Starting /dee2/code/volunteer_pipeline.sh SRR7168979 current disk space = 3059081568256 free memory = 1452937872 SRR7168979 SRAfilesize 0189cdac78565e06ed73ffb5b1bd1fb4 SRR7168979.sra SRR7168979.sra file validated SRR7168979 is paired end SRR7168979 is conventional basespace SRR7168979 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168979_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.908 34.0 33.0 34.0 27.0 34.0 2 32.64625 34.0 33.0 34.0 28.0 34.0 3 32.911 34.0 33.0 34.0 31.0 34.0 4 33.14075 34.0 33.0 34.0 32.0 34.0 5 33.09075 34.0 33.0 34.0 32.0 34.0 6 36.67375 38.0 37.0 38.0 34.0 38.0 7 37.012 38.0 38.0 38.0 36.0 38.0 8 37.16675 38.0 38.0 38.0 36.0 38.0 9 37.2635 38.0 38.0 38.0 36.0 38.0 10-14 37.21725 38.0 38.0 38.0 36.6 38.0 15-19 37.24545 38.0 38.0 38.0 36.6 38.0 20-24 37.221799999999995 38.0 38.0 38.0 36.2 38.0 25-29 37.0993 38.0 38.0 38.0 36.0 38.0 30-34 37.1001 38.0 38.0 38.0 36.0 38.0 35-39 36.99845 38.0 38.0 38.0 35.8 38.0 40-44 36.80555 38.0 38.0 38.0 35.0 38.0 45-49 36.65605000000001 38.0 38.0 38.0 34.4 38.0 50-54 36.57504999999999 38.0 38.0 38.0 34.0 38.0 55-59 36.541700000000006 38.0 38.0 38.0 34.0 38.0 60-64 36.35635 38.0 37.4 38.0 33.4 38.0 65-69 36.2938 38.0 37.4 38.0 33.4 38.0 70-74 36.21145 38.0 37.0 38.0 33.0 38.0 75-79 36.0988 38.0 37.0 38.0 33.0 38.0 80-84 35.8868 38.0 37.0 38.0 31.4 38.0 85-89 35.829449999999994 38.0 37.0 38.0 31.0 38.0 90-94 35.606449999999995 38.0 36.8 38.0 29.4 38.0 95-99 35.4255 38.0 36.0 38.0 29.2 38.0 100-104 35.0115 38.0 35.8 38.0 28.0 38.0 105-109 34.85815 38.0 35.2 38.0 27.0 38.0 110-114 34.59365 38.0 34.8 38.0 25.8 38.0 115-119 34.40865 38.0 34.8 38.0 25.0 38.0 120-124 33.701350000000005 38.0 34.0 38.0 18.2 38.0 125-129 33.21835 38.0 33.8 38.0 16.2 38.0 130-134 33.37195 38.0 33.8 38.0 17.8 38.0 135-139 32.744800000000005 37.6 33.2 38.0 14.8 38.0 140-144 32.0144 36.4 32.0 38.0 14.0 38.0 145-149 30.5302 36.0 30.4 38.0 6.4 38.0 150-151 26.886125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 1.0 13 0.0 14 2.0 15 1.0 16 5.0 17 4.0 18 6.0 19 5.0 20 10.0 21 10.0 22 13.0 23 24.0 24 20.0 25 26.0 26 28.0 27 47.0 28 58.0 29 61.0 30 76.0 31 104.0 32 144.0 33 182.0 34 260.0 35 452.0 36 929.0 37 1529.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.3758389261745 14.604026845637582 8.644295302013424 32.375838926174495 2 23.125 17.474999999999998 32.5 26.900000000000002 3 19.225 24.0 26.85 29.925 4 20.175 31.825 23.875 24.125 5 20.61546159619715 34.57593194896172 24.568426319739807 20.240180135101326 6 18.525 35.75 24.775 20.95 7 15.024999999999999 26.8 40.45 17.724999999999998 8 18.175 25.95 30.375000000000004 25.5 9 18.45 25.074999999999996 32.4 24.075 10-14 20.474999999999998 30.095 26.125 23.305 15-19 20.335 28.98 27.57 23.115 20-24 20.53 29.07 26.840000000000003 23.56 25-29 20.165 29.294999999999998 26.979999999999997 23.56 30-34 20.195 29.37 26.955000000000002 23.48 35-39 20.72 29.065 26.779999999999998 23.435 40-44 20.235 28.915000000000003 27.42 23.43 45-49 19.605 29.82 26.384999999999998 24.19 50-54 20.025000000000002 29.48 26.86 23.635 55-59 20.015 29.160000000000004 26.705000000000002 24.12 60-64 19.785 29.134999999999998 26.965 24.115000000000002 65-69 20.605 28.78 27.08 23.535 70-74 20.135 29.04 27.505000000000003 23.32 75-79 20.82 28.425 26.889999999999997 23.865 80-84 20.355 29.220000000000002 27.075 23.35 85-89 20.835 28.955 27.150000000000002 23.06 90-94 20.105 29.425 26.47 24.0 95-99 20.205000000000002 29.115000000000002 27.084999999999997 23.595 100-104 20.505000000000003 28.945 27.325 23.225 105-109 20.23 28.970000000000002 27.165 23.635 110-114 20.625 27.61 27.83 23.935000000000002 115-119 20.625 29.134999999999998 26.700000000000003 23.54 120-124 20.025000000000002 28.435 27.625 23.915 125-129 20.825 28.715000000000003 27.1 23.36 130-134 20.615 28.035 27.685 23.665 135-139 20.935000000000002 28.305000000000003 26.950000000000003 23.810000000000002 140-144 20.974999999999998 28.4 26.72 23.905 145-149 20.7 28.355000000000004 26.545 24.4 150-151 19.8875 29.512500000000003 27.0 23.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.5 23 2.5 24 4.0 25 5.5 26 6.0 27 8.5 28 12.0 29 16.0 30 20.5 31 21.5 32 26.0 33 40.0 34 60.0 35 80.5 36 96.0 37 112.0 38 129.5 39 151.5 40 176.0 41 196.0 42 224.0 43 257.0 44 286.5 45 280.0 46 246.5 47 239.5 48 238.0 49 227.5 50 188.0 51 145.0 52 124.0 53 104.5 54 85.0 55 54.5 56 32.5 57 25.0 58 19.5 59 15.5 60 12.0 61 8.0 62 4.5 63 3.0 64 3.0 65 2.0 66 2.0 67 1.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.875000000000001 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.9625 0.0 0.0 0.0 0.0 126-127 1.0750000000000002 0.0 0.0 0.0 0.0 128-129 1.2125 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.7000000000000002 0.0 0.0 0.0 0.0 136-137 1.9500000000000002 0.0 0.0 0.0 0.0 138-139 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACGAAG 10 0.0068396386 144.9375 2 AAAAAAA 20 0.0059476276 28.9875 35-39 >>END_MODULE SRR7168979 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168979_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.434 33.0 33.0 34.0 32.0 34.0 2 32.48925 33.0 33.0 34.0 32.0 34.0 3 32.44575 34.0 33.0 34.0 31.0 34.0 4 32.419 34.0 33.0 34.0 32.0 34.0 5 32.3675 34.0 33.0 34.0 31.0 34.0 6 36.705 38.0 38.0 38.0 36.0 38.0 7 36.7315 38.0 38.0 38.0 36.0 38.0 8 36.6605 38.0 38.0 38.0 35.0 38.0 9 36.76425 38.0 38.0 38.0 36.0 38.0 10-14 36.638 38.0 38.0 38.0 35.4 38.0 15-19 36.6142 38.0 38.0 38.0 35.4 38.0 20-24 36.62965 38.0 38.0 38.0 35.4 38.0 25-29 36.494299999999996 38.0 38.0 38.0 35.0 38.0 30-34 36.373599999999996 38.0 38.0 38.0 34.2 38.0 35-39 36.37205 38.0 38.0 38.0 34.6 38.0 40-44 36.3962 38.0 38.0 38.0 34.4 38.0 45-49 36.358349999999994 38.0 38.0 38.0 34.8 38.0 50-54 36.3345 38.0 38.0 38.0 34.2 38.0 55-59 36.24865 38.0 38.0 38.0 34.0 38.0 60-64 36.1511 38.0 38.0 38.0 34.0 38.0 65-69 35.97775 38.0 38.0 38.0 33.2 38.0 70-74 35.993900000000004 38.0 38.0 38.0 33.6 38.0 75-79 35.87135 38.0 38.0 38.0 33.0 38.0 80-84 35.765249999999995 38.0 38.0 38.0 31.6 38.0 85-89 35.59765 38.0 37.8 38.0 30.4 38.0 90-94 35.4683 38.0 37.2 38.0 30.2 38.0 95-99 35.30375 38.0 37.0 38.0 29.0 38.0 100-104 35.1537 38.0 37.0 38.0 28.4 38.0 105-109 35.14104999999999 38.0 37.0 38.0 28.6 38.0 110-114 34.94905 38.0 36.8 38.0 27.8 38.0 115-119 34.6841 38.0 36.2 38.0 26.0 38.0 120-124 34.61345 38.0 36.0 38.0 26.4 38.0 125-129 34.14829999999999 38.0 35.4 38.0 23.0 38.0 130-134 33.726350000000004 38.0 35.0 38.0 19.0 38.0 135-139 33.4276 38.0 34.8 38.0 15.0 38.0 140-144 32.923449999999995 38.0 34.2 38.0 14.2 38.0 145-149 32.21775 38.0 33.6 38.0 8.8 38.0 150-151 27.988125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 5.0 4 3.0 5 5.0 6 4.0 7 5.0 8 4.0 9 8.0 10 4.0 11 5.0 12 4.0 13 2.0 14 6.0 15 6.0 16 9.0 17 6.0 18 5.0 19 11.0 20 13.0 21 16.0 22 9.0 23 21.0 24 27.0 25 31.0 26 33.0 27 38.0 28 29.0 29 47.0 30 64.0 31 64.0 32 88.0 33 114.0 34 165.0 35 205.0 36 513.0 37 2410.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.85287471754959 22.319859402460455 12.65377855887522 23.173487321114738 2 29.144720341108606 25.156759468271883 27.94080762478054 17.757712565838975 3 20.978670012547052 28.60727728983689 31.518193224592224 18.89585947302384 4 23.81430363864492 34.50439146800502 22.88582183186951 18.795483061480553 5 24.140526976160604 36.13550815558344 21.78168130489335 17.94228356336261 6 21.932899349023536 36.12919379068603 23.810716074111166 18.12719078617927 7 19.524405506883603 21.201501877346686 38.49812265331665 20.77596996245307 8 21.657486229344016 24.787180771156734 26.91537305958938 26.639959939909865 9 20.38057085628443 26.664997496244368 29.394091136705057 23.56034051076615 10-14 23.396585390276876 28.578581084464027 26.61092474841035 21.413908776848743 15-19 22.855425910160747 28.348940858330412 27.377435024287642 21.41819820722119 20-24 23.5638804026644 27.86097060149246 27.099714528972807 21.475434466870336 25-29 23.880821231847772 28.13219829744617 26.945418127190784 21.04156234351527 30-34 22.993340343498073 27.92048470281909 27.990586350207803 21.095588603475036 35-39 23.095798487655866 27.622815363813913 27.85317241724673 21.42821373128349 40-44 23.080390683696468 28.650137741046834 27.848735286751815 20.420736288504884 45-49 23.08617234468938 28.106212424849698 27.489979959919843 21.317635270541082 50-54 24.109959441189723 27.259526313154076 27.44980221320915 21.18071203244705 55-59 23.367387820512818 27.959735576923077 28.064903846153843 20.607972756410255 60-64 23.40095166541448 27.147508139243676 28.30954169797145 21.1419984973704 65-69 23.74248496993988 27.680360721442888 28.421843687374746 20.155310621242485 70-74 23.39679358717435 28.09619238476954 27.53507014028056 20.971943887775552 75-79 23.47342583779993 27.06006111305916 28.758202674948656 20.70831037419226 80-84 23.860334635808037 28.12343452559864 26.97625488428013 21.039975954313196 85-89 23.73246492985972 27.950901803607213 27.710420841683366 20.606212424849698 90-94 23.552104208416832 28.101202404809616 28.491983967935873 19.854709418837675 95-99 24.660554135978757 27.38113131920437 27.5164086377073 20.441905907109575 100-104 24.243486973947896 27.805611222444888 27.49498997995992 20.455911823647295 105-109 23.612224448897795 27.429859719438877 28.311623246492985 20.64629258517034 110-114 23.776363909623765 27.328290165823354 28.174941135213665 20.720404789339213 115-119 23.436873747494992 26.998997995991985 28.79258517034068 20.771543086172343 120-124 23.532064128256515 27.45490981963928 28.04609218436874 20.96693386773547 125-129 24.49153391443743 27.85793006712754 27.356978258691512 20.293557759743514 130-134 23.87513778935765 27.267261248622106 28.038881651468085 20.818719310552158 135-139 24.10441404880004 27.771932461546168 27.852096798436794 20.271556691216993 140-144 24.090407938257993 28.430389896762552 27.387992382479702 20.09120978249975 145-149 24.10821643286573 27.720440881763526 27.715430861723444 20.455911823647295 150-151 24.07059707097259 27.28752034046814 29.002378270121415 19.639504318437854 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.5 23 2.5 24 1.5 25 1.0 26 0.5 27 2.5 28 6.5 29 6.5 30 7.0 31 15.0 32 22.0 33 26.5 34 37.5 35 57.0 36 69.5 37 95.0 38 131.0 39 171.0 40 197.0 41 215.0 42 239.0 43 262.5 44 272.5 45 266.0 46 271.0 47 274.5 48 267.0 49 233.5 50 192.5 51 161.5 52 126.5 53 98.5 54 77.0 55 49.5 56 36.0 57 27.0 58 17.5 59 15.0 60 13.5 61 7.5 62 2.5 63 5.5 64 4.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.325 3 0.375 4 0.375 5 0.375 6 0.15 7 0.125 8 0.15 9 0.15 10-14 0.135 15-19 0.155 20-24 0.165 25-29 0.15 30-34 0.145 35-39 0.155 40-44 0.17500000000000002 45-49 0.2 50-54 0.145 55-59 0.16 60-64 0.17500000000000002 65-69 0.2 70-74 0.2 75-79 0.185 80-84 0.19 85-89 0.2 90-94 0.2 95-99 0.20500000000000002 100-104 0.2 105-109 0.2 110-114 0.19499999999999998 115-119 0.2 120-124 0.2 125-129 0.19 130-134 0.21 135-139 0.20500000000000002 140-144 0.22999999999999998 145-149 0.2 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52213279678068 98.925 2 0.3772635814889336 0.75 3 0.07545271629778671 0.22499999999999998 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0125 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0125 0.0 0.0 0.025 0.0 72-73 0.037500000000000006 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.05 0.0 0.0 0.025 0.0 92-93 0.05 0.0 0.0 0.025 0.0 94-95 0.075 0.0 0.0 0.025 0.0 96-97 0.075 0.0 0.0 0.025 0.0 98-99 0.1 0.0 0.0 0.025 0.0 100-101 0.1125 0.0 0.0 0.025 0.0 102-103 0.15 0.0 0.0 0.025 0.0 104-105 0.1875 0.0 0.0 0.025 0.0 106-107 0.225 0.0 0.0 0.025 0.0 108-109 0.2375 0.0 0.0 0.025 0.0 110-111 0.25 0.0 0.0 0.025 0.0 112-113 0.2875 0.0 0.0 0.025 0.0 114-115 0.4125 0.0 0.0 0.025 0.0 116-117 0.525 0.0 0.0 0.025 0.0 118-119 0.575 0.0 0.0 0.025 0.0 120-121 0.6375 0.0 0.0 0.025 0.0 122-123 0.8 0.0 0.0 0.025 0.0 124-125 0.95 0.0 0.0 0.025 0.0 126-127 1.0499999999999998 0.0 0.0 0.025 0.0 128-129 1.2125 0.0 0.0 0.025 0.0 130-131 1.35 0.0 0.0 0.025 0.0 132-133 1.4874999999999998 0.0 0.0 0.025 0.0 134-135 1.7375 0.0 0.0 0.025 0.0 136-137 1.975 0.0 0.0 0.025 0.0 138-139 2.225 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935710 spots for SRR7168979.sra Written 935710 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra Read 935697 spots for SRR7168979.sra Written 935697 spots for SRR7168979.sra SRR ids: ['SRR7168979.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_13stk3xb SRR7168979.sra spots: 18713953 blocks: [[1, 935697], [935698, 1871394], [1871395, 2807091], [2807092, 3742788], [3742789, 4678485], [4678486, 5614182], [5614183, 6549879], [6549880, 7485576], [7485577, 8421273], [8421274, 9356970], [9356971, 10292667], [10292668, 11228364], [11228365, 12164061], [12164062, 13099758], [13099759, 14035455], [14035456, 14971152], [14971153, 15906849], [15906850, 16842546], [16842547, 17778243], [17778244, 18713953]] SRR7168979 file size 6319844 SRR7168979 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168979 SRR7168979_1.fastq SRR7168979_2.fastq Input file: SRR7168979_1.fastq Paired file: SRR7168979_2.fastq trimmed: SRR7168979-trimmed-pair1.fastq, SRR7168979-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:50:23 2025 >> started Mon Feb 10 13:50:46 2025 >> done (22.840s) 18713953 read pairs processed; of these: 39555 ( 0.21%) short read pairs filtered out after trimming by size control 71539 ( 0.38%) empty read pairs filtered out after trimming by size control 18602859 (99.41%) read pairs available; of these: 9190108 (49.40%) trimmed read pairs available after processing 9412751 (50.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 2 0.00% 21 6 0.00% 22 3 0.00% 23 6 0.00% 24 6 0.00% 25 9 0.00% 26 11 0.00% 27 8 0.00% 28 7 0.00% 29 10 0.00% 30 8 0.00% 31 5 0.00% 32 9 0.00% 33 7 0.00% 34 11 0.00% 35 12 0.00% 36 10 0.00% 37 15 0.00% 38 16 0.00% 39 10 0.00% 40 18 0.00% 41 20 0.00% 42 22 0.00% 43 22 0.00% 44 26 0.00% 45 43 0.00% 46 26 0.00% 47 40 0.00% 48 30 0.00% 49 33 0.00% 50 55 0.00% 51 46 0.00% 52 61 0.00% 53 81 0.00% 54 65 0.00% 55 77 0.00% 56 99 0.00% 57 89 0.00% 58 117 0.00% 59 118 0.00% 60 123 0.00% 61 152 0.00% 62 162 0.00% 63 165 0.00% 64 197 0.00% 65 220 0.00% 66 248 0.00% 67 258 0.00% 68 314 0.00% 69 356 0.00% 70 421 0.00% 71 451 0.00% 72 487 0.00% 73 543 0.00% 74 625 0.00% 75 635 0.00% 76 746 0.00% 77 771 0.00% 78 947 0.01% 79 1047 0.01% 80 1182 0.01% 81 1323 0.01% 82 1636 0.01% 83 1944 0.01% 84 3402 0.02% 85 4245 0.02% 86 4249 0.02% 87 4239 0.02% 88 4319 0.02% 89 4387 0.02% 90 4612 0.02% 91 4917 0.03% 92 5308 0.03% 93 5488 0.03% 94 5964 0.03% 95 6162 0.03% 96 6356 0.03% 97 6593 0.04% 98 6966 0.04% 99 7408 0.04% 100 7931 0.04% 101 8263 0.04% 102 9014 0.05% 103 9736 0.05% 104 10362 0.06% 105 11056 0.06% 106 11392 0.06% 107 12075 0.06% 108 12663 0.07% 109 13598 0.07% 110 14466 0.08% 111 15148 0.08% 112 16433 0.09% 113 17600 0.09% 114 18603 0.10% 115 20058 0.11% 116 21010 0.11% 117 21890 0.12% 118 23492 0.13% 119 24369 0.13% 120 25588 0.14% 121 27394 0.15% 122 28727 0.15% 123 31282 0.17% 124 33532 0.18% 125 35494 0.19% 126 38255 0.21% 127 40335 0.22% 128 42924 0.23% 129 45316 0.24% 130 48667 0.26% 131 51305 0.28% 132 55630 0.30% 133 60073 0.32% 134 65023 0.35% 135 69658 0.37% 136 75955 0.41% 137 81638 0.44% 138 88081 0.47% 139 95564 0.51% 140 106870 0.57% 141 118917 0.64% 142 134398 0.72% 143 155379 0.84% 144 181067 0.97% 145 220068 1.18% 146 277117 1.49% 147 375632 2.02% 148 567588 3.05% 149 1082273 5.82% 150 4530361 24.35% 151 9412751 50.60% 18602859 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=39 prefix-density=0.18 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=290.11 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=37 prefix-density=0.23 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=33 fanout-score=56.30 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=13.2 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCG SRR7168979 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:51:39 Started mapping on | Feb 10 13:51:40 Finished on | Feb 10 13:53:49 Mapping speed, Million of reads per hour | 519.15 Number of input reads | 18602859 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17468317 Uniquely mapped reads % | 93.90% Average mapped length | 295.34 Number of splices: Total | 16488811 Number of splices: Annotated (sjdb) | 16219281 Number of splices: GT/AG | 16254475 Number of splices: GC/AG | 188929 Number of splices: AT/AC | 12968 Number of splices: Non-canonical | 32439 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330539 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 49863 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.00% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 835875 835875 835875 N_multimapping 330539 330539 330539 N_noFeature 371100 17273949 456572 N_ambiguous 183462 890 73958 UnstrandedReadsAssigned:16913755 PositiveStrandReadsAssigned:193478 NegativeStrandReadsAssigned:16937787 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168979 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168979-trimmed-pair1.fastq SRR7168979-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,602,859 reads, 16,856,534 reads pseudoaligned [quant] estimated average fragment length: 261.012 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,355 rounds 52401 SRR7168979.ke.tsv 34699 SRR7168979.se.tsv 87100 total ==> SRR7168979.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.99 309 9.5514 Potri.005G024800.1.v4.1 1035 774.988 34 2.38401 Potri.004G059700.1.v4.1 961 701.038 8 0.620116 Potri.007G009000.2.v4.1 1416 1155.99 0 0 Potri.003G141000.2.v4.1 2943 2682.99 277.06 5.61151 Potri.016G087400.1.v4.1 270 67.2752 1714 1384.46 Potri.015G069301.1.v4.1 564 310.073 0 0 Potri.010G195200.1.v4.1 1773 1512.99 30 1.07748 Potri.012G127500.1.v4.1 977 717.02 6939 525.884 ==> SRR7168979.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1522 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 328 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 36 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168979 completed mapping pipeline successfully