Starting /dee2/code/volunteer_pipeline.sh SRR7168974 current disk space = 3058894282752 free memory = 1465120108 SRR7168974 SRAfilesize 85901c85bfa7747e1249b2046dddb163 SRR7168974.sra SRR7168974.sra file validated SRR7168974 is paired end SRR7168974 is conventional basespace SRR7168974 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168974_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3205 34.0 34.0 34.0 33.0 34.0 2 33.51925 34.0 34.0 34.0 33.0 34.0 3 33.534 34.0 34.0 34.0 33.0 34.0 4 33.58375 34.0 34.0 34.0 33.0 34.0 5 33.57475 34.0 34.0 34.0 33.0 34.0 6 37.21975 38.0 38.0 38.0 36.0 38.0 7 37.4095 38.0 38.0 38.0 37.0 38.0 8 37.56725 38.0 38.0 38.0 37.0 38.0 9 37.58225 38.0 38.0 38.0 38.0 38.0 10-14 37.575149999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.5681 38.0 38.0 38.0 37.8 38.0 20-24 37.57025 38.0 38.0 38.0 38.0 38.0 25-29 37.516149999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.49475 38.0 38.0 38.0 38.0 38.0 35-39 37.438649999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.310700000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.3326 38.0 38.0 38.0 37.0 38.0 50-54 37.30805 38.0 38.0 38.0 37.0 38.0 55-59 37.22475 38.0 38.0 38.0 36.6 38.0 60-64 37.2436 38.0 38.0 38.0 36.4 38.0 65-69 37.18095 38.0 38.0 38.0 36.0 38.0 70-74 37.13345 38.0 38.0 38.0 36.0 38.0 75-79 37.1096 38.0 38.0 38.0 36.0 38.0 80-84 37.04735 38.0 38.0 38.0 36.0 38.0 85-89 36.97330000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.860749999999996 38.0 38.0 38.0 35.4 38.0 95-99 36.7749 38.0 38.0 38.0 35.0 38.0 100-104 36.6815 38.0 38.0 38.0 34.6 38.0 105-109 36.57065 38.0 38.0 38.0 34.0 38.0 110-114 36.413650000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.2732 38.0 37.6 38.0 33.8 38.0 120-124 36.1464 38.0 37.4 38.0 33.4 38.0 125-129 35.940999999999995 38.0 36.8 38.0 33.0 38.0 130-134 35.59394999999999 38.0 36.4 38.0 30.6 38.0 135-139 35.4649 38.0 36.0 38.0 31.0 38.0 140-144 35.124 38.0 35.8 38.0 29.6 38.0 145-149 34.64535 38.0 35.6 38.0 27.8 38.0 150-151 31.929499999999997 36.5 32.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 0.0 16 3.0 17 1.0 18 2.0 19 2.0 20 2.0 21 2.0 22 4.0 23 5.0 24 6.0 25 5.0 26 10.0 27 21.0 28 26.0 29 26.0 30 41.0 31 43.0 32 45.0 33 82.0 34 140.0 35 219.0 36 512.0 37 2799.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.53652392947103 14.760705289672543 8.740554156171285 34.96221662468514 2 23.35 17.275 34.8 24.575 3 20.75 23.200000000000003 26.674999999999997 29.375 4 21.375 32.300000000000004 22.575 23.75 5 21.75 36.15 23.150000000000002 18.95 6 19.8 34.425 25.324999999999996 20.45 7 15.25 25.900000000000002 40.425 18.425 8 17.7 24.6 31.35 26.35 9 17.8 25.4 31.35 25.45 10-14 20.080000000000002 29.615000000000002 26.395000000000003 23.91 15-19 19.845 29.095 27.01 24.05 20-24 19.759999999999998 28.99 27.665 23.585 25-29 19.875 29.549999999999997 26.715 23.86 30-34 19.640982049102455 29.161458072903645 27.631381569078457 23.566178308915443 35-39 19.919999999999998 29.57 27.279999999999998 23.23 40-44 19.74 29.099999999999998 27.455000000000002 23.705000000000002 45-49 19.46 28.939999999999998 27.32 24.279999999999998 50-54 19.855 28.27 28.24 23.635 55-59 20.1 29.475 26.424999999999997 24.0 60-64 19.695 29.45 27.150000000000002 23.705000000000002 65-69 20.150000000000002 28.549999999999997 27.794999999999998 23.505000000000003 70-74 20.105 28.720000000000002 27.345000000000002 23.830000000000002 75-79 20.185 28.74 27.38 23.695 80-84 20.09 28.655 26.965 24.29 85-89 20.3 28.945 26.545 24.21 90-94 20.435 29.07 27.21 23.285 95-99 20.349999999999998 29.12 27.24 23.29 100-104 20.669999999999998 28.57 27.034999999999997 23.724999999999998 105-109 20.53 28.185 27.79 23.494999999999997 110-114 20.105 28.660000000000004 27.560000000000002 23.674999999999997 115-119 20.064999999999998 28.549999999999997 27.74 23.645 120-124 20.544999999999998 28.52 26.924999999999997 24.01 125-129 20.45 29.01 27.185 23.355 130-134 20.895 27.950000000000003 27.38 23.775 135-139 20.7 28.95 26.825 23.525 140-144 20.685000000000002 28.625 27.250000000000004 23.44 145-149 20.395 28.749999999999996 27.134999999999998 23.72 150-151 21.349999999999998 27.875 26.4125 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 2.0 25 2.0 26 4.0 27 11.0 28 14.0 29 13.5 30 17.5 31 26.0 32 39.0 33 49.5 34 58.5 35 69.0 36 79.5 37 111.5 38 138.5 39 158.5 40 192.0 41 217.0 42 227.5 43 247.5 44 261.5 45 272.0 46 278.5 47 253.0 48 227.0 49 214.0 50 180.5 51 144.5 52 128.5 53 103.0 54 69.0 55 49.0 56 43.5 57 26.5 58 17.5 59 14.5 60 9.5 61 8.0 62 5.0 63 3.0 64 3.0 65 2.5 66 1.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.8999999999999999 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.3624999999999998 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 2.1625 0.0 0.0 0.0 0.0 134-135 2.5250000000000004 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138-139 3.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168974 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168974_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98275 33.0 33.0 34.0 32.0 34.0 2 33.09425 34.0 33.0 34.0 32.0 34.0 3 33.1745 34.0 33.0 34.0 33.0 34.0 4 33.1005 34.0 33.0 34.0 33.0 34.0 5 33.10325 34.0 33.0 34.0 33.0 34.0 6 37.352 38.0 38.0 38.0 37.0 38.0 7 37.33325 38.0 38.0 38.0 37.0 38.0 8 37.32975 38.0 38.0 38.0 37.0 38.0 9 37.32575 38.0 38.0 38.0 37.0 38.0 10-14 37.325250000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.28240000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.22725 38.0 38.0 38.0 37.0 38.0 25-29 37.28085 38.0 38.0 38.0 37.0 38.0 30-34 37.23865 38.0 38.0 38.0 37.0 38.0 35-39 37.227 38.0 38.0 38.0 37.0 38.0 40-44 37.198350000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.15905 38.0 38.0 38.0 37.0 38.0 50-54 37.14485 38.0 38.0 38.0 36.8 38.0 55-59 37.089600000000004 38.0 38.0 38.0 36.6 38.0 60-64 37.0469 38.0 38.0 38.0 36.0 38.0 65-69 37.050399999999996 38.0 38.0 38.0 36.2 38.0 70-74 36.95345 38.0 38.0 38.0 36.0 38.0 75-79 36.8699 38.0 38.0 38.0 36.0 38.0 80-84 36.8157 38.0 38.0 38.0 35.6 38.0 85-89 36.70435 38.0 38.0 38.0 35.2 38.0 90-94 36.6057 38.0 38.0 38.0 35.0 38.0 95-99 36.45845 38.0 38.0 38.0 34.0 38.0 100-104 36.327 38.0 38.0 38.0 34.2 38.0 105-109 36.244600000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.082350000000005 38.0 37.8 38.0 33.6 38.0 115-119 35.85165 38.0 37.0 38.0 32.6 38.0 120-124 35.665549999999996 38.0 37.0 38.0 31.4 38.0 125-129 35.42895 38.0 36.2 38.0 30.6 38.0 130-134 35.13689999999999 38.0 36.0 38.0 28.8 38.0 135-139 34.622699999999995 38.0 35.0 38.0 26.8 38.0 140-144 34.318149999999996 38.0 35.0 38.0 24.8 38.0 145-149 33.81 38.0 35.0 38.0 21.4 38.0 150-151 30.144625 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 3.0 14 4.0 15 1.0 16 1.0 17 6.0 18 5.0 19 7.0 20 5.0 21 7.0 22 6.0 23 13.0 24 13.0 25 9.0 26 14.0 27 25.0 28 24.0 29 27.0 30 38.0 31 55.0 32 65.0 33 85.0 34 141.0 35 225.0 36 589.0 37 2622.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.875 21.224999999999998 11.625 26.275 2 26.463231615807903 25.162581290645324 29.864932466233117 18.509254627313656 3 20.040030022516888 28.371278458844134 32.34926194645985 19.239429572179134 4 22.678347934918648 34.593241551939926 23.404255319148938 19.32415519399249 5 21.766324743557668 37.97848386289717 21.1408556417313 19.11433575181386 6 21.175 37.75 22.425 18.65 7 19.425 21.575 38.875 20.125 8 21.075 25.275 27.750000000000004 25.900000000000002 9 21.099999999999998 25.374999999999996 29.2 24.325 10-14 23.176158807940396 29.031451572578632 26.306315315765787 21.486074303715185 15-19 23.299319727891156 27.896158463385355 27.425970388155264 21.37855142056823 20-24 23.213482022303346 28.049207381107166 27.874181127169074 20.863129469420414 25-29 22.649529905981197 28.240648129625924 28.110622124424882 20.999199839967993 30-34 22.992299229922992 27.93279327932793 27.872787278727873 21.202120212021203 35-39 23.14615730786539 28.331416570828544 27.801390069503473 20.721036051802592 40-44 23.567356735673567 28.06780678067807 28.112811281128113 20.25202520252025 45-49 24.066203310165506 28.111405570278514 27.391369568478424 20.431021551077556 50-54 23.026151307565378 28.516425821291065 27.611380569028455 20.846042302115105 55-59 23.665 27.415 28.74 20.18 60-64 23.34116705835292 27.84639231961598 28.046402320116005 20.766038301915096 65-69 22.941147057352868 27.476373818690934 28.331416570828544 21.251062553127657 70-74 23.365 27.639999999999997 27.99 21.005 75-79 23.071153557677885 27.78638931946597 28.696434821741086 20.446022301115054 80-84 23.021151057552878 27.74138706935347 28.191409570478527 21.04605230261513 85-89 23.625 28.01 28.01 20.355 90-94 23.365 27.515 28.389999999999997 20.73 95-99 23.72 27.185 28.194999999999997 20.9 100-104 23.735 27.275 28.27 20.72 105-109 24.04 26.93 28.665000000000003 20.365 110-114 23.72 27.794999999999998 28.095 20.39 115-119 24.306215310765538 27.501375068753436 27.78638931946597 20.40602030101505 120-124 23.997399739974 27.442744274427444 28.492849284928496 20.067006700670067 125-129 23.66 27.91 28.415000000000003 20.015 130-134 24.48 27.650000000000002 27.48 20.39 135-139 24.05 27.77 27.665 20.515 140-144 24.23 28.625 27.32 19.825 145-149 24.64 27.49 27.650000000000002 20.22 150-151 24.8 27.3875 27.987499999999997 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 2.5 26 3.5 27 4.0 28 4.0 29 7.0 30 11.5 31 16.0 32 21.0 33 30.0 34 44.5 35 62.5 36 82.0 37 102.0 38 134.0 39 169.5 40 193.5 41 217.0 42 244.5 43 285.5 44 304.5 45 300.0 46 304.0 47 268.0 48 229.0 49 209.5 50 167.0 51 123.0 52 109.5 53 105.0 54 73.0 55 44.0 56 32.5 57 24.5 58 20.5 59 15.5 60 10.5 61 6.5 62 3.0 63 2.5 64 2.0 65 1.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.075 4 0.125 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.04 20-24 0.015 25-29 0.02 30-34 0.01 35-39 0.005 40-44 0.01 45-49 0.005 50-54 0.005 55-59 0.0 60-64 0.005 65-69 0.005 70-74 0.0 75-79 0.005 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.5125 0.0 0.0 0.0 0.0 128-129 1.6375 0.0 0.0 0.0 0.0 130-131 1.7625 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.3875 0.0 0.0 0.0 0.0 136-137 2.6500000000000004 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAAAT 10 0.006830828 145.0 1 >>END_MODULE Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754129 spots for SRR7168974.sra Written 754129 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra Read 754124 spots for SRR7168974.sra Written 754124 spots for SRR7168974.sra SRR ids: ['SRR7168974.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w6cewzmv SRR7168974.sra spots: 15082485 blocks: [[1, 754124], [754125, 1508248], [1508249, 2262372], [2262373, 3016496], [3016497, 3770620], [3770621, 4524744], [4524745, 5278868], [5278869, 6032992], [6032993, 6787116], [6787117, 7541240], [7541241, 8295364], [8295365, 9049488], [9049489, 9803612], [9803613, 10557736], [10557737, 11311860], [11311861, 12065984], [12065985, 12820108], [12820109, 13574232], [13574233, 14328356], [14328357, 15082485]] SRR7168974 file size 5089258 SRR7168974 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168974 SRR7168974_1.fastq SRR7168974_2.fastq Input file: SRR7168974_1.fastq Paired file: SRR7168974_2.fastq trimmed: SRR7168974-trimmed-pair1.fastq, SRR7168974-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:19:14 2025 >> started Mon Feb 10 13:19:31 2025 >> done (17.235s) 15082485 read pairs processed; of these: 13982 ( 0.09%) short read pairs filtered out after trimming by size control 8407 ( 0.06%) empty read pairs filtered out after trimming by size control 15060096 (99.85%) read pairs available; of these: 5933519 (39.40%) trimmed read pairs available after processing 9126577 (60.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 4 0.00% 21 1 0.00% 22 7 0.00% 23 2 0.00% 24 3 0.00% 25 0 0.00% 26 6 0.00% 27 7 0.00% 28 3 0.00% 29 2 0.00% 30 8 0.00% 31 5 0.00% 32 3 0.00% 33 3 0.00% 34 11 0.00% 35 7 0.00% 36 5 0.00% 37 3 0.00% 38 6 0.00% 39 6 0.00% 40 6 0.00% 41 6 0.00% 42 1 0.00% 43 12 0.00% 44 3 0.00% 45 9 0.00% 46 8 0.00% 47 7 0.00% 48 8 0.00% 49 19 0.00% 50 17 0.00% 51 19 0.00% 52 12 0.00% 53 31 0.00% 54 24 0.00% 55 29 0.00% 56 29 0.00% 57 33 0.00% 58 37 0.00% 59 41 0.00% 60 68 0.00% 61 54 0.00% 62 62 0.00% 63 69 0.00% 64 77 0.00% 65 82 0.00% 66 83 0.00% 67 119 0.00% 68 137 0.00% 69 146 0.00% 70 178 0.00% 71 150 0.00% 72 216 0.00% 73 250 0.00% 74 276 0.00% 75 292 0.00% 76 372 0.00% 77 383 0.00% 78 459 0.00% 79 497 0.00% 80 541 0.00% 81 634 0.00% 82 756 0.01% 83 902 0.01% 84 1545 0.01% 85 1927 0.01% 86 2069 0.01% 87 2228 0.01% 88 2465 0.02% 89 2372 0.02% 90 2586 0.02% 91 2803 0.02% 92 2991 0.02% 93 3289 0.02% 94 3606 0.02% 95 3686 0.02% 96 3965 0.03% 97 4080 0.03% 98 4484 0.03% 99 4701 0.03% 100 5110 0.03% 101 5629 0.04% 102 6116 0.04% 103 6513 0.04% 104 7223 0.05% 105 7554 0.05% 106 8053 0.05% 107 8592 0.06% 108 8979 0.06% 109 9564 0.06% 110 10001 0.07% 111 10980 0.07% 112 11659 0.08% 113 12548 0.08% 114 13706 0.09% 115 14328 0.10% 116 15243 0.10% 117 16269 0.11% 118 16942 0.11% 119 17654 0.12% 120 18295 0.12% 121 19737 0.13% 122 20851 0.14% 123 22844 0.15% 124 24535 0.16% 125 25901 0.17% 126 27268 0.18% 127 28771 0.19% 128 30134 0.20% 129 31719 0.21% 130 33832 0.22% 131 35056 0.23% 132 38396 0.25% 133 41186 0.27% 134 44338 0.29% 135 47736 0.32% 136 50876 0.34% 137 55130 0.37% 138 59485 0.39% 139 64023 0.43% 140 69075 0.46% 141 76441 0.51% 142 83829 0.56% 143 94616 0.63% 144 109205 0.73% 145 130278 0.87% 146 158955 1.06% 147 211520 1.40% 148 313911 2.08% 149 608136 4.04% 150 3088723 20.51% 151 9126577 60.60% 15060096 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=208.67 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=35 prefix-density=0.23 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=77.21 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.0 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7168974 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:20:15 Started mapping on | Feb 10 13:20:15 Finished on | Feb 10 13:21:37 Mapping speed, Million of reads per hour | 661.17 Number of input reads | 15060096 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14342253 Uniquely mapped reads % | 95.23% Average mapped length | 296.46 Number of splices: Total | 13598387 Number of splices: Annotated (sjdb) | 13371814 Number of splices: GT/AG | 13403490 Number of splices: GC/AG | 155313 Number of splices: AT/AC | 10407 Number of splices: Non-canonical | 29177 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269340 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 40782 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 461200 461200 461200 N_multimapping 269340 269340 269340 N_noFeature 345966 14172563 421909 N_ambiguous 151338 791 57020 UnstrandedReadsAssigned:13844949 PositiveStrandReadsAssigned:168899 NegativeStrandReadsAssigned:13863324 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168974 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168974-trimmed-pair1.fastq SRR7168974-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,060,096 reads, 13,781,018 reads pseudoaligned [quant] estimated average fragment length: 253.643 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR7168974.ke.tsv 34699 SRR7168974.se.tsv 87100 total ==> SRR7168974.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.36 256 10.2054 Potri.005G024800.1.v4.1 1035 782.357 39 3.5082 Potri.004G059700.1.v4.1 961 708.425 2 0.198683 Potri.007G009000.2.v4.1 1416 1163.36 0 0 Potri.003G141000.2.v4.1 2943 2690.36 206.103 5.39138 Potri.016G087400.1.v4.1 270 72.66 1401 1356.96 Potri.015G069301.1.v4.1 564 317.85 0 0 Potri.010G195200.1.v4.1 1773 1520.36 14 0.648048 Potri.012G127500.1.v4.1 977 724.391 3871 376.075 ==> SRR7168974.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1406 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 252 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168974 completed mapping pipeline successfully