Starting /dee2/code/volunteer_pipeline.sh SRR7168976 current disk space = 3058835062784 free memory = 1343805344 SRR7168976 SRAfilesize f411e5d79fddec41b69805326770735c SRR7168976.sra SRR7168976.sra file validated SRR7168976 is paired end SRR7168976 is conventional basespace SRR7168976 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168976_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0395 34.0 34.0 34.0 33.0 34.0 2 33.4435 34.0 34.0 34.0 33.0 34.0 3 33.47225 34.0 34.0 34.0 33.0 34.0 4 33.5215 34.0 34.0 34.0 33.0 34.0 5 33.5465 34.0 34.0 34.0 33.0 34.0 6 37.196 38.0 38.0 38.0 36.0 38.0 7 37.479 38.0 38.0 38.0 37.0 38.0 8 37.513 38.0 38.0 38.0 38.0 38.0 9 37.5965 38.0 38.0 38.0 38.0 38.0 10-14 37.5671 38.0 38.0 38.0 38.0 38.0 15-19 37.5941 38.0 38.0 38.0 38.0 38.0 20-24 37.57165 38.0 38.0 38.0 38.0 38.0 25-29 37.537099999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.51025 38.0 38.0 38.0 37.8 38.0 35-39 37.374399999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.2952 38.0 38.0 38.0 37.0 38.0 45-49 37.255250000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.223200000000006 38.0 38.0 38.0 36.2 38.0 55-59 37.15675 38.0 38.0 38.0 36.0 38.0 60-64 37.06335 38.0 38.0 38.0 36.0 38.0 65-69 37.04275 38.0 38.0 38.0 36.0 38.0 70-74 37.03380000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.84855 38.0 38.0 38.0 35.4 38.0 80-84 36.885400000000004 38.0 38.0 38.0 35.6 38.0 85-89 36.788850000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.65605000000001 38.0 38.0 38.0 34.6 38.0 95-99 36.56895 38.0 38.0 38.0 34.4 38.0 100-104 36.40185 38.0 38.0 38.0 34.0 38.0 105-109 36.264500000000005 38.0 37.8 38.0 34.0 38.0 110-114 36.012699999999995 38.0 37.0 38.0 33.0 38.0 115-119 35.909800000000004 38.0 37.0 38.0 32.6 38.0 120-124 35.777750000000005 38.0 37.0 38.0 32.2 38.0 125-129 35.5619 38.0 36.2 38.0 31.0 38.0 130-134 35.2507 38.0 36.0 38.0 29.4 38.0 135-139 34.99245 38.0 35.8 38.0 28.2 38.0 140-144 34.68395 38.0 35.0 38.0 27.8 38.0 145-149 33.945249999999994 38.0 35.0 38.0 23.4 38.0 150-151 30.748624999999997 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 3.0 16 1.0 17 1.0 18 3.0 19 6.0 20 5.0 21 1.0 22 12.0 23 7.0 24 4.0 25 17.0 26 17.0 27 23.0 28 24.0 29 27.0 30 34.0 31 33.0 32 67.0 33 91.0 34 151.0 35 252.0 36 673.0 37 2545.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.512071156289707 11.359593392630241 15.222363405336722 41.905972045743326 2 21.375 14.374999999999998 35.099999999999994 29.15 3 20.200000000000003 19.5 26.224999999999998 34.075 4 22.75 27.925 23.674999999999997 25.650000000000002 5 23.225 33.225 24.224999999999998 19.325 6 19.525000000000002 36.125 24.55 19.8 7 14.6 26.875 39.725 18.8 8 17.75 28.15 30.5 23.599999999999998 9 18.7 24.65 33.75 22.900000000000002 10-14 19.31 30.0 26.625 24.065 15-19 19.805 29.04 27.815 23.34 20-24 19.875 28.865000000000002 27.750000000000004 23.51 25-29 19.845 28.754999999999995 27.384999999999998 24.015 30-34 19.94199419941994 29.45794579457946 26.907690769076908 23.692369236923692 35-39 20.059011802360473 28.42068413682737 27.995599119823964 23.524704940988197 40-44 19.98 29.255 27.115000000000002 23.65 45-49 20.369999999999997 28.685 27.310000000000002 23.635 50-54 19.855 28.299999999999997 27.38 24.465 55-59 20.091004550227513 29.031451572578632 27.2013600680034 23.67618380919046 60-64 20.085 28.62 27.515 23.78 65-69 20.23 28.970000000000002 27.29 23.51 70-74 19.775000000000002 28.74 27.36 24.125 75-79 20.9 28.665000000000003 26.540000000000003 23.895 80-84 20.29 28.815 27.665 23.23 85-89 20.669999999999998 28.49 27.365000000000002 23.474999999999998 90-94 20.8 28.595 26.939999999999998 23.665 95-99 20.0 28.27 27.675 24.055 100-104 20.51 28.355000000000004 27.500000000000004 23.635 105-109 20.02 29.185 27.284999999999997 23.51 110-114 20.69 28.165000000000003 27.49 23.655 115-119 20.205000000000002 29.025000000000002 27.35 23.419999999999998 120-124 20.349999999999998 28.23 27.41 24.01 125-129 20.26 28.884999999999998 27.405 23.45 130-134 20.525 28.315 27.445000000000004 23.715 135-139 20.891044552227612 28.88144407220361 26.781339066953347 23.44617230861543 140-144 20.71 28.21 27.055 24.025 145-149 20.96 28.595 27.74 22.705000000000002 150-151 21.125 28.6875 26.7625 23.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 0.5 23 2.0 24 3.0 25 4.0 26 8.0 27 8.5 28 7.5 29 15.5 30 21.0 31 27.0 32 30.0 33 40.5 34 57.5 35 73.0 36 91.0 37 112.5 38 131.5 39 158.5 40 189.0 41 198.0 42 219.5 43 256.5 44 263.0 45 268.5 46 273.5 47 250.5 48 233.5 49 208.0 50 173.5 51 147.0 52 127.5 53 98.5 54 71.5 55 56.5 56 44.0 57 38.5 58 27.5 59 14.5 60 11.5 61 9.0 62 5.0 63 4.5 64 5.0 65 3.5 66 2.0 67 0.5 68 0.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.36250000000000004 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 0.9875 0.0 0.0 0.0 0.0 126-127 1.0499999999999998 0.0 0.0 0.0 0.0 128-129 1.1625 0.0 0.0 0.0 0.0 130-131 1.325 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.7999999999999998 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTATTG 10 0.006832588 144.9875 3 GAGATCG 10 0.006832588 144.9875 145 >>END_MODULE SRR7168976 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168976_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8975 33.0 33.0 34.0 32.0 34.0 2 33.02675 34.0 33.0 34.0 32.0 34.0 3 33.062 34.0 33.0 34.0 33.0 34.0 4 33.048 34.0 33.0 34.0 33.0 34.0 5 32.98625 34.0 33.0 34.0 33.0 34.0 6 37.2215 38.0 38.0 38.0 37.0 38.0 7 37.22725 38.0 38.0 38.0 37.0 38.0 8 37.197 38.0 38.0 38.0 37.0 38.0 9 37.2295 38.0 38.0 38.0 37.0 38.0 10-14 37.117200000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.07925 38.0 38.0 38.0 37.0 38.0 20-24 37.05 38.0 38.0 38.0 37.0 38.0 25-29 37.0038 38.0 38.0 38.0 37.0 38.0 30-34 37.0326 38.0 38.0 38.0 37.0 38.0 35-39 36.996900000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.004599999999996 38.0 38.0 38.0 37.0 38.0 45-49 36.91035 38.0 38.0 38.0 36.6 38.0 50-54 36.881550000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.8918 38.0 38.0 38.0 36.0 38.0 60-64 36.8055 38.0 38.0 38.0 36.0 38.0 65-69 36.68875 38.0 38.0 38.0 35.8 38.0 70-74 36.5537 38.0 38.0 38.0 35.0 38.0 75-79 36.5268 38.0 38.0 38.0 35.2 38.0 80-84 36.48315 38.0 38.0 38.0 35.0 38.0 85-89 36.38995 38.0 38.0 38.0 34.2 38.0 90-94 36.27434999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.183800000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.0032 38.0 38.0 38.0 33.8 38.0 105-109 35.9029 38.0 38.0 38.0 33.2 38.0 110-114 35.683949999999996 38.0 37.2 38.0 31.8 38.0 115-119 35.5428 38.0 37.0 38.0 31.2 38.0 120-124 35.18255 38.0 36.4 38.0 29.2 38.0 125-129 34.84785 38.0 36.0 38.0 28.0 38.0 130-134 34.55929999999999 38.0 35.8 38.0 26.8 38.0 135-139 34.2226 38.0 35.2 38.0 23.6 38.0 140-144 33.6503 38.0 35.0 38.0 21.8 38.0 145-149 33.05465 38.0 34.0 38.0 16.8 38.0 150-151 29.085125 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 5.0 5 0.0 6 1.0 7 1.0 8 0.0 9 2.0 10 2.0 11 4.0 12 3.0 13 3.0 14 3.0 15 3.0 16 3.0 17 4.0 18 7.0 19 6.0 20 12.0 21 10.0 22 10.0 23 7.0 24 11.0 25 24.0 26 27.0 27 21.0 28 26.0 29 37.0 30 35.0 31 42.0 32 74.0 33 97.0 34 122.0 35 246.0 36 566.0 37 2568.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.975 18.275 22.6 30.15 2 26.075 23.7 30.9 19.325 3 20.65 26.974999999999998 31.324999999999996 21.05 4 24.3 31.075000000000003 24.725 19.900000000000002 5 24.975 33.5 23.849999999999998 17.675 6 20.525 36.7 24.025 18.75 7 19.625 21.85 39.275 19.25 8 21.975 25.624999999999996 28.675 23.724999999999998 9 21.825 24.65 29.725 23.799999999999997 10-14 23.455000000000002 28.715000000000003 26.795 21.035 15-19 23.075000000000003 28.125 28.050000000000004 20.75 20-24 22.63 27.925 28.17 21.275 25-29 22.919999999999998 27.685 28.249999999999996 21.145 30-34 22.525000000000002 27.765 28.585 21.125 35-39 23.22 27.66 27.855 21.265 40-44 23.275000000000002 28.03 27.755000000000003 20.94 45-49 23.25 27.57 28.255000000000003 20.925 50-54 23.235 28.21 27.685 20.87 55-59 23.345 27.965 27.54 21.15 60-64 23.175 27.375 28.765 20.685000000000002 65-69 22.830000000000002 28.065 28.175 20.93 70-74 23.685000000000002 27.565 27.905 20.845 75-79 22.82 27.54 28.37 21.27 80-84 23.54 27.61 28.035 20.815 85-89 23.5 27.634999999999998 28.46 20.405 90-94 23.49 28.21 28.084999999999997 20.215 95-99 23.51 28.03 28.215 20.244999999999997 100-104 23.5 27.355 28.660000000000004 20.485 105-109 23.785 27.555000000000003 27.96 20.7 110-114 23.535 27.589999999999996 28.244999999999997 20.630000000000003 115-119 23.885 27.54 28.535 20.04 120-124 23.494999999999997 27.755000000000003 27.97 20.78 125-129 23.69 27.445000000000004 28.22 20.645 130-134 24.02 27.705000000000002 27.96 20.315 135-139 24.095 27.685 27.715 20.505000000000003 140-144 24.32 28.115000000000002 27.195000000000004 20.369999999999997 145-149 24.215 27.405 27.91 20.47 150-151 23.7625 27.5875 28.375 20.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 0.5 25 1.5 26 2.0 27 5.0 28 9.0 29 12.5 30 12.0 31 16.0 32 22.5 33 31.5 34 39.0 35 54.5 36 87.0 37 111.5 38 130.5 39 152.5 40 190.0 41 245.0 42 281.0 43 281.5 44 272.5 45 287.5 46 277.0 47 255.0 48 250.0 49 213.0 50 180.5 51 144.5 52 102.5 53 88.0 54 70.5 55 47.0 56 30.5 57 21.0 58 20.0 59 14.0 60 8.0 61 5.5 62 5.5 63 6.0 64 3.0 65 0.5 66 1.0 67 1.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 0.9125 0.0 0.0 0.0 0.0 124-125 1.0125 0.0 0.0 0.0 0.0 126-127 1.0750000000000002 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.7999999999999998 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768435 spots for SRR7168976.sra Written 768435 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra Read 768426 spots for SRR7168976.sra Written 768426 spots for SRR7168976.sra SRR ids: ['SRR7168976.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0d5fn2lw SRR7168976.sra spots: 15368529 blocks: [[1, 768426], [768427, 1536852], [1536853, 2305278], [2305279, 3073704], [3073705, 3842130], [3842131, 4610556], [4610557, 5378982], [5378983, 6147408], [6147409, 6915834], [6915835, 7684260], [7684261, 8452686], [8452687, 9221112], [9221113, 9989538], [9989539, 10757964], [10757965, 11526390], [11526391, 12294816], [12294817, 13063242], [13063243, 13831668], [13831669, 14600094], [14600095, 15368529]] SRR7168976 file size 5186189 SRR7168976 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168976 SRR7168976_1.fastq SRR7168976_2.fastq Input file: SRR7168976_1.fastq Paired file: SRR7168976_2.fastq trimmed: SRR7168976-trimmed-pair1.fastq, SRR7168976-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:11:17 2025 >> started Mon Feb 10 13:11:36 2025 >> done (18.431s) 15368529 read pairs processed; of these: 30355 ( 0.20%) short read pairs filtered out after trimming by size control 57410 ( 0.37%) empty read pairs filtered out after trimming by size control 15280764 (99.43%) read pairs available; of these: 6000400 (39.27%) trimmed read pairs available after processing 9280364 (60.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 5 0.00% 23 7 0.00% 24 3 0.00% 25 7 0.00% 26 6 0.00% 27 6 0.00% 28 6 0.00% 29 5 0.00% 30 11 0.00% 31 7 0.00% 32 7 0.00% 33 11 0.00% 34 8 0.00% 35 10 0.00% 36 5 0.00% 37 11 0.00% 38 12 0.00% 39 18 0.00% 40 16 0.00% 41 18 0.00% 42 25 0.00% 43 29 0.00% 44 29 0.00% 45 34 0.00% 46 33 0.00% 47 37 0.00% 48 35 0.00% 49 34 0.00% 50 33 0.00% 51 42 0.00% 52 52 0.00% 53 55 0.00% 54 59 0.00% 55 64 0.00% 56 65 0.00% 57 78 0.00% 58 86 0.00% 59 92 0.00% 60 121 0.00% 61 127 0.00% 62 130 0.00% 63 112 0.00% 64 127 0.00% 65 179 0.00% 66 213 0.00% 67 301 0.00% 68 504 0.00% 69 878 0.01% 70 748 0.00% 71 432 0.00% 72 323 0.00% 73 374 0.00% 74 407 0.00% 75 446 0.00% 76 471 0.00% 77 532 0.00% 78 610 0.00% 79 673 0.00% 80 752 0.00% 81 877 0.01% 82 955 0.01% 83 1053 0.01% 84 2364 0.02% 85 3257 0.02% 86 3225 0.02% 87 3338 0.02% 88 3470 0.02% 89 3467 0.02% 90 3537 0.02% 91 3779 0.02% 92 3978 0.03% 93 4054 0.03% 94 4224 0.03% 95 4362 0.03% 96 4704 0.03% 97 4934 0.03% 98 5079 0.03% 99 5462 0.04% 100 5850 0.04% 101 6111 0.04% 102 6349 0.04% 103 6802 0.04% 104 7372 0.05% 105 7788 0.05% 106 8272 0.05% 107 8594 0.06% 108 9039 0.06% 109 9608 0.06% 110 9847 0.06% 111 10323 0.07% 112 11186 0.07% 113 11934 0.08% 114 12662 0.08% 115 13400 0.09% 116 14444 0.09% 117 15174 0.10% 118 15948 0.10% 119 16637 0.11% 120 17207 0.11% 121 18243 0.12% 122 19037 0.12% 123 20404 0.13% 124 21543 0.14% 125 22666 0.15% 126 24329 0.16% 127 25517 0.17% 128 26907 0.18% 129 28769 0.19% 130 30462 0.20% 131 32546 0.21% 132 34149 0.22% 133 36590 0.24% 134 39440 0.26% 135 42250 0.28% 136 45313 0.30% 137 48918 0.32% 138 52994 0.35% 139 57964 0.38% 140 63165 0.41% 141 70273 0.46% 142 78198 0.51% 143 88817 0.58% 144 102708 0.67% 145 121773 0.80% 146 151115 0.99% 147 203315 1.33% 148 309625 2.03% 149 611935 4.00% 150 3271228 21.41% 151 9280364 60.73% 15280764 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=39 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=165.96 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=44 prefix-density=0.23 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=51.55 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=13.0 sequence=TGTTGGTGGTGG SRR7168976 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:12:28 Started mapping on | Feb 10 13:12:28 Finished on | Feb 10 13:14:05 Mapping speed, Million of reads per hour | 567.12 Number of input reads | 15280764 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14589827 Uniquely mapped reads % | 95.48% Average mapped length | 296.69 Number of splices: Total | 13318431 Number of splices: Annotated (sjdb) | 13093180 Number of splices: GT/AG | 13133925 Number of splices: GC/AG | 144376 Number of splices: AT/AC | 11033 Number of splices: Non-canonical | 29097 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260752 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 61897 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 453663 453663 453663 N_multimapping 260752 260752 260752 N_noFeature 360879 14393467 432617 N_ambiguous 191889 878 66746 UnstrandedReadsAssigned:14037059 PositiveStrandReadsAssigned:195482 NegativeStrandReadsAssigned:14090464 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168976 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168976-trimmed-pair1.fastq SRR7168976-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,280,764 reads, 14,038,332 reads pseudoaligned [quant] estimated average fragment length: 259.775 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR7168976.ke.tsv 34699 SRR7168976.se.tsv 87100 total ==> SRR7168976.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.23 280 11.0242 Potri.005G024800.1.v4.1 1035 776.225 30 2.67698 Potri.004G059700.1.v4.1 961 702.264 5 0.493152 Potri.007G009000.2.v4.1 1416 1157.23 0 0 Potri.003G141000.2.v4.1 2943 2684.23 211.053 5.44607 Potri.016G087400.1.v4.1 270 67.8514 1407 1436.3 Potri.015G069301.1.v4.1 564 310.785 0 0 Potri.010G195200.1.v4.1 1773 1514.23 3 0.137228 Potri.012G127500.1.v4.1 977 718.239 3388 326.728 ==> SRR7168976.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1113 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 228 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168976 completed mapping pipeline successfully