Starting /dee2/code/volunteer_pipeline.sh SRR7168978 current disk space = 3058917974016 free memory = 1339353392 SRR7168978 SRAfilesize fb0aab5cdfeaf901f45a6c8938be10c5 SRR7168978.sra SRR7168978.sra file validated SRR7168978 is paired end SRR7168978 is conventional basespace SRR7168978 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168978_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0195 34.0 33.0 34.0 33.0 34.0 2 33.45225 34.0 34.0 34.0 33.0 34.0 3 33.4835 34.0 34.0 34.0 33.0 34.0 4 33.494 34.0 34.0 34.0 33.0 34.0 5 33.55825 34.0 34.0 34.0 33.0 34.0 6 37.2315 38.0 38.0 38.0 36.0 38.0 7 37.43625 38.0 38.0 38.0 37.0 38.0 8 37.46775 38.0 38.0 38.0 37.0 38.0 9 37.524 38.0 38.0 38.0 37.0 38.0 10-14 37.52175 38.0 38.0 38.0 37.8 38.0 15-19 37.544050000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.544599999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.5178 38.0 38.0 38.0 38.0 38.0 30-34 37.4952 38.0 38.0 38.0 38.0 38.0 35-39 37.3902 38.0 38.0 38.0 37.0 38.0 40-44 37.305899999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.34165 38.0 38.0 38.0 37.0 38.0 50-54 37.31869999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.2298 38.0 38.0 38.0 36.6 38.0 60-64 37.23775 38.0 38.0 38.0 37.0 38.0 65-69 37.17399999999999 38.0 38.0 38.0 36.4 38.0 70-74 37.14195 38.0 38.0 38.0 36.4 38.0 75-79 37.10850000000001 38.0 38.0 38.0 36.2 38.0 80-84 36.9948 38.0 38.0 38.0 36.0 38.0 85-89 36.95055 38.0 38.0 38.0 36.0 38.0 90-94 36.860800000000005 38.0 38.0 38.0 35.6 38.0 95-99 36.8373 38.0 38.0 38.0 35.4 38.0 100-104 36.68975 38.0 38.0 38.0 35.0 38.0 105-109 36.606500000000004 38.0 38.0 38.0 34.6 38.0 110-114 36.48935 38.0 38.0 38.0 34.2 38.0 115-119 36.33735 38.0 38.0 38.0 34.0 38.0 120-124 36.1025 38.0 38.0 38.0 33.6 38.0 125-129 35.92035 38.0 37.0 38.0 33.0 38.0 130-134 35.66235 38.0 36.6 38.0 31.8 38.0 135-139 35.56415 38.0 36.4 38.0 31.8 38.0 140-144 35.0847 38.0 36.0 38.0 30.0 38.0 145-149 34.575149999999994 38.0 35.6 38.0 27.6 38.0 150-151 31.833125000000003 36.5 33.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 2.0 14 0.0 15 2.0 16 1.0 17 3.0 18 1.0 19 3.0 20 6.0 21 5.0 22 7.0 23 5.0 24 9.0 25 9.0 26 14.0 27 15.0 28 30.0 29 23.0 30 33.0 31 37.0 32 50.0 33 79.0 34 143.0 35 193.0 36 472.0 37 2857.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.63650228774784 12.65887137773259 8.617183528215557 34.08744280630401 2 22.425 16.075 32.95 28.549999999999997 3 18.875 22.25 28.65 30.225 4 23.35 29.075 24.075 23.5 5 23.0 34.300000000000004 22.8 19.900000000000002 6 18.7 35.975 25.224999999999998 20.1 7 14.725 26.125 40.35 18.8 8 17.1 26.075 31.125000000000004 25.7 9 17.549999999999997 24.15 33.75 24.55 10-14 20.095 29.609999999999996 26.69 23.605 15-19 19.63 28.92 27.92 23.53 20-24 19.744999999999997 28.525 27.82 23.91 25-29 20.175 29.270000000000003 27.075 23.48 30-34 20.44 29.28 26.855 23.425 35-39 20.119999999999997 29.035 27.18 23.665 40-44 20.655 29.12 27.165 23.06 45-49 19.915 28.660000000000004 27.134999999999998 24.29 50-54 20.265 29.054999999999996 27.284999999999997 23.395 55-59 20.44 28.435 27.089999999999996 24.035 60-64 20.630000000000003 29.175 26.895000000000003 23.3 65-69 19.98 28.96 27.72 23.34 70-74 20.1 28.375 27.839999999999996 23.685000000000002 75-79 20.655 27.715 27.565 24.065 80-84 20.315 28.675 27.450000000000003 23.56 85-89 20.91 28.610000000000003 27.07 23.41 90-94 20.265 28.605000000000004 27.644999999999996 23.485 95-99 20.424999999999997 28.754999999999995 26.840000000000003 23.98 100-104 20.544999999999998 28.77 27.089999999999996 23.595 105-109 19.915 28.365000000000002 27.515 24.205 110-114 20.355 28.74 27.055 23.849999999999998 115-119 20.985 29.054999999999996 26.855 23.105 120-124 20.880000000000003 28.349999999999998 26.889999999999997 23.880000000000003 125-129 20.74 27.860000000000003 27.425 23.974999999999998 130-134 20.72 28.615000000000002 27.47 23.195 135-139 21.14 28.599999999999998 26.63 23.630000000000003 140-144 20.665 28.04 27.425 23.87 145-149 20.615 28.249999999999996 27.400000000000002 23.735 150-151 21.1625 28.275 27.1125 23.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.5 25 3.0 26 4.0 27 7.5 28 10.5 29 15.0 30 17.0 31 18.5 32 28.5 33 40.5 34 52.5 35 70.0 36 94.5 37 118.0 38 144.5 39 160.0 40 159.5 41 189.5 42 230.5 43 254.5 44 267.5 45 280.5 46 280.0 47 261.0 48 241.5 49 216.5 50 193.0 51 162.0 52 122.0 53 90.5 54 75.0 55 58.0 56 35.5 57 23.5 58 19.0 59 14.0 60 6.5 61 4.5 62 6.0 63 5.5 64 5.0 65 4.5 66 3.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7125 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.2375 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.0625 0.0 0.0 0.0 0.0 136-137 2.3 0.0 0.0 0.0 0.0 138-139 2.4625000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAGAGT 10 0.006832588 144.9875 7 GGGATTT 10 0.006832588 144.9875 3 TAGAGTA 10 0.006832588 144.9875 8 >>END_MODULE SRR7168978 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168978_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00675 33.0 33.0 34.0 32.0 34.0 2 33.08675 34.0 33.0 34.0 32.0 34.0 3 33.117 34.0 33.0 34.0 33.0 34.0 4 33.1105 34.0 33.0 34.0 33.0 34.0 5 33.1035 34.0 33.0 34.0 33.0 34.0 6 37.26625 38.0 38.0 38.0 37.0 38.0 7 37.2775 38.0 38.0 38.0 37.0 38.0 8 37.25325 38.0 38.0 38.0 37.0 38.0 9 37.3335 38.0 38.0 38.0 37.0 38.0 10-14 37.2642 38.0 38.0 38.0 37.0 38.0 15-19 37.2274 38.0 38.0 38.0 37.0 38.0 20-24 37.18814999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.1897 38.0 38.0 38.0 37.0 38.0 30-34 37.179950000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.16625 38.0 38.0 38.0 37.0 38.0 40-44 37.1166 38.0 38.0 38.0 37.0 38.0 45-49 37.11445 38.0 38.0 38.0 37.0 38.0 50-54 37.031 38.0 38.0 38.0 36.8 38.0 55-59 37.027 38.0 38.0 38.0 36.2 38.0 60-64 36.99165 38.0 38.0 38.0 36.2 38.0 65-69 36.9221 38.0 38.0 38.0 36.0 38.0 70-74 36.80245 38.0 38.0 38.0 36.0 38.0 75-79 36.7854 38.0 38.0 38.0 35.8 38.0 80-84 36.6699 38.0 38.0 38.0 35.0 38.0 85-89 36.5869 38.0 38.0 38.0 34.8 38.0 90-94 36.435550000000006 38.0 38.0 38.0 34.4 38.0 95-99 36.39755 38.0 38.0 38.0 34.0 38.0 100-104 36.20725 38.0 38.0 38.0 34.0 38.0 105-109 36.03075 38.0 37.8 38.0 33.6 38.0 110-114 35.88225 38.0 37.2 38.0 32.6 38.0 115-119 35.72945 38.0 37.0 38.0 31.8 38.0 120-124 35.451800000000006 38.0 36.8 38.0 31.0 38.0 125-129 35.298500000000004 38.0 36.4 38.0 30.0 38.0 130-134 34.79155 38.0 35.8 38.0 27.6 38.0 135-139 34.3949 38.0 35.0 38.0 25.4 38.0 140-144 34.08075 38.0 35.0 38.0 23.2 38.0 145-149 33.287549999999996 38.0 34.2 38.0 16.8 38.0 150-151 29.133875 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 2.0 10 2.0 11 0.0 12 2.0 13 1.0 14 3.0 15 2.0 16 1.0 17 4.0 18 6.0 19 8.0 20 1.0 21 5.0 22 14.0 23 15.0 24 17.0 25 15.0 26 18.0 27 33.0 28 26.0 29 31.0 30 51.0 31 47.0 32 69.0 33 97.0 34 121.0 35 240.0 36 564.0 37 2594.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.099999999999994 23.25 10.6 25.05 2 25.74430823117338 25.569176882662 31.523642732049034 17.162872154115586 3 19.494494494494493 27.5025025025025 33.908908908908906 19.094094094094093 4 23.723723723723726 33.98398398398398 22.67267267267267 19.61961961961962 5 24.0990990990991 36.96196196196196 21.42142142142142 17.51751751751752 6 20.4 39.0 22.625 17.974999999999998 7 20.674999999999997 21.375 38.824999999999996 19.125 8 20.9 25.45 27.900000000000002 25.75 9 20.724999999999998 24.25 30.4 24.625 10-14 23.711185559277965 28.551427571378568 26.16630831541577 21.5710785539277 15-19 23.714228537122274 28.156894136481892 26.991194716830098 21.13768260956574 20-24 22.98574643660915 27.581895473868467 27.38184546136534 22.05051262815704 25-29 22.614522904580916 28.355671134226846 27.790558111622328 21.239247849569914 30-34 23.124624924984996 27.960592118423683 27.935587117423484 20.979195839167833 35-39 22.891867560268082 27.993398019405824 27.65329598879664 21.46143843152946 40-44 23.139627925585117 27.60552110422084 27.815563112622527 21.439287857571514 45-49 22.91572893223306 28.042010502625658 28.107026756689173 20.935233808452114 50-54 22.97614880744037 28.15640782039102 27.76138806940347 21.10605530276514 55-59 23.373506025903886 27.424113617042558 28.539280892133824 20.66309946491974 60-64 23.07576894223556 27.871967991997998 28.08702175543886 20.96524131032758 65-69 23.69092273068267 27.696924231057764 27.916979244811202 20.69517379344836 70-74 23.700665299384724 27.31229053073883 28.01260567255265 20.974438497323796 75-79 23.934573829531814 27.315926370548222 28.211284513805523 20.538215286114443 80-84 23.629725945189037 27.4004800960192 27.885577115423082 21.084216843368676 85-89 23.73237323732373 27.53775377537754 27.912791279127912 20.817081708170818 90-94 24.00480096019204 27.350470094018803 27.71054210842168 20.934186837367474 95-99 23.546177308865442 27.181359067953398 27.986399319965997 21.28606430321516 100-104 24.14 28.005000000000003 27.48 20.375 105-109 23.741187059352967 27.301365068253414 28.021401070053503 20.936046802340115 110-114 23.365 27.534999999999997 28.21 20.89 115-119 23.81833641774621 27.934777172010207 27.439603861351475 20.80728254889211 120-124 24.14569470155601 27.66798418972332 27.703006954520436 20.48331415420023 125-129 23.29130391273892 27.77944561192835 28.009606724707297 20.91964375062544 130-134 24.261065266316578 27.561890472618156 27.616904226056516 20.560140035008754 135-139 23.837383738373838 27.627762776277624 27.677767776777678 20.857085708570857 140-144 24.04101025256314 27.396849212303074 28.107026756689173 20.455113778444613 145-149 24.08222466740022 28.183455036510953 27.243172951885562 20.491147344203263 150-151 24.23711855927964 26.975987993997 27.863931965982992 20.92296148074037 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 3.0 27 2.5 28 4.0 29 5.5 30 9.5 31 11.5 32 13.5 33 26.5 34 43.5 35 60.0 36 71.5 37 101.0 38 135.5 39 162.5 40 181.5 41 205.5 42 256.0 43 275.5 44 287.5 45 304.5 46 285.5 47 271.5 48 258.0 49 202.5 50 162.5 51 155.5 52 134.0 53 97.5 54 74.0 55 54.0 56 34.0 57 32.5 58 25.5 59 15.5 60 10.0 61 4.5 62 2.0 63 3.5 64 5.0 65 4.0 66 1.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.1 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.06 20-24 0.025 25-29 0.02 30-34 0.02 35-39 0.03 40-44 0.02 45-49 0.025 50-54 0.005 55-59 0.015 60-64 0.025 65-69 0.025 70-74 0.045 75-79 0.04 80-84 0.02 85-89 0.01 90-94 0.02 95-99 0.005 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.034999999999999996 120-124 0.065 125-129 0.06999999999999999 130-134 0.025 135-139 0.01 140-144 0.025 145-149 0.03 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.9125 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.6125 0.0 0.0 0.0 0.0 132-133 1.8125 0.0 0.0 0.0 0.0 134-135 1.9875 0.0 0.0 0.0 0.0 136-137 2.2 0.0 0.0 0.0 0.0 138-139 2.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGTCA 10 0.006830828 145.0 145 >>END_MODULE Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra Read 848277 spots for SRR7168978.sra Written 848277 spots for SRR7168978.sra Read 848269 spots for SRR7168978.sra Written 848269 spots for SRR7168978.sra SRR ids: ['SRR7168978.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1dkku2mj SRR7168978.sra spots: 16965388 blocks: [[1, 848269], [848270, 1696538], [1696539, 2544807], [2544808, 3393076], [3393077, 4241345], [4241346, 5089614], [5089615, 5937883], [5937884, 6786152], [6786153, 7634421], [7634422, 8482690], [8482691, 9330959], [9330960, 10179228], [10179229, 11027497], [11027498, 11875766], [11875767, 12724035], [12724036, 13572304], [13572305, 14420573], [14420574, 15268842], [15268843, 16117111], [16117112, 16965388]] SRR7168978 file size 5727312 SRR7168978 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168978 SRR7168978_1.fastq SRR7168978_2.fastq Input file: SRR7168978_1.fastq Paired file: SRR7168978_2.fastq trimmed: SRR7168978-trimmed-pair1.fastq, SRR7168978-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:23:46 2025 >> started Mon Feb 10 13:24:04 2025 >> done (18.523s) 16965388 read pairs processed; of these: 19575 ( 0.12%) short read pairs filtered out after trimming by size control 10137 ( 0.06%) empty read pairs filtered out after trimming by size control 16935676 (99.82%) read pairs available; of these: 6791166 (40.10%) trimmed read pairs available after processing 10144510 (59.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 5 0.00% 21 7 0.00% 22 10 0.00% 23 5 0.00% 24 9 0.00% 25 6 0.00% 26 7 0.00% 27 11 0.00% 28 4 0.00% 29 7 0.00% 30 13 0.00% 31 2 0.00% 32 5 0.00% 33 7 0.00% 34 6 0.00% 35 7 0.00% 36 4 0.00% 37 6 0.00% 38 9 0.00% 39 14 0.00% 40 7 0.00% 41 10 0.00% 42 10 0.00% 43 15 0.00% 44 14 0.00% 45 9 0.00% 46 18 0.00% 47 12 0.00% 48 17 0.00% 49 13 0.00% 50 26 0.00% 51 28 0.00% 52 24 0.00% 53 27 0.00% 54 33 0.00% 55 38 0.00% 56 33 0.00% 57 42 0.00% 58 34 0.00% 59 55 0.00% 60 49 0.00% 61 62 0.00% 62 96 0.00% 63 75 0.00% 64 95 0.00% 65 100 0.00% 66 105 0.00% 67 97 0.00% 68 148 0.00% 69 189 0.00% 70 194 0.00% 71 238 0.00% 72 262 0.00% 73 317 0.00% 74 339 0.00% 75 355 0.00% 76 384 0.00% 77 454 0.00% 78 514 0.00% 79 539 0.00% 80 630 0.00% 81 793 0.00% 82 873 0.01% 83 1099 0.01% 84 1842 0.01% 85 2535 0.01% 86 2468 0.01% 87 2674 0.02% 88 2886 0.02% 89 3075 0.02% 90 3059 0.02% 91 3305 0.02% 92 3535 0.02% 93 3659 0.02% 94 3922 0.02% 95 4129 0.02% 96 4350 0.03% 97 4617 0.03% 98 5005 0.03% 99 5274 0.03% 100 5797 0.03% 101 6013 0.04% 102 6440 0.04% 103 7029 0.04% 104 7394 0.04% 105 7862 0.05% 106 8658 0.05% 107 8891 0.05% 108 9476 0.06% 109 10094 0.06% 110 10725 0.06% 111 11376 0.07% 112 12103 0.07% 113 12998 0.08% 114 13999 0.08% 115 14950 0.09% 116 15897 0.09% 117 16527 0.10% 118 17460 0.10% 119 18092 0.11% 120 18978 0.11% 121 20223 0.12% 122 21526 0.13% 123 22775 0.13% 124 24614 0.15% 125 26255 0.16% 126 27826 0.16% 127 29612 0.17% 128 31007 0.18% 129 32577 0.19% 130 34748 0.21% 131 37064 0.22% 132 39806 0.24% 133 43255 0.26% 134 46487 0.27% 135 50230 0.30% 136 54428 0.32% 137 58839 0.35% 138 63274 0.37% 139 68956 0.41% 140 74892 0.44% 141 82846 0.49% 142 92394 0.55% 143 105407 0.62% 144 123973 0.73% 145 147890 0.87% 146 180272 1.06% 147 242848 1.43% 148 360253 2.13% 149 702848 4.15% 150 3638320 21.48% 151 10144510 59.90% 16935676 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=39 prefix-density=0.20 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=225.10 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=11.7 sequence=AGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTGAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTACTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=10.62 fanout-score-rank=9 prefix-density=0.37 prefix-fanout=6.7 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=62.92 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=7.0 sequence=CTCTTCTTTTCTCCCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTGGATGAAGTGAG SRR7168978 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:25:07 Started mapping on | Feb 10 13:25:07 Finished on | Feb 10 13:26:38 Mapping speed, Million of reads per hour | 669.98 Number of input reads | 16935676 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16144775 Uniquely mapped reads % | 95.33% Average mapped length | 296.68 Number of splices: Total | 14855050 Number of splices: Annotated (sjdb) | 14626247 Number of splices: GT/AG | 14659406 Number of splices: GC/AG | 155591 Number of splices: AT/AC | 12346 Number of splices: Non-canonical | 27707 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267553 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 31081 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 541339 541339 541339 N_multimapping 267553 267553 267553 N_noFeature 345990 15936445 432778 N_ambiguous 187902 979 65707 UnstrandedReadsAssigned:15610883 PositiveStrandReadsAssigned:207351 NegativeStrandReadsAssigned:15646290 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168978 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168978-trimmed-pair1.fastq SRR7168978-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,935,676 reads, 15,528,352 reads pseudoaligned [quant] estimated average fragment length: 258.977 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR7168978.ke.tsv 34699 SRR7168978.se.tsv 87100 total ==> SRR7168978.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.02 245 9.16778 Potri.005G024800.1.v4.1 1035 777.023 35 2.96654 Potri.004G059700.1.v4.1 961 703.086 2 0.187343 Potri.007G009000.2.v4.1 1416 1158.02 0 0 Potri.003G141000.2.v4.1 2943 2685.02 260.052 6.37865 Potri.016G087400.1.v4.1 270 68.4435 1237 1190.29 Potri.015G069301.1.v4.1 564 313.294 0 0 Potri.010G195200.1.v4.1 1773 1515.02 5 0.217354 Potri.012G127500.1.v4.1 977 719.067 3826 350.422 ==> SRR7168978.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1747 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 223 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 30 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7168978 completed mapping pipeline successfully