Starting /dee2/code/volunteer_pipeline.sh SRR7168980 current disk space = 3059087077376 free memory = 1345693956 SRR7168980 SRAfilesize 01a2fda5a2a7c4dee2075cf5ea223161 SRR7168980.sra SRR7168980.sra file validated SRR7168980 is paired end SRR7168980 is conventional basespace SRR7168980 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168980_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.622 34.0 34.0 34.0 33.0 34.0 2 33.713 34.0 34.0 34.0 33.0 34.0 3 33.723 34.0 34.0 34.0 33.0 34.0 4 33.75125 34.0 34.0 34.0 33.0 34.0 5 33.72425 34.0 34.0 34.0 33.0 34.0 6 37.47975 38.0 38.0 38.0 37.0 38.0 7 37.6495 38.0 38.0 38.0 38.0 38.0 8 37.70675 38.0 38.0 38.0 38.0 38.0 9 37.57925 38.0 38.0 38.0 38.0 38.0 10-14 37.70155 38.0 38.0 38.0 38.0 38.0 15-19 37.724199999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.727850000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.6957 38.0 38.0 38.0 38.0 38.0 30-34 37.624449999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.55405 38.0 38.0 38.0 38.0 38.0 40-44 37.46705 38.0 38.0 38.0 38.0 38.0 45-49 37.4404 38.0 38.0 38.0 37.2 38.0 50-54 37.422450000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.362550000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.308800000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.2863 38.0 38.0 38.0 36.8 38.0 70-74 37.2238 38.0 38.0 38.0 37.0 38.0 75-79 37.17695 38.0 38.0 38.0 36.6 38.0 80-84 37.12650000000001 38.0 38.0 38.0 36.0 38.0 85-89 37.0582 38.0 38.0 38.0 36.0 38.0 90-94 36.991499999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.9076 38.0 38.0 38.0 36.0 38.0 100-104 36.79215 38.0 38.0 38.0 35.4 38.0 105-109 36.74945 38.0 38.0 38.0 35.2 38.0 110-114 36.50435 38.0 38.0 38.0 34.4 38.0 115-119 36.423350000000006 38.0 38.0 38.0 34.4 38.0 120-124 36.21015 38.0 38.0 38.0 34.0 38.0 125-129 35.9764 38.0 37.8 38.0 33.4 38.0 130-134 35.8351 38.0 37.0 38.0 32.8 38.0 135-139 35.6348 38.0 36.8 38.0 32.6 38.0 140-144 35.37545 38.0 36.0 38.0 31.0 38.0 145-149 34.9365 38.0 36.0 38.0 29.4 38.0 150-151 31.640875 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 4.0 17 2.0 18 3.0 19 0.0 20 1.0 21 2.0 22 5.0 23 9.0 24 11.0 25 12.0 26 17.0 27 15.0 28 13.0 29 20.0 30 25.0 31 22.0 32 47.0 33 65.0 34 79.0 35 155.0 36 501.0 37 2986.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.00827689992476 14.647604715324805 11.086029596187611 33.25808878856283 2 22.930732683170792 16.25406351587897 32.50812703175794 28.307076769192296 3 19.3 21.224999999999998 26.650000000000002 32.824999999999996 4 21.7 28.625 23.25 26.424999999999997 5 21.625 32.45 23.9 22.025 6 20.674999999999997 33.25 24.75 21.325 7 14.825 28.749999999999996 38.85 17.575 8 17.275 28.999999999999996 30.15 23.575 9 16.5 26.950000000000003 33.25 23.3 10-14 19.21 31.259999999999998 26.87 22.66 15-19 19.205 30.145 27.48 23.169999999999998 20-24 18.905 30.470000000000002 27.450000000000003 23.175 25-29 18.61 30.28 27.51 23.599999999999998 30-34 19.115 30.485 26.919999999999998 23.48 35-39 19.475 29.585 27.735 23.205000000000002 40-44 19.509999999999998 29.945 26.790000000000003 23.755000000000003 45-49 19.400000000000002 30.11 26.974999999999998 23.515 50-54 20.01 29.475 27.0 23.515 55-59 19.77 30.025000000000002 26.88 23.325000000000003 60-64 19.265 29.765000000000004 27.275 23.695 65-69 19.495 29.775000000000002 26.884999999999998 23.845 70-74 19.71 29.970000000000002 27.275 23.044999999999998 75-79 19.945 29.68 26.840000000000003 23.535 80-84 19.869999999999997 28.754999999999995 27.82 23.555 85-89 19.715 28.115000000000002 28.15 24.02 90-94 20.080000000000002 29.39 26.905 23.625 95-99 19.45 29.38 27.345000000000002 23.825 100-104 20.419999999999998 28.945 27.27 23.365 105-109 19.66 28.4 27.889999999999997 24.05 110-114 19.650000000000002 28.9 27.775 23.674999999999997 115-119 20.235 28.62 27.650000000000002 23.494999999999997 120-124 20.07 28.560000000000002 27.305 24.065 125-129 20.495 29.005 26.61 23.89 130-134 20.885 28.63 26.99 23.494999999999997 135-139 19.919999999999998 28.34 27.55 24.19 140-144 20.825 28.544999999999998 27.165 23.465 145-149 20.23 28.84 26.625 24.305 150-151 20.1 27.375 27.8625 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 2.0 22 1.5 23 2.0 24 5.0 25 6.0 26 8.5 27 10.5 28 14.0 29 27.5 30 33.0 31 40.0 32 59.5 33 64.5 34 83.0 35 104.0 36 120.5 37 139.0 38 146.5 39 167.0 40 192.5 41 210.5 42 221.0 43 226.5 44 233.5 45 239.5 46 234.0 47 220.0 48 199.0 49 175.0 50 158.0 51 138.5 52 106.5 53 89.5 54 76.0 55 56.5 56 43.5 57 34.0 58 25.5 59 17.5 60 16.5 61 13.5 62 9.0 63 6.5 64 4.0 65 2.5 66 2.0 67 2.0 68 3.5 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.2000000000000002 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.4875 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.9875 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.5125 0.0 0.0 0.0 0.0 138-139 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGTT 10 0.006577216 146.82278 1 TCATTAG 10 0.006832588 144.9875 7 >>END_MODULE SRR7168980 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168980_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.103 34.0 33.0 34.0 33.0 34.0 2 33.1795 34.0 33.0 34.0 33.0 34.0 3 33.1865 34.0 33.0 34.0 33.0 34.0 4 33.2105 34.0 33.0 34.0 33.0 34.0 5 33.18625 34.0 33.0 34.0 33.0 34.0 6 37.371 38.0 38.0 38.0 38.0 38.0 7 37.3875 38.0 38.0 38.0 38.0 38.0 8 37.313 38.0 38.0 38.0 38.0 38.0 9 37.35375 38.0 38.0 38.0 38.0 38.0 10-14 37.28750000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.20245 38.0 38.0 38.0 37.6 38.0 20-24 37.19675 38.0 38.0 38.0 38.0 38.0 25-29 37.19465 38.0 38.0 38.0 38.0 38.0 30-34 37.1419 38.0 38.0 38.0 38.0 38.0 35-39 37.17745 38.0 38.0 38.0 38.0 38.0 40-44 37.126549999999995 38.0 38.0 38.0 37.8 38.0 45-49 37.0923 38.0 38.0 38.0 37.6 38.0 50-54 37.0155 38.0 38.0 38.0 37.0 38.0 55-59 36.9662 38.0 38.0 38.0 37.0 38.0 60-64 36.93585 38.0 38.0 38.0 36.8 38.0 65-69 36.9149 38.0 38.0 38.0 37.0 38.0 70-74 36.82525 38.0 38.0 38.0 36.6 38.0 75-79 36.7346 38.0 38.0 38.0 36.0 38.0 80-84 36.63945 38.0 38.0 38.0 36.0 38.0 85-89 36.59555 38.0 38.0 38.0 36.0 38.0 90-94 36.5269 38.0 38.0 38.0 35.8 38.0 95-99 36.30875 38.0 38.0 38.0 34.6 38.0 100-104 36.22065 38.0 38.0 38.0 34.2 38.0 105-109 36.0852 38.0 38.0 38.0 34.0 38.0 110-114 36.0051 38.0 38.0 38.0 34.0 38.0 115-119 35.84655 38.0 38.0 38.0 33.4 38.0 120-124 35.35655 38.0 37.2 38.0 30.4 38.0 125-129 35.218050000000005 38.0 36.8 38.0 30.2 38.0 130-134 34.9772 38.0 36.0 38.0 28.8 38.0 135-139 34.454950000000004 38.0 35.8 38.0 26.4 38.0 140-144 33.90195000000001 38.0 34.6 38.0 23.0 38.0 145-149 33.1368 38.0 33.2 38.0 16.2 38.0 150-151 29.2775 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 2.0 4 2.0 5 3.0 6 2.0 7 3.0 8 1.0 9 1.0 10 2.0 11 2.0 12 4.0 13 1.0 14 4.0 15 4.0 16 3.0 17 7.0 18 5.0 19 2.0 20 6.0 21 10.0 22 9.0 23 15.0 24 9.0 25 14.0 26 22.0 27 16.0 28 18.0 29 36.0 30 47.0 31 35.0 32 44.0 33 66.0 34 106.0 35 177.0 36 504.0 37 2798.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.15361521140856 20.540405303977984 16.18714035526645 25.11883912934701 2 26.125 29.2 26.75 17.925 3 21.525 31.45 27.85 19.175 4 23.799999999999997 34.325 22.8 19.075 5 24.6 34.975 23.575 16.85 6 22.1 36.225 23.849999999999998 17.825 7 21.45 22.650000000000002 35.975 19.925 8 22.275 26.075 27.500000000000004 24.15 9 22.625 26.700000000000003 28.125 22.55 10-14 23.385 28.804999999999996 25.779999999999998 22.03 15-19 23.72 28.275 27.224999999999998 20.78 20-24 24.125 28.34 26.779999999999998 20.755000000000003 25-29 23.805 27.884999999999998 27.29 21.02 30-34 24.265 28.57 26.605 20.560000000000002 35-39 23.68 27.87 27.37 21.08 40-44 23.810000000000002 27.865000000000002 27.455000000000002 20.87 45-49 23.805 27.41 27.58 21.205 50-54 23.04 28.17 27.37 21.42 55-59 23.849999999999998 27.794999999999998 27.894999999999996 20.46 60-64 23.685000000000002 27.985 27.465 20.865000000000002 65-69 23.86 27.83 28.08 20.23 70-74 23.635 27.42 28.02 20.925 75-79 23.745 28.005000000000003 27.450000000000003 20.8 80-84 24.07 26.99 28.405 20.535 85-89 23.535 27.134999999999998 28.24 21.09 90-94 23.755000000000003 27.544999999999998 28.000000000000004 20.7 95-99 24.15 27.97 27.474999999999998 20.405 100-104 23.965 27.875 27.73 20.43 105-109 23.405 28.175 28.24 20.18 110-114 23.925 28.060000000000002 27.51 20.505000000000003 115-119 23.565 28.17 28.38 19.885 120-124 23.585 27.58 28.375 20.46 125-129 24.11 27.875 27.79 20.225 130-134 23.61 28.005000000000003 28.139999999999997 20.244999999999997 135-139 23.549999999999997 28.075 28.110000000000003 20.265 140-144 24.745 27.36 27.98 19.915 145-149 24.099999999999998 27.6 28.38 19.919999999999998 150-151 23.1125 27.250000000000004 28.8375 20.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 2.0 26 1.5 27 3.0 28 6.5 29 7.5 30 8.0 31 11.0 32 17.0 33 32.0 34 43.0 35 57.0 36 85.5 37 104.5 38 115.0 39 139.5 40 186.0 41 227.0 42 248.5 43 269.5 44 294.0 45 284.0 46 263.0 47 259.0 48 246.5 49 218.0 50 180.5 51 148.0 52 117.5 53 104.5 54 78.5 55 55.5 56 53.0 57 32.0 58 17.0 59 17.0 60 14.5 61 9.5 62 4.5 63 1.5 64 2.0 65 5.0 66 4.0 67 2.0 68 3.5 69 2.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.5 88 1.5 89 1.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31904161412358 98.45 2 0.5296343001261034 1.05 3 0.1008827238335435 0.3 4 0.05044136191677175 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.4875 0.0 0.0 0.0 0.0 130-131 1.7125 0.0 0.0 0.0 0.0 132-133 1.9749999999999999 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.4375 0.0 0.0 0.0 0.0 138-139 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTGAA 10 0.006830828 145.0 5 GAAACTT 10 0.006830828 145.0 8 TTTTTTT 35 0.0035366106 20.714287 9 >>END_MODULE Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641019 spots for SRR7168980.sra Written 641019 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra Read 641002 spots for SRR7168980.sra Written 641002 spots for SRR7168980.sra SRR ids: ['SRR7168980.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tfej11e3 SRR7168980.sra spots: 12820057 blocks: [[1, 641002], [641003, 1282004], [1282005, 1923006], [1923007, 2564008], [2564009, 3205010], [3205011, 3846012], [3846013, 4487014], [4487015, 5128016], [5128017, 5769018], [5769019, 6410020], [6410021, 7051022], [7051023, 7692024], [7692025, 8333026], [8333027, 8974028], [8974029, 9615030], [9615031, 10256032], [10256033, 10897034], [10897035, 11538036], [11538037, 12179038], [12179039, 12820057]] SRR7168980 file size 4322596 SRR7168980 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168980 SRR7168980_1.fastq SRR7168980_2.fastq Input file: SRR7168980_1.fastq Paired file: SRR7168980_2.fastq trimmed: SRR7168980-trimmed-pair1.fastq, SRR7168980-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:34:54 2025 >> started Mon Feb 10 13:35:09 2025 >> done (14.886s) 12820057 read pairs processed; of these: 26897 ( 0.21%) short read pairs filtered out after trimming by size control 30992 ( 0.24%) empty read pairs filtered out after trimming by size control 12762168 (99.55%) read pairs available; of these: 4990784 (39.11%) trimmed read pairs available after processing 7771384 (60.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 9 0.00% 21 3 0.00% 22 6 0.00% 23 9 0.00% 24 6 0.00% 25 8 0.00% 26 4 0.00% 27 8 0.00% 28 8 0.00% 29 7 0.00% 30 10 0.00% 31 6 0.00% 32 8 0.00% 33 11 0.00% 34 4 0.00% 35 14 0.00% 36 11 0.00% 37 12 0.00% 38 10 0.00% 39 9 0.00% 40 8 0.00% 41 7 0.00% 42 9 0.00% 43 12 0.00% 44 23 0.00% 45 18 0.00% 46 18 0.00% 47 17 0.00% 48 28 0.00% 49 23 0.00% 50 18 0.00% 51 34 0.00% 52 16 0.00% 53 26 0.00% 54 28 0.00% 55 40 0.00% 56 28 0.00% 57 33 0.00% 58 46 0.00% 59 38 0.00% 60 43 0.00% 61 49 0.00% 62 64 0.00% 63 67 0.00% 64 80 0.00% 65 94 0.00% 66 91 0.00% 67 103 0.00% 68 106 0.00% 69 168 0.00% 70 181 0.00% 71 177 0.00% 72 183 0.00% 73 199 0.00% 74 190 0.00% 75 284 0.00% 76 307 0.00% 77 319 0.00% 78 380 0.00% 79 399 0.00% 80 465 0.00% 81 511 0.00% 82 634 0.00% 83 799 0.01% 84 1879 0.01% 85 2672 0.02% 86 2807 0.02% 87 2898 0.02% 88 2998 0.02% 89 3080 0.02% 90 3139 0.02% 91 3206 0.03% 92 3225 0.03% 93 3443 0.03% 94 3532 0.03% 95 3690 0.03% 96 3915 0.03% 97 4216 0.03% 98 4369 0.03% 99 4483 0.04% 100 4943 0.04% 101 5312 0.04% 102 5643 0.04% 103 5971 0.05% 104 6416 0.05% 105 6786 0.05% 106 7318 0.06% 107 7639 0.06% 108 7845 0.06% 109 8448 0.07% 110 8722 0.07% 111 9358 0.07% 112 9768 0.08% 113 10581 0.08% 114 11416 0.09% 115 11992 0.09% 116 12674 0.10% 117 13141 0.10% 118 13768 0.11% 119 14114 0.11% 120 14868 0.12% 121 15659 0.12% 122 16569 0.13% 123 17821 0.14% 124 18915 0.15% 125 20258 0.16% 126 21381 0.17% 127 22753 0.18% 128 23245 0.18% 129 24658 0.19% 130 26430 0.21% 131 28136 0.22% 132 30082 0.24% 133 32194 0.25% 134 34762 0.27% 135 37868 0.30% 136 40210 0.32% 137 44019 0.34% 138 47060 0.37% 139 50038 0.39% 140 54673 0.43% 141 58295 0.46% 142 64418 0.50% 143 72629 0.57% 144 83341 0.65% 145 99782 0.78% 146 121496 0.95% 147 162270 1.27% 148 248868 1.95% 149 486718 3.81% 150 2729427 21.39% 151 7771384 60.89% 12762168 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=38 prefix-density=0.19 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=291.65 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=21.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=7.35 fanout-score-rank=18 prefix-density=0.38 prefix-fanout=3.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=249.90 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=25.7 sequence=GAAGAAGAAGAAA SRR7168980 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:36:01 Started mapping on | Feb 10 13:36:03 Finished on | Feb 10 13:38:01 Mapping speed, Million of reads per hour | 389.35 Number of input reads | 12762168 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11732048 Uniquely mapped reads % | 91.93% Average mapped length | 296.48 Number of splices: Total | 10297531 Number of splices: Annotated (sjdb) | 10115655 Number of splices: GT/AG | 10142954 Number of splices: GC/AG | 121686 Number of splices: AT/AC | 8839 Number of splices: Non-canonical | 24052 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 213357 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 29512 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.11% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 840715 840715 840715 N_multimapping 213357 213357 213357 N_noFeature 278383 11585181 343077 N_ambiguous 131470 756 48863 UnstrandedReadsAssigned:11322195 PositiveStrandReadsAssigned:146111 NegativeStrandReadsAssigned:11340108 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168980 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168980-trimmed-pair1.fastq SRR7168980-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,762,168 reads, 11,309,347 reads pseudoaligned [quant] estimated average fragment length: 251.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR7168980.ke.tsv 34699 SRR7168980.se.tsv 87100 total ==> SRR7168980.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.42 165 6.6888 Potri.005G024800.1.v4.1 1035 784.421 43 3.92757 Potri.004G059700.1.v4.1 961 710.446 3 0.302548 Potri.007G009000.2.v4.1 1416 1165.42 0 0 Potri.003G141000.2.v4.1 2943 2692.42 169 4.49726 Potri.016G087400.1.v4.1 270 68.8209 1530 1592.85 Potri.015G069301.1.v4.1 564 317.254 0 0 Potri.010G195200.1.v4.1 1773 1522.42 30 1.41186 Potri.012G127500.1.v4.1 977 726.428 5072 500.255 ==> SRR7168980.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1245 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 285 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168980 completed mapping pipeline successfully