869861640264688 24.273110086224182 145-149 21.059255902935107 28.087398680964608 26.86905301314001 23.98429240296028 150-151 20.709984947315604 28.61264425489212 26.04114400401405 24.636226793778224 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 2.0 24 2.0 25 2.5 26 3.5 27 8.0 28 10.5 29 11.0 30 15.0 31 20.5 32 31.5 33 53.5 34 59.0 35 68.5 36 97.5 37 110.5 38 123.0 39 149.0 40 170.5 41 196.0 42 228.5 43 247.5 44 259.5 45 278.5 46 281.0 47 256.0 48 227.5 49 215.0 50 193.0 51 148.5 52 112.5 53 96.5 54 85.0 55 61.5 56 46.0 57 33.5 58 23.5 59 18.5 60 11.5 61 9.5 62 8.0 63 6.5 64 3.5 65 0.5 66 1.5 67 3.5 68 2.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.04 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.03 75-79 0.0 80-84 0.415 85-89 0.385 90-94 0.33999999999999997 95-99 0.5700000000000001 100-104 0.28500000000000003 105-109 0.4 110-114 0.33 115-119 0.31 120-124 0.03 125-129 0.245 130-134 0.83 135-139 0.73 140-144 0.26 145-149 0.685 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3198992443325 98.575 2 0.6045340050377833 1.2 3 0.07556675062972291 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.8250000000000002 0.0 0.0 0.0 0.0 132-133 1.8875 0.0 0.0 0.0 0.0 134-135 2.0625 0.0 0.0 0.0 0.0 136-137 2.2875 0.0 0.0 0.0 0.0 138-139 2.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168973 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168973_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77 33.0 33.0 34.0 32.0 34.0 2 32.81725 34.0 33.0 34.0 32.0 34.0 3 32.78875 34.0 33.0 34.0 32.0 34.0 4 32.6785 34.0 33.0 34.0 32.0 34.0 5 32.633 34.0 33.0 34.0 32.0 34.0 6 36.619 38.0 38.0 38.0 36.0 38.0 7 36.54475 38.0 38.0 38.0 36.0 38.0 8 36.2485 38.0 38.0 38.0 34.0 38.0 9 36.342 38.0 38.0 38.0 34.0 38.0 10-14 35.88985 38.0 38.0 38.0 32.6 38.0 15-19 35.58635 38.0 38.0 38.0 33.0 38.0 20-24 35.9034 38.0 38.0 38.0 33.4 38.0 25-29 36.06045 38.0 38.0 38.0 33.6 38.0 30-34 36.07340000000001 38.0 38.0 38.0 34.2 38.0 35-39 36.134 38.0 38.0 38.0 34.6 38.0 40-44 36.175149999999995 38.0 38.0 38.0 35.0 38.0 45-49 36.1832 38.0 38.0 38.0 34.8 38.0 50-54 35.61775 38.0 38.0 38.0 32.6 38.0 55-59 34.852900000000005 38.0 38.0 38.0 27.2 38.0 60-64 35.03824999999999 38.0 38.0 38.0 28.8 38.0 65-69 35.261849999999995 38.0 38.0 38.0 30.6 38.0 70-74 34.99905 38.0 38.0 38.0 28.0 38.0 75-79 35.00575 38.0 38.0 38.0 28.4 38.0 80-84 35.125800000000005 38.0 38.0 38.0 29.4 38.0 85-89 35.08624999999999 38.0 38.0 38.0 29.6 38.0 90-94 34.934 38.0 38.0 38.0 28.8 38.0 95-99 34.7636 38.0 37.6 38.0 27.4 38.0 100-104 34.43695 38.0 37.0 38.0 25.4 38.0 105-109 34.413650000000004 38.0 37.0 38.0 25.2 38.0 110-114 34.227250000000005 38.0 37.0 38.0 21.8 38.0 115-119 34.13225 38.0 37.0 38.0 21.4 38.0 120-124 34.105000000000004 38.0 36.2 38.0 23.2 38.0 125-129 33.7792 38.0 35.8 38.0 18.6 38.0 130-134 33.34015000000001 38.0 35.2 38.0 16.0 38.0 135-139 32.7232 38.0 34.2 38.0 14.2 38.0 140-144 32.48965 38.0 34.2 38.0 13.4 38.0 145-149 31.700149999999997 38.0 33.4 38.0 4.2 38.0 150-151 28.059 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 38.0 4 10.0 5 4.0 6 0.0 7 6.0 8 12.0 9 10.0 10 25.0 11 26.0 12 17.0 13 5.0 14 4.0 15 5.0 16 9.0 17 6.0 18 11.0 19 11.0 20 13.0 21 8.0 22 16.0 23 23.0 24 18.0 25 25.0 26 25.0 27 29.0 28 34.0 29 37.0 30 49.0 31 62.0 32 68.0 33 97.0 34 128.0 35 222.0 36 475.0 37 2447.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.525 21.099999999999998 15.299999999999999 23.075000000000003 2 25.650000000000002 26.75 28.975 18.625 3 20.630157539384847 28.457114278569644 31.15778944736184 19.754938734683673 4 23.536768384192097 31.990995497748877 23.386693346673336 21.085542771385693 5 23.323323323323322 36.26126126126126 22.872872872872875 17.54254254254254 6 19.839478304489592 35.86656634060697 25.20692249811889 19.08703285678455 7 19.54225352112676 22.736418511066397 38.0784708249497 19.642857142857142 8 22.79057989364396 25.246897948847806 26.664978475563434 25.297543681944795 9 20.873055694932262 25.865529352734573 29.15203211239338 24.109382839939787 10-14 23.327232052064268 28.569249542403906 26.021964612568638 22.081553792963188 15-19 24.033475381218874 27.401550546798788 27.288596806489707 21.276377265492634 20-24 22.89565702123347 27.55789793746516 27.684589266710585 21.861855774590786 25-29 23.54917991673772 27.767467522696492 27.265887545769175 21.417465014796612 30-34 23.524954536269956 27.631844817134777 27.838957365124266 21.004243281471005 35-39 23.73162874974834 27.6323736661969 27.26998188041071 21.366015703644052 40-44 24.204174000502892 28.051294945939148 27.312044254463164 20.432486799094796 45-49 23.403507008993618 27.493342712153947 27.890267798824297 21.212882480028135 50-54 23.38754907459338 28.185387243155052 27.288023249885278 21.139040432366286 55-59 24.170371136152177 27.6026051897033 27.13739274268583 21.0896309314587 60-64 23.65458113831216 28.36483834314637 27.011672347897946 20.96890817064353 65-69 23.727777494778664 27.364882074270287 28.022006010901123 20.88533442004992 70-74 23.938896862825505 27.199097806028295 27.69120360877589 21.17080172237031 75-79 23.7839496700936 27.41036264129712 28.09063475014066 20.71505293846862 80-84 23.606490249270614 26.99493269181553 27.9264984388596 21.472078620054255 85-89 23.859810223446587 26.925823895520868 27.99204162840526 21.222324252627285 90-94 23.687717859339756 27.286241541931517 28.05003075661267 20.976009842116056 95-99 23.7380419295746 27.081213108080604 28.058212904538976 21.12253205780582 100-104 23.958871551100547 27.14167613929937 27.684199648651443 21.215252660948643 105-109 23.781018163213098 27.536454336147354 27.991813763110766 20.690713737528778 110-114 23.292325114531323 27.091161785144386 28.151541668811447 21.464971431512843 115-119 23.982341768903034 27.5755864688671 27.709049843437196 20.73302191879267 120-124 24.395314639217077 27.721717965620407 27.5797373358349 20.30323005932762 125-129 24.479536914796384 27.282421041941706 27.617548491926474 20.620493551335432 130-134 24.02457757296467 27.173579109062977 28.023553507424477 20.778289810547875 135-139 24.529360746900668 27.07004744655885 27.814907402683538 20.585684403856945 140-144 24.5940494200706 27.846696923852747 26.98436712052446 20.574886535552196 145-149 24.440175908608403 27.872415710458476 27.154627710660666 20.53278067027246 150-151 24.400815910249875 26.68281489036206 28.04691483936767 20.8694543600204 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 2.0 5 1.0 6 1.0 7 1.0 8 0.5 9 1.5 10 3.5 11 4.5 12 5.0 13 5.0 14 5.0 15 6.0 16 4.0 17 3.0 18 4.0 19 3.5 20 5.0 21 5.5 22 3.5 23 5.5 24 5.0 25 4.5 26 7.5 27 5.5 28 7.0 29 10.0 30 9.5 31 10.5 32 16.5 33 26.0 34 31.0 35 48.0 36 69.0 37 91.5 38 117.5 39 147.0 40 187.5 41 216.0 42 235.5 43 249.0 44 282.5 45 299.0 46 285.0 47 275.0 48 247.0 49 204.0 50 164.0 51 141.5 52 125.0 53 104.0 54 89.5 55 64.5 56 35.0 57 27.5 58 21.5 59 16.0 60 16.0 61 12.5 62 9.5 63 6.5 64 2.0 65 1.0 66 0.5 67 1.0 68 1.0 69 0.0 70 1.5 71 1.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.05 5 0.1 6 0.325 7 0.6 8 1.275 9 0.35000000000000003 10-14 1.66 15-19 2.6149999999999998 20-24 1.335 25-29 0.315 30-34 1.02 35-39 0.66 40-44 0.575 45-49 0.485 50-54 1.9349999999999998 55-59 3.27 60-64 3.19 65-69 1.8450000000000002 70-74 2.46 75-79 2.245 80-84 2.315 85-89 1.9900000000000002 90-94 2.46 95-99 1.7399999999999998 100-104 3.2300000000000004 105-109 2.275 110-114 2.8649999999999998 115-119 2.595 120-124 1.395 125-129 1.53 130-134 2.35 135-139 1.9949999999999999 140-144 0.8500000000000001 145-149 1.085 150-151 1.95 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.48750000000000004 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.425 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.7625 0.0 0.0 0.0 0.0 134-135 1.9375 0.0 0.0 0.0 0.0 136-137 2.15 0.0 0.0 0.0 0.0 138-139 2.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 40 0.0074108387 18.22436 100-104 >>END_MODULE Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775132 spots for SRR7168973.sra Written 775132 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra Read 775124 spots for SRR7168973.sra Written 775124 spots for SRR7168973.sra SRR ids: ['SRR7168973.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_75ofdbxt SRR7168973.sra spots: 15502488 blocks: [[1, 775124], [775125, 1550248], [1550249, 2325372], [2325373, 3100496], [3100497, 3875620], [3875621, 4650744], [4650745, 5425868], [5425869, 6200992], [6200993, 6976116], [6976117, 7751240], [7751241, 8526364], [8526365, 9301488], [9301489, 10076612], [10076613, 10851736], [10851737, 11626860], [11626861, 12401984], [12401985, 13177108], [13177109, 13952232], [13952233, 14727356], [14727357, 15502488]] SRR7168973 file size 5231584 SRR7168973 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168973 SRR7168973_1.fastq SRR7168973_2.fastq Input file: SRR7168973_1.fastq Paired file: SRR7168973_2.fastq trimmed: SRR7168973-trimmed-pair1.fastq, SRR7168973-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:58:09 2025 >> started Mon Feb 10 12:58:27 2025 >> done (17.503s) 15502488 read pairs processed; of these: 59129 ( 0.38%) short read pairs filtered out after trimming by size control 40888 ( 0.26%) empty read pairs filtered out after trimming by size control 15402471 (99.35%) read pairs available; of these: 6876457 (44.65%) trimmed read pairs available after processing 8526014 (55.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 6 0.00% 21 10 0.00% 22 9 0.00% 23 10 0.00% 24 6 0.00% 25 15 0.00% 26 11 0.00% 27 9 0.00% 28 10 0.00% 29 13 0.00% 30 17 0.00% 31 21 0.00% 32 9 0.00% 33 15 0.00% 34 14 0.00% 35 14 0.00% 36 9 0.00% 37 13 0.00% 38 21 0.00% 39 13 0.00% 40 16 0.00% 41 16 0.00% 42 14 0.00% 43 24 0.00% 44 15 0.00% 45 15 0.00% 46 26 0.00% 47 32 0.00% 48 27 0.00% 49 45 0.00% 50 48 0.00% 51 41 0.00% 52 50 0.00% 53 50 0.00% 54 63 0.00% 55 67 0.00% 56 71 0.00% 57 63 0.00% 58 89 0.00% 59 96 0.00% 60 128 0.00% 61 143 0.00% 62 137 0.00% 63 157 0.00% 64 166 0.00% 65 175 0.00% 66 185 0.00% 67 244 0.00% 68 274 0.00% 69 413 0.00% 70 343 0.00% 71 357 0.00% 72 386 0.00% 73 424 0.00% 74 509 0.00% 75 540 0.00% 76 628 0.00% 77 741 0.00% 78 784 0.01% 79 849 0.01% 80 1026 0.01% 81 1182 0.01% 82 1258 0.01% 83 1640 0.01% 84 3517 0.02% 85 4376 0.03% 86 4537 0.03% 87 4405 0.03% 88 4588 0.03% 89 4460 0.03% 90 4563 0.03% 91 4740 0.03% 92 5068 0.03% 93 5089 0.03% 94 5313 0.03% 95 5352 0.03% 96 5881 0.04% 97 5985 0.04% 98 6320 0.04% 99 6622 0.04% 100 7373 0.05% 101 7339 0.05% 102 7658 0.05% 103 7851 0.05% 104 8388 0.05% 105 8854 0.06% 106 9517 0.06% 107 9842 0.06% 108 10282 0.07% 109 10912 0.07% 110 11114 0.07% 111 11718 0.08% 112 12543 0.08% 113 13191 0.09% 114 13910 0.09% 115 14879 0.10% 116 15658 0.10% 117 16527 0.11% 118 17041 0.11% 119 17670 0.11% 120 18698 0.12% 121 19478 0.13% 122 21069 0.14% 123 22450 0.15% 124 24053 0.16% 125 25293 0.16% 126 26777 0.17% 127 27866 0.18% 128 29225 0.19% 129 30950 0.20% 130 33115 0.21% 131 35144 0.23% 132 38015 0.25% 133 40162 0.26% 134 43792 0.28% 135 46747 0.30% 136 50264 0.33% 137 54224 0.35% 138 58930 0.38% 139 64556 0.42% 140 70990 0.46% 141 78890 0.51% 142 88934 0.58% 143 102609 0.67% 144 120742 0.78% 145 146434 0.95% 146 183868 1.19% 147 254482 1.65% 148 381682 2.48% 149 746730 4.85% 150 3663391 23.78% 151 8526014 55.35% 15402471 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=32 prefix-density=0.31 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=155.02 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=38 prefix-density=0.30 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=28 fanout-score=44.89 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=9.9 sequence=TCAAGGAAGCTTTCAG SRR7168973 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:59:13 Started mapping on | Feb 10 12:59:14 Finished on | Feb 10 13:00:53 Mapping speed, Million of reads per hour | 560.09 Number of input reads | 15402471 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14503471 Uniquely mapped reads % | 94.16% Average mapped length | 296.02 Number of splices: Total | 12735216 Number of splices: Annotated (sjdb) | 12539104 Number of splices: GT/AG | 12568407 Number of splices: GC/AG | 130679 Number of splices: AT/AC | 9880 Number of splices: Non-canonical | 26250 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 252740 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 35710 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.92% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 686245 686245 686245 N_multimapping 252740 252740 252740 N_noFeature 279179 14311895 343359 N_ambiguous 184293 920 56264 UnstrandedReadsAssigned:14039999 PositiveStrandReadsAssigned:190656 NegativeStrandReadsAssigned:14103848 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168973 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168973-trimmed-pair1.fastq SRR7168973-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,402,471 reads, 14,051,200 reads pseudoaligned [quant] estimated average fragment length: 252.196 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR7168973.ke.tsv 34699 SRR7168973.se.tsv 87100 total ==> SRR7168973.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.8 256 8.73642 Potri.005G024800.1.v4.1 1035 783.804 27 2.07701 Potri.004G059700.1.v4.1 961 709.828 1 0.0849433 Potri.007G009000.2.v4.1 1416 1164.8 0 0 Potri.003G141000.2.v4.1 2943 2691.8 175 3.91991 Potri.016G087400.1.v4.1 270 68.0331 1703 1509.3 Potri.015G069301.1.v4.1 564 316.291 0 0 Potri.010G195200.1.v4.1 1773 1521.8 15 0.594312 Potri.012G127500.1.v4.1 977 725.816 2221 184.503 ==> SRR7168973.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1272 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 330 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168973 completed mapping pipeline successfully