Starting /dee2/code/volunteer_pipeline.sh SRR7168977 current disk space = 3059067650048 free memory = 1484419728 SRR7168977 SRAfilesize 6c3d1e67cbbd62bf9d6e632d670a6612 SRR7168977.sra SRR7168977.sra file validated SRR7168977 is paired end SRR7168977 is conventional basespace SRR7168977 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168977_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.165 34.0 33.0 34.0 33.0 34.0 2 33.46275 34.0 34.0 34.0 33.0 34.0 3 33.425 34.0 34.0 34.0 33.0 34.0 4 33.46 34.0 34.0 34.0 33.0 34.0 5 33.46925 34.0 34.0 34.0 33.0 34.0 6 37.10775 38.0 38.0 38.0 36.0 38.0 7 37.40425 38.0 38.0 38.0 37.0 38.0 8 37.50475 38.0 38.0 38.0 37.0 38.0 9 37.50475 38.0 38.0 38.0 37.0 38.0 10-14 37.5157 38.0 38.0 38.0 37.6 38.0 15-19 37.51705 38.0 38.0 38.0 37.6 38.0 20-24 37.4847 38.0 38.0 38.0 37.6 38.0 25-29 37.47279999999999 38.0 38.0 38.0 37.4 38.0 30-34 37.408 38.0 38.0 38.0 37.0 38.0 35-39 37.3264 38.0 38.0 38.0 37.0 38.0 40-44 37.25425 38.0 38.0 38.0 36.4 38.0 45-49 37.14020000000001 38.0 38.0 38.0 36.0 38.0 50-54 37.11995 38.0 38.0 38.0 36.0 38.0 55-59 37.0794 38.0 38.0 38.0 36.0 38.0 60-64 37.0677 38.0 38.0 38.0 36.0 38.0 65-69 37.0261 38.0 38.0 38.0 36.0 38.0 70-74 36.9645 38.0 38.0 38.0 36.0 38.0 75-79 36.88145 38.0 38.0 38.0 35.8 38.0 80-84 36.8483 38.0 38.0 38.0 35.4 38.0 85-89 36.7641 38.0 38.0 38.0 35.0 38.0 90-94 36.64695 38.0 38.0 38.0 34.6 38.0 95-99 36.538149999999995 38.0 38.0 38.0 34.2 38.0 100-104 36.462599999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.3995 38.0 38.0 38.0 34.0 38.0 110-114 36.1915 38.0 37.6 38.0 33.6 38.0 115-119 36.0194 38.0 37.0 38.0 33.0 38.0 120-124 35.889399999999995 38.0 36.8 38.0 32.4 38.0 125-129 35.63054999999999 38.0 36.4 38.0 31.0 38.0 130-134 35.43075 38.0 36.0 38.0 31.0 38.0 135-139 35.1697 38.0 36.0 38.0 30.4 38.0 140-144 34.7534 38.0 35.4 38.0 28.0 38.0 145-149 34.3416 38.0 35.0 38.0 26.8 38.0 150-151 31.570625 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 2.0 16 4.0 17 1.0 18 2.0 19 3.0 20 3.0 21 7.0 22 4.0 23 9.0 24 10.0 25 5.0 26 17.0 27 22.0 28 18.0 29 27.0 30 48.0 31 52.0 32 70.0 33 93.0 34 126.0 35 228.0 36 555.0 37 2687.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.76262626262626 14.444444444444443 13.434343434343434 33.35858585858586 2 22.675 17.875 31.7 27.750000000000004 3 19.1 23.75 26.275 30.875000000000004 4 21.5 30.049999999999997 23.825 24.625 5 21.425 32.9 25.124999999999996 20.549999999999997 6 19.175 34.4 24.75 21.675 7 14.325 26.224999999999998 41.375 18.075 8 18.125 26.575 29.75 25.55 9 18.3 26.1 31.225 24.375 10-14 19.915 29.64 26.479999999999997 23.965 15-19 19.775000000000002 29.485 26.745 23.995 20-24 19.81 29.494999999999997 27.025 23.669999999999998 25-29 20.095 29.215000000000003 26.93 23.76 30-34 20.27804170625594 29.42441366204931 26.974046106916038 23.323498524778717 35-39 20.05 29.080000000000002 26.765 24.104999999999997 40-44 19.73 29.265 26.955000000000002 24.05 45-49 20.255000000000003 28.645 26.700000000000003 24.4 50-54 20.075000000000003 29.244999999999997 26.945000000000004 23.735 55-59 20.34 28.63 27.134999999999998 23.895 60-64 19.81 28.735 27.16 24.295 65-69 20.355 28.945 26.47 24.23 70-74 20.09 28.994999999999997 26.955000000000002 23.96 75-79 20.52 28.305000000000003 26.55 24.625 80-84 20.76 28.694999999999997 27.055 23.49 85-89 20.599999999999998 28.349999999999998 27.405 23.645 90-94 20.48 28.705000000000002 27.29 23.525 95-99 20.49 27.779999999999998 27.250000000000004 24.48 100-104 20.87 28.345 26.779999999999998 24.005000000000003 105-109 20.59 28.415000000000003 26.44 24.555 110-114 21.029999999999998 28.110000000000003 26.515 24.345 115-119 20.655 28.255000000000003 27.029999999999998 24.060000000000002 120-124 20.635 28.065 27.38 23.919999999999998 125-129 21.154999999999998 27.76 27.345000000000002 23.74 130-134 21.21 27.779999999999998 27.229999999999997 23.78 135-139 21.085 29.075 26.165 23.674999999999997 140-144 21.575 28.084999999999997 26.32 24.02 145-149 21.335 28.185 26.740000000000002 23.74 150-151 21.1625 28.175 27.2625 23.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.5 24 4.0 25 4.0 26 4.5 27 10.0 28 16.5 29 17.0 30 23.5 31 32.0 32 40.5 33 47.5 34 63.0 35 80.5 36 87.0 37 93.5 38 113.0 39 148.0 40 167.5 41 191.5 42 220.5 43 227.0 44 239.5 45 256.0 46 273.0 47 257.0 48 226.5 49 210.5 50 181.5 51 157.5 52 139.5 53 112.5 54 84.5 55 67.5 56 51.5 57 36.5 58 25.5 59 24.5 60 17.5 61 11.0 62 9.5 63 4.5 64 3.0 65 3.5 66 2.0 67 1.0 68 2.5 69 2.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0125 0.0 86-87 0.0125 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.025 0.0 0.0 0.025 0.0 94-95 0.037500000000000006 0.0 0.0 0.025 0.0 96-97 0.05 0.0 0.0 0.025 0.0 98-99 0.0625 0.0 0.0 0.025 0.0 100-101 0.125 0.0 0.0 0.025 0.0 102-103 0.175 0.0 0.0 0.025 0.0 104-105 0.21250000000000002 0.0 0.0 0.025 0.0 106-107 0.25 0.0 0.0 0.025 0.0 108-109 0.3 0.0 0.0 0.025 0.0 110-111 0.3 0.0 0.0 0.025 0.0 112-113 0.3 0.0 0.0 0.025 0.0 114-115 0.325 0.0 0.0 0.025 0.0 116-117 0.375 0.0 0.0 0.025 0.0 118-119 0.44999999999999996 0.0 0.0 0.025 0.0 120-121 0.475 0.0 0.0 0.025 0.0 122-123 0.525 0.0 0.0 0.025 0.0 124-125 0.575 0.0 0.0 0.025 0.0 126-127 0.7125 0.0 0.0 0.025 0.0 128-129 0.8125 0.0 0.0 0.025 0.0 130-131 0.875 0.0 0.0 0.025 0.0 132-133 1.0 0.0 0.0 0.025 0.0 134-135 1.1875 0.0 0.0 0.025 0.0 136-137 1.4 0.0 0.0 0.025 0.0 138-139 1.55 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 35 0.0033124194 62.14286 145 >>END_MODULE SRR7168977 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168977_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84475 33.0 33.0 34.0 32.0 34.0 2 32.9535 34.0 33.0 34.0 32.0 34.0 3 33.0175 34.0 33.0 34.0 32.0 34.0 4 32.955 34.0 33.0 34.0 32.0 34.0 5 32.8875 34.0 33.0 34.0 32.0 34.0 6 37.12925 38.0 38.0 38.0 37.0 38.0 7 37.166 38.0 38.0 38.0 37.0 38.0 8 37.22225 38.0 38.0 38.0 37.0 38.0 9 37.247 38.0 38.0 38.0 37.0 38.0 10-14 37.1238 38.0 38.0 38.0 37.0 38.0 15-19 37.109950000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.0186 38.0 38.0 38.0 36.6 38.0 25-29 37.0532 38.0 38.0 38.0 36.8 38.0 30-34 37.018699999999995 38.0 38.0 38.0 36.4 38.0 35-39 36.99595000000001 38.0 38.0 38.0 36.4 38.0 40-44 36.97585 38.0 38.0 38.0 36.6 38.0 45-49 36.9543 38.0 38.0 38.0 36.0 38.0 50-54 36.915099999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.86555 38.0 38.0 38.0 36.0 38.0 60-64 36.77909999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.787349999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.66875 38.0 38.0 38.0 35.0 38.0 75-79 36.619600000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.51265 38.0 38.0 38.0 34.4 38.0 85-89 36.415800000000004 38.0 38.0 38.0 34.2 38.0 90-94 36.328500000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.161199999999994 38.0 38.0 38.0 33.6 38.0 100-104 36.053200000000004 38.0 37.8 38.0 33.4 38.0 105-109 35.92575000000001 38.0 37.2 38.0 32.8 38.0 110-114 35.7327 38.0 37.0 38.0 31.6 38.0 115-119 35.5375 38.0 37.0 38.0 31.0 38.0 120-124 35.4008 38.0 36.6 38.0 31.0 38.0 125-129 35.0264 38.0 36.0 38.0 28.0 38.0 130-134 34.6828 38.0 35.4 38.0 27.6 38.0 135-139 34.2799 38.0 35.0 38.0 24.6 38.0 140-144 33.81645 38.0 35.0 38.0 22.2 38.0 145-149 33.246900000000004 38.0 34.6 38.0 15.8 38.0 150-151 29.664625 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 1.0 5 1.0 6 1.0 7 1.0 8 3.0 9 1.0 10 2.0 11 1.0 12 0.0 13 2.0 14 4.0 15 4.0 16 3.0 17 6.0 18 3.0 19 8.0 20 9.0 21 13.0 22 17.0 23 11.0 24 19.0 25 15.0 26 22.0 27 30.0 28 21.0 29 34.0 30 40.0 31 55.0 32 66.0 33 98.0 34 143.0 35 251.0 36 616.0 37 2492.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.9 19.575 16.1 26.424999999999997 2 27.05205205205205 26.7017017017017 28.32832832832833 17.917917917917915 3 20.175219023779725 29.61201501877347 31.038798498122656 19.173967459324157 4 23.053817271589487 34.39299123904881 23.554443053817273 18.998748435544428 5 24.680851063829788 34.643304130162704 22.5531914893617 18.122653316645806 6 21.85 35.35 22.775000000000002 20.025000000000002 7 21.05 23.05 35.625 20.275000000000002 8 22.375 26.224999999999998 25.6 25.8 9 21.775 25.75 27.175 25.3 10-14 23.632363236323634 27.71277127712771 26.127612761276126 22.52725272527253 15-19 23.606524567197038 27.77944561192835 26.783748624036825 21.830281196837788 20-24 23.54706411923577 28.21346403921176 26.883064919475842 21.356406922076623 25-29 24.548592007202522 27.15450407642675 26.87440604211474 21.42249787425599 30-34 23.195798949737434 28.71717929482371 26.726681670417605 21.360340085021257 35-39 24.205 27.889999999999997 27.075 20.830000000000002 40-44 23.55971194238848 27.905581116223242 26.9003800760152 21.634326865373072 45-49 23.471173558677936 27.68638431921596 26.901345067253363 21.941097054852744 50-54 23.617361736173617 27.262726272627262 27.442744274427444 21.677167716771677 55-59 23.785 27.365000000000002 27.400000000000002 21.45 60-64 23.87 27.73 27.215 21.185000000000002 65-69 23.882388238823882 27.467746774677465 27.512751275127513 21.137113711371136 70-74 24.63 27.18 27.305 20.885 75-79 22.96229622962296 27.607760776077605 28.11781178117812 21.31213121312131 80-84 24.17741774177418 27.077707770777078 27.61276127612761 21.132113211321133 85-89 24.335 27.265 27.565 20.835 90-94 24.12 27.445000000000004 26.85 21.584999999999997 95-99 24.154999999999998 27.389999999999997 27.455000000000002 21.0 100-104 23.985 27.605 27.27 21.14 105-109 24.025 27.41 27.345000000000002 21.22 110-114 24.36 27.515 27.13 20.995 115-119 23.806190309515475 27.631381569078457 27.626381319065953 20.936046802340115 120-124 23.798569785467823 27.59913987098065 27.634145121768267 20.968145221783267 125-129 24.32 28.060000000000002 26.765 20.855 130-134 24.23 27.395000000000003 27.43 20.945 135-139 24.125 27.794999999999998 27.01 21.07 140-144 24.64 27.57 27.375 20.415 145-149 24.375 27.54 27.36 20.724999999999998 150-151 24.4 27.6375 27.712500000000002 20.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 2.5 26 2.5 27 2.5 28 5.0 29 6.5 30 5.5 31 8.5 32 13.0 33 17.0 34 24.5 35 30.5 36 53.5 37 81.0 38 104.5 39 143.0 40 170.5 41 208.0 42 237.0 43 254.0 44 290.5 45 309.5 46 295.0 47 279.0 48 259.0 49 227.0 50 193.5 51 160.5 52 141.5 53 117.0 54 86.0 55 64.5 56 51.0 57 40.0 58 29.5 59 21.5 60 16.5 61 12.0 62 9.0 63 8.0 64 5.5 65 2.5 66 2.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.125 4 0.125 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.06999999999999999 20-24 0.03 25-29 0.034999999999999996 30-34 0.025 35-39 0.0 40-44 0.02 45-49 0.005 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.01 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.2875 0.0 0.0 0.0 0.0 136-137 1.4874999999999998 0.0 0.0 0.0 0.0 138-139 1.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTCAA 10 0.006830828 145.0 5 GACATTT 10 0.006830828 145.0 7 GAAGAGC 30 0.0017973486 72.5 145 TTTTTTT 30 0.0014437955 24.166668 115-119 >>END_MODULE Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792700 spots for SRR7168977.sra Written 792700 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra Read 792696 spots for SRR7168977.sra Written 792696 spots for SRR7168977.sra SRR ids: ['SRR7168977.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0f7k61zl SRR7168977.sra spots: 15853924 blocks: [[1, 792696], [792697, 1585392], [1585393, 2378088], [2378089, 3170784], [3170785, 3963480], [3963481, 4756176], [4756177, 5548872], [5548873, 6341568], [6341569, 7134264], [7134265, 7926960], [7926961, 8719656], [8719657, 9512352], [9512353, 10305048], [10305049, 11097744], [11097745, 11890440], [11890441, 12683136], [12683137, 13475832], [13475833, 14268528], [14268529, 15061224], [15061225, 15853924]] SRR7168977 file size 5350674 SRR7168977 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168977 SRR7168977_1.fastq SRR7168977_2.fastq Input file: SRR7168977_1.fastq Paired file: SRR7168977_2.fastq trimmed: SRR7168977-trimmed-pair1.fastq, SRR7168977-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:51:13 2025 >> started Mon Feb 10 13:51:31 2025 >> done (17.397s) 15853924 read pairs processed; of these: 29115 ( 0.18%) short read pairs filtered out after trimming by size control 18994 ( 0.12%) empty read pairs filtered out after trimming by size control 15805815 (99.70%) read pairs available; of these: 6327527 (40.03%) trimmed read pairs available after processing 9478288 (59.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 6 0.00% 21 5 0.00% 22 7 0.00% 23 7 0.00% 24 10 0.00% 25 7 0.00% 26 11 0.00% 27 9 0.00% 28 10 0.00% 29 179 0.00% 30 12 0.00% 31 32 0.00% 32 8 0.00% 33 5 0.00% 34 12 0.00% 35 16 0.00% 36 5 0.00% 37 16 0.00% 38 13 0.00% 39 34 0.00% 40 18 0.00% 41 15 0.00% 42 14 0.00% 43 13 0.00% 44 22 0.00% 45 28 0.00% 46 16 0.00% 47 27 0.00% 48 29 0.00% 49 23 0.00% 50 24 0.00% 51 21 0.00% 52 22 0.00% 53 36 0.00% 54 49 0.00% 55 45 0.00% 56 46 0.00% 57 44 0.00% 58 52 0.00% 59 66 0.00% 60 70 0.00% 61 70 0.00% 62 87 0.00% 63 106 0.00% 64 111 0.00% 65 134 0.00% 66 119 0.00% 67 165 0.00% 68 251 0.00% 69 385 0.00% 70 371 0.00% 71 283 0.00% 72 254 0.00% 73 288 0.00% 74 286 0.00% 75 332 0.00% 76 374 0.00% 77 462 0.00% 78 475 0.00% 79 556 0.00% 80 634 0.00% 81 681 0.00% 82 790 0.00% 83 966 0.01% 84 2069 0.01% 85 2786 0.02% 86 2820 0.02% 87 2910 0.02% 88 3114 0.02% 89 3117 0.02% 90 3114 0.02% 91 3212 0.02% 92 3422 0.02% 93 3522 0.02% 94 3694 0.02% 95 3897 0.02% 96 4158 0.03% 97 4280 0.03% 98 4618 0.03% 99 4762 0.03% 100 5080 0.03% 101 5508 0.03% 102 5847 0.04% 103 6248 0.04% 104 6697 0.04% 105 7081 0.04% 106 7824 0.05% 107 8035 0.05% 108 8521 0.05% 109 9013 0.06% 110 9545 0.06% 111 10179 0.06% 112 10841 0.07% 113 11813 0.07% 114 12631 0.08% 115 13567 0.09% 116 14241 0.09% 117 15276 0.10% 118 16188 0.10% 119 16616 0.11% 120 17684 0.11% 121 18964 0.12% 122 20027 0.13% 123 21540 0.14% 124 23109 0.15% 125 24501 0.16% 126 26217 0.17% 127 27787 0.18% 128 28928 0.18% 129 30616 0.19% 130 32634 0.21% 131 34969 0.22% 132 37431 0.24% 133 40566 0.26% 134 43339 0.27% 135 47364 0.30% 136 50769 0.32% 137 55059 0.35% 138 60086 0.38% 139 65086 0.41% 140 70601 0.45% 141 78621 0.50% 142 86952 0.55% 143 98592 0.62% 144 114463 0.72% 145 138268 0.87% 146 169836 1.07% 147 229780 1.45% 148 343553 2.17% 149 673074 4.26% 150 3351586 21.20% 151 9478288 59.97% 15805815 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=37 prefix-density=0.30 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=248.44 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=37 prefix-density=0.27 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=154.83 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.3 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGA SRR7168977 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:52:21 Started mapping on | Feb 10 13:52:21 Finished on | Feb 10 13:54:26 Mapping speed, Million of reads per hour | 455.21 Number of input reads | 15805815 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14559467 Uniquely mapped reads % | 92.11% Average mapped length | 296.66 Number of splices: Total | 13511818 Number of splices: Annotated (sjdb) | 13298216 Number of splices: GT/AG | 13321418 Number of splices: GC/AG | 151219 Number of splices: AT/AC | 10979 Number of splices: Non-canonical | 28202 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289717 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 38575 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.76% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 978538 978538 978538 N_multimapping 289717 289717 289717 N_noFeature 256457 14399900 318787 N_ambiguous 158412 901 60536 UnstrandedReadsAssigned:14144598 PositiveStrandReadsAssigned:158666 NegativeStrandReadsAssigned:14180144 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168977 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168977-trimmed-pair1.fastq SRR7168977-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,805,815 reads, 14,112,931 reads pseudoaligned [quant] estimated average fragment length: 257.448 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR7168977.ke.tsv 34699 SRR7168977.se.tsv 87100 total ==> SRR7168977.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.55 231 7.48669 Potri.005G024800.1.v4.1 1035 778.552 28 2.05326 Potri.004G059700.1.v4.1 961 704.564 6 0.486188 Potri.007G009000.2.v4.1 1416 1159.55 0 0 Potri.003G141000.2.v4.1 2943 2686.55 212.028 4.50579 Potri.016G087400.1.v4.1 270 66.8522 1681 1435.57 Potri.015G069301.1.v4.1 564 311.689 0 0 Potri.010G195200.1.v4.1 1773 1516.55 11 0.414104 Potri.012G127500.1.v4.1 977 720.564 5087 403.053 ==> SRR7168977.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 974 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168977 completed mapping pipeline successfully