Starting /dee2/code/volunteer_pipeline.sh SRR7168975 current disk space = 3059076141056 free memory = 1181067924 SRR7168975 SRAfilesize 123a43623e9b063784591a4c84114768 SRR7168975.sra SRR7168975.sra file validated SRR7168975 is paired end SRR7168975 is conventional basespace SRR7168975 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168975_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.05675 34.0 33.0 34.0 27.0 34.0 2 32.78025 34.0 33.0 34.0 28.0 34.0 3 33.00525 34.0 33.0 34.0 32.0 34.0 4 33.24575 34.0 33.0 34.0 32.0 34.0 5 33.20875 34.0 33.0 34.0 32.0 34.0 6 36.86925 38.0 37.0 38.0 35.0 38.0 7 37.1925 38.0 38.0 38.0 36.0 38.0 8 37.34475 38.0 38.0 38.0 37.0 38.0 9 37.4045 38.0 38.0 38.0 37.0 38.0 10-14 37.32899999999999 38.0 38.0 38.0 36.8 38.0 15-19 37.35335 38.0 38.0 38.0 37.0 38.0 20-24 37.3257 38.0 38.0 38.0 37.0 38.0 25-29 37.274350000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.267250000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.2151 38.0 38.0 38.0 36.6 38.0 40-44 36.9978 38.0 38.0 38.0 35.6 38.0 45-49 36.8713 38.0 38.0 38.0 35.0 38.0 50-54 36.79365 38.0 38.0 38.0 35.0 38.0 55-59 36.7208 38.0 38.0 38.0 34.2 38.0 60-64 36.563900000000004 38.0 38.0 38.0 34.0 38.0 65-69 36.5418 38.0 38.0 38.0 34.0 38.0 70-74 36.503750000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.309799999999996 38.0 37.0 38.0 33.8 38.0 80-84 36.148999999999994 38.0 37.0 38.0 33.0 38.0 85-89 36.08275 38.0 37.0 38.0 33.0 38.0 90-94 35.9362 38.0 37.0 38.0 32.6 38.0 95-99 35.550799999999995 38.0 36.6 38.0 30.2 38.0 100-104 35.2202 38.0 36.0 38.0 28.6 38.0 105-109 35.1652 38.0 36.0 38.0 28.6 38.0 110-114 35.004900000000006 38.0 35.8 38.0 28.2 38.0 115-119 34.68425 38.0 35.0 38.0 26.6 38.0 120-124 33.9066 38.0 34.2 38.0 20.0 38.0 125-129 33.60295 38.0 34.0 38.0 19.0 38.0 130-134 33.6802 38.0 34.0 38.0 20.2 38.0 135-139 33.25965 38.0 33.6 38.0 18.6 38.0 140-144 32.4991 38.0 33.2 38.0 14.4 38.0 145-149 31.022399999999998 36.0 31.0 38.0 8.8 38.0 150-151 27.505499999999998 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 2.0 14 2.0 15 1.0 16 2.0 17 7.0 18 7.0 19 5.0 20 7.0 21 7.0 22 9.0 23 14.0 24 22.0 25 23.0 26 27.0 27 38.0 28 46.0 29 52.0 30 70.0 31 93.0 32 111.0 33 153.0 34 251.0 35 429.0 36 906.0 37 1713.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.66059957173448 13.302997858672377 10.653104925053533 38.38329764453962 2 21.8 16.650000000000002 32.550000000000004 28.999999999999996 3 19.075 22.425 26.3 32.2 4 22.15 30.099999999999998 22.375 25.374999999999996 5 21.605401350337583 34.08352088022005 24.306076519129782 20.005001250312578 6 20.424999999999997 36.075 23.400000000000002 20.1 7 14.7 25.1 41.4 18.8 8 18.55 25.874999999999996 30.375000000000004 25.2 9 18.075 24.325 33.625 23.974999999999998 10-14 19.895 30.349999999999998 26.025 23.73 15-19 20.24 29.04 27.034999999999997 23.685000000000002 20-24 19.955000000000002 29.01 27.62 23.415 25-29 20.025000000000002 29.520000000000003 27.015 23.44 30-34 19.939999999999998 29.17 27.150000000000002 23.74 35-39 19.97 28.915000000000003 27.005000000000003 24.11 40-44 20.765 28.735 27.284999999999997 23.215 45-49 20.18 28.89 26.939999999999998 23.990000000000002 50-54 20.505000000000003 28.475 26.97 24.05 55-59 20.375 28.26 27.474999999999998 23.89 60-64 20.200000000000003 29.03 27.189999999999998 23.580000000000002 65-69 20.349999999999998 28.615000000000002 26.8 24.235 70-74 20.305 29.005 26.83 23.86 75-79 20.82 28.360000000000003 26.979999999999997 23.84 80-84 20.355 28.77 26.86 24.015 85-89 20.48 28.625 27.3 23.595 90-94 20.68 29.035 26.325 23.96 95-99 20.515 28.895 26.955000000000002 23.635 100-104 20.865000000000002 28.58 27.089999999999996 23.465 105-109 20.974999999999998 28.595 26.765 23.665 110-114 20.990000000000002 28.139999999999997 26.88 23.990000000000002 115-119 20.47 28.389999999999997 27.1 24.04 120-124 21.215 27.955000000000002 26.8 24.03 125-129 20.880000000000003 28.335 26.840000000000003 23.945 130-134 20.765 28.62 26.534999999999997 24.08 135-139 20.625 27.935 27.115000000000002 24.325 140-144 21.065 28.22 26.455000000000002 24.26 145-149 21.455 28.255000000000003 26.305 23.985 150-151 21.1375 27.200000000000003 27.712500000000002 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.5 26 5.0 27 7.5 28 12.0 29 14.0 30 17.0 31 32.0 32 40.0 33 37.5 34 50.5 35 75.0 36 93.0 37 107.0 38 125.0 39 155.0 40 175.5 41 193.5 42 225.5 43 246.0 44 271.5 45 287.5 46 268.5 47 250.0 48 230.5 49 202.5 50 168.0 51 139.0 52 117.0 53 108.5 54 94.5 55 56.0 56 39.5 57 36.0 58 24.5 59 21.5 60 17.0 61 10.0 62 10.5 63 7.5 64 6.5 65 5.5 66 2.5 67 1.5 68 2.5 69 3.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.6000000000000005 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.4875 0.0 0.0 0.0 0.0 120-121 1.8375 0.0 0.0 0.0 0.0 122-123 2.0375 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.525 0.0 0.0 0.0 0.0 128-129 2.7125 0.0 0.0 0.0 0.0 130-131 3.05 0.0 0.0 0.0 0.0 132-133 3.4875 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.300000000000001 0.0 0.0 0.0 0.0 138-139 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTATC 10 0.0068396386 144.9375 5 >>END_MODULE SRR7168975 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168975_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.719 33.0 33.0 34.0 32.0 34.0 2 32.733 34.0 33.0 34.0 32.0 34.0 3 32.7745 34.0 33.0 34.0 32.0 34.0 4 32.71425 34.0 33.0 34.0 32.0 34.0 5 32.705 34.0 33.0 34.0 32.0 34.0 6 36.923 38.0 38.0 38.0 36.0 38.0 7 36.97125 38.0 38.0 38.0 36.0 38.0 8 37.06675 38.0 38.0 38.0 37.0 38.0 9 37.01625 38.0 38.0 38.0 37.0 38.0 10-14 36.909000000000006 38.0 38.0 38.0 36.0 38.0 15-19 36.8867 38.0 38.0 38.0 36.4 38.0 20-24 36.8798 38.0 38.0 38.0 36.2 38.0 25-29 36.78315 38.0 38.0 38.0 36.2 38.0 30-34 36.638850000000005 38.0 38.0 38.0 35.6 38.0 35-39 36.715999999999994 38.0 38.0 38.0 35.8 38.0 40-44 36.6914 38.0 38.0 38.0 36.0 38.0 45-49 36.63305 38.0 38.0 38.0 35.8 38.0 50-54 36.55585 38.0 38.0 38.0 35.0 38.0 55-59 36.449850000000005 38.0 38.0 38.0 35.0 38.0 60-64 36.40265000000001 38.0 38.0 38.0 34.8 38.0 65-69 36.27675000000001 38.0 38.0 38.0 34.0 38.0 70-74 36.2181 38.0 38.0 38.0 34.0 38.0 75-79 36.1566 38.0 38.0 38.0 34.0 38.0 80-84 36.03195000000001 38.0 38.0 38.0 33.4 38.0 85-89 35.94500000000001 38.0 38.0 38.0 33.2 38.0 90-94 35.86569999999999 38.0 38.0 38.0 33.0 38.0 95-99 35.7054 38.0 38.0 38.0 32.0 38.0 100-104 35.538 38.0 37.0 38.0 31.0 38.0 105-109 35.466300000000004 38.0 37.2 38.0 30.8 38.0 110-114 35.249649999999995 38.0 37.0 38.0 29.8 38.0 115-119 35.0041 38.0 36.8 38.0 28.4 38.0 120-124 34.95585 38.0 36.2 38.0 28.2 38.0 125-129 34.54875 38.0 35.8 38.0 25.6 38.0 130-134 34.099650000000004 38.0 35.0 38.0 22.6 38.0 135-139 33.75535 38.0 35.0 38.0 21.4 38.0 140-144 33.43169999999999 38.0 35.0 38.0 18.4 38.0 145-149 32.535199999999996 38.0 33.6 38.0 11.2 38.0 150-151 27.8555 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 7.0 4 3.0 5 3.0 6 1.0 7 6.0 8 10.0 9 7.0 10 1.0 11 4.0 12 5.0 13 1.0 14 4.0 15 3.0 16 7.0 17 5.0 18 7.0 19 9.0 20 7.0 21 7.0 22 11.0 23 18.0 24 19.0 25 21.0 26 24.0 27 35.0 28 40.0 29 48.0 30 48.0 31 71.0 32 79.0 33 114.0 34 142.0 35 248.0 36 508.0 37 2467.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.02682376535473 19.82953121082978 15.69315617949361 27.450488844321885 2 27.93786018541719 25.95840641443247 28.48910047607116 17.614632924079178 3 20.882426673351716 28.32790172975683 30.33341689646528 20.45625470042617 4 25.119077463023316 32.94058661318626 23.113562296314864 18.826773627475557 5 26.39759338179995 35.74830784657809 20.631737277513164 17.2223614941088 6 21.896896896896898 36.286286286286284 23.673673673673672 18.143143143143142 7 20.77077077077077 20.87087087087087 38.288288288288285 20.07007007007007 8 23.123123123123122 23.923923923923923 27.077077077077078 25.875875875875877 9 21.946946946946948 25.400400400400404 30.005005005005003 22.64764764764765 10-14 23.543543543543542 28.008008008008005 26.606606606606608 21.84184184184184 15-19 23.15431202762901 27.513889584063268 27.513889584063268 21.817908804244457 20-24 23.371877659308204 28.027231316013417 27.351454172298144 21.24943685238024 25-29 24.12153368705576 27.675442987286015 26.429071979177092 21.77395134648113 30-34 23.56091700870958 28.130944038442284 26.989688657523274 21.318450295324855 35-39 23.890084588818258 27.67405776064868 27.143500675709497 21.292356974823566 40-44 24.138966760112133 27.61814177012415 27.19263115738887 21.05026031237485 45-49 23.198998748435546 27.71964956195244 27.80976220275344 21.271589486858574 50-54 23.574753491165723 27.61399469442915 27.799189148606036 21.01206266579909 55-59 24.072683586124043 27.907093157130703 27.406517495119388 20.61370576162587 60-64 23.934918648310386 27.589486858573213 27.784730913642054 20.690863579474343 65-69 23.764705882352942 27.739674593241553 27.18898623279099 21.306633291614517 70-74 24.515644555694617 27.49436795994994 27.394242803504383 20.595744680851062 75-79 23.93372046455747 27.873448137765315 27.13756507809371 21.0552663195835 80-84 23.97496871088861 26.87359198998748 28.205256570713395 20.946182728410513 85-89 24.330413016270338 27.74468085106383 27.173967459324157 20.750938673341675 90-94 24.471813357364574 27.49574446780815 28.00640833083008 20.026033843997197 95-99 23.981175528186643 27.831180534695104 27.801141483929108 20.386502453189145 100-104 24.05006257822278 27.058823529411764 27.95994993742178 20.93116395494368 105-109 24.480600750938674 27.449311639549435 27.524405506883603 20.545682102628284 110-114 24.245306633291612 27.27909887359199 27.609511889862326 20.866082603254068 115-119 24.399158822351293 27.143000200280394 27.58361706388944 20.874223913478872 120-124 23.79474342928661 27.674593241551943 28.000000000000004 20.530663329161452 125-129 24.391709221988584 27.105236807850204 28.241714228497045 20.261339741664163 130-134 24.893606368597606 26.976418164522105 27.62729685074851 20.502678616131778 135-139 24.56193050966256 26.80484630019025 27.926304195454087 20.7069189946931 140-144 24.65952333266573 27.35329461245744 27.34328059282996 20.643901462046866 145-149 25.622027534418024 26.988735919899874 27.63454317897372 19.754693366708388 150-151 25.647441511322405 27.061178531214814 27.298886525709996 19.992493431752784 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 1.0 25 1.0 26 1.5 27 2.0 28 5.5 29 8.5 30 9.0 31 8.0 32 12.5 33 23.5 34 30.0 35 43.5 36 66.5 37 81.5 38 105.5 39 147.0 40 173.0 41 217.5 42 260.0 43 276.0 44 282.5 45 274.5 46 277.0 47 270.0 48 267.5 49 237.5 50 182.5 51 150.0 52 130.5 53 122.0 54 89.5 55 55.0 56 45.0 57 35.5 58 24.0 59 20.5 60 14.5 61 9.5 62 8.5 63 5.5 64 5.0 65 2.5 66 0.5 67 1.0 68 1.5 69 1.0 70 1.5 71 1.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.22499999999999998 3 0.27499999999999997 4 0.27499999999999997 5 0.27499999999999997 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.1 15-19 0.105 20-24 0.11499999999999999 25-29 0.11 30-34 0.11 35-39 0.105 40-44 0.12 45-49 0.125 50-54 0.105 55-59 0.11499999999999999 60-64 0.125 65-69 0.125 70-74 0.125 75-79 0.12 80-84 0.125 85-89 0.125 90-94 0.13 95-99 0.13 100-104 0.125 105-109 0.125 110-114 0.125 115-119 0.13999999999999999 120-124 0.125 125-129 0.13 130-134 0.135 135-139 0.13 140-144 0.13999999999999999 145-149 0.125 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.38749999999999996 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.7250000000000001 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.4249999999999998 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 1.9749999999999999 0.0 0.0 0.0 0.0 124-125 2.25 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.4375 0.0 0.0 0.0 0.0 134-135 3.85 0.0 0.0 0.0 0.0 136-137 4.35 0.0 0.0 0.0 0.0 138-139 4.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATAG 10 0.0065840036 146.77216 1 >>END_MODULE Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925245 spots for SRR7168975.sra Written 925245 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra Read 925231 spots for SRR7168975.sra Written 925231 spots for SRR7168975.sra SRR ids: ['SRR7168975.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4wudu9ty SRR7168975.sra spots: 18504634 blocks: [[1, 925231], [925232, 1850462], [1850463, 2775693], [2775694, 3700924], [3700925, 4626155], [4626156, 5551386], [5551387, 6476617], [6476618, 7401848], [7401849, 8327079], [8327080, 9252310], [9252311, 10177541], [10177542, 11102772], [11102773, 12028003], [12028004, 12953234], [12953235, 13878465], [13878466, 14803696], [14803697, 15728927], [15728928, 16654158], [16654159, 17579389], [17579390, 18504634]] SRR7168975 file size 6248912 SRR7168975 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168975 SRR7168975_1.fastq SRR7168975_2.fastq Input file: SRR7168975_1.fastq Paired file: SRR7168975_2.fastq trimmed: SRR7168975-trimmed-pair1.fastq, SRR7168975-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:32:18 2025 >> started Mon Feb 10 13:32:49 2025 >> done (31.160s) 18504634 read pairs processed; of these: 33924 ( 0.18%) short read pairs filtered out after trimming by size control 73071 ( 0.39%) empty read pairs filtered out after trimming by size control 18397639 (99.42%) read pairs available; of these: 9218709 (50.11%) trimmed read pairs available after processing 9178930 (49.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 3 0.00% 24 1 0.00% 25 4 0.00% 26 5 0.00% 27 10 0.00% 28 3 0.00% 29 3 0.00% 30 5 0.00% 31 8 0.00% 32 10 0.00% 33 5 0.00% 34 14 0.00% 35 9 0.00% 36 11 0.00% 37 13 0.00% 38 8 0.00% 39 10 0.00% 40 12 0.00% 41 10 0.00% 42 17 0.00% 43 10 0.00% 44 18 0.00% 45 23 0.00% 46 17 0.00% 47 31 0.00% 48 32 0.00% 49 47 0.00% 50 35 0.00% 51 35 0.00% 52 54 0.00% 53 61 0.00% 54 65 0.00% 55 59 0.00% 56 61 0.00% 57 90 0.00% 58 100 0.00% 59 104 0.00% 60 121 0.00% 61 150 0.00% 62 160 0.00% 63 194 0.00% 64 198 0.00% 65 239 0.00% 66 234 0.00% 67 261 0.00% 68 291 0.00% 69 379 0.00% 70 403 0.00% 71 436 0.00% 72 529 0.00% 73 638 0.00% 74 610 0.00% 75 815 0.00% 76 898 0.00% 77 983 0.01% 78 1080 0.01% 79 1259 0.01% 80 1442 0.01% 81 1566 0.01% 82 1908 0.01% 83 2281 0.01% 84 3652 0.02% 85 4444 0.02% 86 4673 0.03% 87 4722 0.03% 88 4950 0.03% 89 5247 0.03% 90 5514 0.03% 91 5800 0.03% 92 6332 0.03% 93 6901 0.04% 94 7526 0.04% 95 7799 0.04% 96 8255 0.04% 97 8798 0.05% 98 9281 0.05% 99 9730 0.05% 100 10587 0.06% 101 11175 0.06% 102 12160 0.07% 103 13350 0.07% 104 14164 0.08% 105 15339 0.08% 106 16078 0.09% 107 16871 0.09% 108 17895 0.10% 109 18722 0.10% 110 19946 0.11% 111 21036 0.11% 112 22800 0.12% 113 24376 0.13% 114 26033 0.14% 115 27848 0.15% 116 29307 0.16% 117 30755 0.17% 118 32299 0.18% 119 33393 0.18% 120 34607 0.19% 121 36504 0.20% 122 38137 0.21% 123 41670 0.23% 124 44708 0.24% 125 47405 0.26% 126 50063 0.27% 127 52869 0.29% 128 55052 0.30% 129 57481 0.31% 130 60709 0.33% 131 63889 0.35% 132 67419 0.37% 133 71919 0.39% 134 76910 0.42% 135 82953 0.45% 136 87777 0.48% 137 93094 0.51% 138 98803 0.54% 139 107308 0.58% 140 115617 0.63% 141 126510 0.69% 142 139627 0.76% 143 157708 0.86% 144 181487 0.99% 145 216220 1.18% 146 266107 1.45% 147 352205 1.91% 148 523568 2.85% 149 994185 5.40% 150 4340352 23.59% 151 9178930 49.89% 18397639 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=276.36 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=17.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=19.04 fanout-score-rank=7 prefix-density=0.48 prefix-fanout=7.6 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=151.04 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=14.2 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATG SRR7168975 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:34:06 Started mapping on | Feb 10 13:34:07 Finished on | Feb 10 13:36:25 Mapping speed, Million of reads per hour | 479.94 Number of input reads | 18397639 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16129293 Uniquely mapped reads % | 87.67% Average mapped length | 289.81 Number of splices: Total | 14906226 Number of splices: Annotated (sjdb) | 14672468 Number of splices: GT/AG | 14692234 Number of splices: GC/AG | 172412 Number of splices: AT/AC | 11534 Number of splices: Non-canonical | 30046 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 293760 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 43889 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.42% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1995578 1995578 1995578 N_multimapping 293760 293760 293760 N_noFeature 301045 15953340 368988 N_ambiguous 197806 1392 88730 UnstrandedReadsAssigned:15630442 PositiveStrandReadsAssigned:174561 NegativeStrandReadsAssigned:15671575 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=145 echo kmer=141 SRR7168975 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168975-trimmed-pair1.fastq SRR7168975-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,397,639 reads, 16,622,780 reads pseudoaligned [quant] estimated average fragment length: 229.075 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR7168975.ke.tsv 34699 SRR7168975.se.tsv 87100 total ==> SRR7168975.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.92 279 8.27244 Potri.005G024800.1.v4.1 1035 806.925 29 1.90734 Potri.004G059700.1.v4.1 961 732.931 6 0.434463 Potri.007G009000.2.v4.1 1416 1187.92 0 0 Potri.003G141000.2.v4.1 2943 2714.92 295 5.76672 Potri.016G087400.1.v4.1 270 81.0449 1890 1237.66 Potri.015G069301.1.v4.1 564 338.558 0 0 Potri.010G195200.1.v4.1 1773 1544.92 11 0.377876 Potri.012G127500.1.v4.1 977 748.925 9418 667.398 ==> SRR7168975.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 746 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 341 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168975 completed mapping pipeline successfully