Starting /dee2/code/volunteer_pipeline.sh SRR7168981 current disk space = 3059108937728 free memory = 1180965340 SRR7168981 SRAfilesize 62a0f56320b22a0211d5e41baa10daac SRR7168981.sra SRR7168981.sra file validated SRR7168981 is paired end SRR7168981 is conventional basespace SRR7168981 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168981_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07 34.0 33.0 34.0 33.0 34.0 2 33.48725 34.0 34.0 34.0 33.0 34.0 3 33.49725 34.0 34.0 34.0 33.0 34.0 4 33.51675 34.0 34.0 34.0 33.0 34.0 5 33.54925 34.0 34.0 34.0 33.0 34.0 6 37.186 38.0 38.0 38.0 36.0 38.0 7 37.45225 38.0 38.0 38.0 37.0 38.0 8 37.50075 38.0 38.0 38.0 37.0 38.0 9 37.61075 38.0 38.0 38.0 38.0 38.0 10-14 37.563250000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.58475 38.0 38.0 38.0 38.0 38.0 20-24 37.565149999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.503249999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.461949999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.39684999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.297349999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.34445 38.0 38.0 38.0 37.0 38.0 50-54 37.289249999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.228500000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.201 38.0 38.0 38.0 36.8 38.0 65-69 37.1466 38.0 38.0 38.0 36.0 38.0 70-74 37.11425 38.0 38.0 38.0 36.0 38.0 75-79 37.084950000000006 38.0 38.0 38.0 36.0 38.0 80-84 36.9431 38.0 38.0 38.0 36.0 38.0 85-89 36.8794 38.0 38.0 38.0 36.0 38.0 90-94 36.82825 38.0 38.0 38.0 35.4 38.0 95-99 36.8101 38.0 38.0 38.0 35.2 38.0 100-104 36.59665 38.0 38.0 38.0 34.8 38.0 105-109 36.46575 38.0 38.0 38.0 34.4 38.0 110-114 36.329699999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.199 38.0 38.0 38.0 34.0 38.0 120-124 35.98995 38.0 37.6 38.0 33.0 38.0 125-129 35.895500000000006 38.0 37.6 38.0 33.0 38.0 130-134 35.66055 38.0 37.0 38.0 31.8 38.0 135-139 35.532650000000004 38.0 36.2 38.0 31.4 38.0 140-144 34.998400000000004 38.0 36.0 38.0 28.8 38.0 145-149 34.5329 38.0 35.4 38.0 27.8 38.0 150-151 31.80025 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 2.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 4.0 18 2.0 19 2.0 20 4.0 21 8.0 22 1.0 23 4.0 24 13.0 25 14.0 26 15.0 27 16.0 28 27.0 29 32.0 30 40.0 31 50.0 32 46.0 33 64.0 34 107.0 35 186.0 36 481.0 37 2876.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.629817444219064 15.060851926977687 10.9026369168357 34.40669371196755 2 22.825 17.075000000000003 33.725 26.375 3 18.825 23.65 27.275 30.25 4 20.599999999999998 30.125 24.5 24.775 5 22.780695173793447 34.2335583895974 22.755688922230558 20.230057514378593 6 20.150000000000002 35.25 24.474999999999998 20.125 7 15.1 25.724999999999998 40.550000000000004 18.625 8 18.575 25.8 29.9 25.724999999999998 9 17.45 23.9 33.15 25.5 10-14 19.71 29.185 27.375 23.73 15-19 19.994999999999997 28.599999999999998 27.71 23.695 20-24 20.03 29.104999999999997 27.584999999999997 23.28 25-29 20.244999999999997 29.075 27.235 23.445 30-34 20.01 29.134999999999998 27.389999999999997 23.465 35-39 19.945 29.205 27.05 23.799999999999997 40-44 19.605 29.42 27.505000000000003 23.47 45-49 20.1 29.195 27.115000000000002 23.59 50-54 20.200000000000003 29.035 27.43 23.335 55-59 20.09 29.044999999999998 27.36 23.505000000000003 60-64 19.994999999999997 28.565 27.29 24.15 65-69 20.25 28.95 27.389999999999997 23.41 70-74 19.895 28.54 27.38 24.185000000000002 75-79 20.745 28.65 26.83 23.775 80-84 20.064999999999998 28.87 27.465 23.599999999999998 85-89 20.315 28.29 26.99 24.404999999999998 90-94 21.075 28.689999999999998 26.540000000000003 23.695 95-99 20.705000000000002 27.905 28.02 23.369999999999997 100-104 20.9 28.365000000000002 27.145000000000003 23.59 105-109 20.46 28.24 26.855 24.445 110-114 20.495 28.185 27.245 24.075 115-119 20.28 28.475 27.12 24.125 120-124 20.705000000000002 28.315 26.939999999999998 24.04 125-129 20.03 27.975 27.744999999999997 24.25 130-134 20.474999999999998 28.035 27.334999999999997 24.154999999999998 135-139 20.669999999999998 28.215 27.205000000000002 23.91 140-144 21.3 28.035 27.3 23.365 145-149 20.075000000000003 28.62 27.49 23.815 150-151 20.599999999999998 28.549999999999997 26.55 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 2.5 24 3.0 25 4.0 26 4.5 27 8.0 28 14.5 29 20.0 30 26.0 31 37.0 32 41.5 33 51.5 34 66.5 35 79.0 36 91.0 37 105.5 38 123.0 39 141.5 40 155.5 41 189.0 42 220.5 43 246.0 44 261.5 45 250.0 46 262.0 47 271.0 48 245.0 49 205.0 50 171.5 51 145.0 52 130.5 53 103.5 54 76.5 55 59.0 56 45.5 57 38.5 58 31.0 59 22.5 60 14.5 61 11.0 62 5.0 63 1.5 64 3.0 65 4.5 66 2.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.1125 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.3375 0.0 0.0 0.0 0.0 130-131 1.4874999999999998 0.0 0.0 0.0 0.0 132-133 1.675 0.0 0.0 0.0 0.0 134-135 1.8875000000000002 0.0 0.0 0.0 0.0 136-137 2.0625 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168981 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168981_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02425 33.0 33.0 34.0 32.0 34.0 2 33.09175 34.0 33.0 34.0 33.0 34.0 3 33.12225 34.0 33.0 34.0 33.0 34.0 4 33.114 34.0 33.0 34.0 33.0 34.0 5 33.10375 34.0 33.0 34.0 33.0 34.0 6 37.28275 38.0 38.0 38.0 37.0 38.0 7 37.3655 38.0 38.0 38.0 37.0 38.0 8 37.36025 38.0 38.0 38.0 37.0 38.0 9 37.3445 38.0 38.0 38.0 37.0 38.0 10-14 37.307900000000004 38.0 38.0 38.0 37.4 38.0 15-19 37.264799999999994 38.0 38.0 38.0 37.4 38.0 20-24 37.2337 38.0 38.0 38.0 37.0 38.0 25-29 37.192 38.0 38.0 38.0 37.0 38.0 30-34 37.226749999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.150349999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.12735 38.0 38.0 38.0 37.0 38.0 45-49 37.1243 38.0 38.0 38.0 37.0 38.0 50-54 37.0592 38.0 38.0 38.0 36.6 38.0 55-59 37.065650000000005 38.0 38.0 38.0 36.8 38.0 60-64 37.0484 38.0 38.0 38.0 36.6 38.0 65-69 36.95625 38.0 38.0 38.0 36.0 38.0 70-74 36.887 38.0 38.0 38.0 36.0 38.0 75-79 36.8001 38.0 38.0 38.0 35.8 38.0 80-84 36.76559999999999 38.0 38.0 38.0 35.8 38.0 85-89 36.6647 38.0 38.0 38.0 35.0 38.0 90-94 36.553999999999995 38.0 38.0 38.0 34.6 38.0 95-99 36.412850000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.32965 38.0 38.0 38.0 34.0 38.0 105-109 36.18815 38.0 38.0 38.0 34.0 38.0 110-114 36.049549999999996 38.0 37.6 38.0 33.6 38.0 115-119 35.81615000000001 38.0 37.6 38.0 32.6 38.0 120-124 35.57325000000001 38.0 37.0 38.0 31.0 38.0 125-129 35.442600000000006 38.0 36.6 38.0 31.0 38.0 130-134 34.978449999999995 38.0 36.0 38.0 28.0 38.0 135-139 34.642250000000004 38.0 35.4 38.0 26.6 38.0 140-144 34.440149999999996 38.0 35.0 38.0 27.0 38.0 145-149 33.65435 38.0 34.2 38.0 21.0 38.0 150-151 29.372125 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 3.0 5 2.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 3.0 14 4.0 15 1.0 16 5.0 17 1.0 18 4.0 19 9.0 20 4.0 21 8.0 22 11.0 23 7.0 24 9.0 25 22.0 26 20.0 27 16.0 28 25.0 29 27.0 30 50.0 31 44.0 32 58.0 33 80.0 34 114.0 35 225.0 36 609.0 37 2627.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.2 21.15 14.899999999999999 25.75 2 27.938969484742373 26.588294147073537 28.46423211605803 17.008504252126063 3 20.95118898623279 29.912390488110134 30.18773466833542 18.94868585732165 4 22.67267267267267 35.985985985985984 21.796796796796798 19.544544544544546 5 23.323323323323322 36.43643643643644 22.32232232232232 17.917917917917915 6 22.655663915978995 35.93398349587397 23.280820205051263 18.12953238309577 7 22.50562640660165 21.080270067516878 37.2093023255814 19.204801200300075 8 23.85596399099775 25.70642660665166 26.30657664416104 24.131032758189548 9 23.055763940985248 24.48112028007002 28.75718929732433 23.705926481620406 10-14 24.04221266379914 28.16845053516055 25.972791837551267 21.816544963489047 15-19 24.18830356696183 28.18049927460103 26.604632547901346 21.026564610535793 20-24 23.87074183382522 28.042619178630385 27.342304036816568 20.744334950727826 25-29 23.915762092941826 28.117652943824723 26.59696863588615 21.36961632734731 30-34 23.566783391695846 27.738869434717362 27.528764382191095 21.1655827913957 35-39 23.232778027915355 28.085446995847718 27.1699434689079 21.51183150732903 40-44 23.934573829531814 27.881152460984392 27.531012404961984 20.65326130452181 45-49 23.47673836918459 27.65382691345673 27.228614307153578 21.6408204102051 50-54 23.658280398139347 28.029810433651782 27.44460561196419 20.867303556244686 55-59 24.20589265169326 27.63743684658096 27.372317542894304 20.784352958831473 60-64 23.65182591295648 28.104052026013004 27.238619309654826 21.005502751375687 65-69 23.90695347673837 27.32866433216608 28.109054527263634 20.655327663831915 70-74 24.132066033016507 27.56378189094547 27.68384192096048 20.62031015507754 75-79 23.85311921556856 26.869778378107963 28.365601080594327 20.91150132572915 80-84 24.02201100550275 27.61880940470235 27.34367183591796 21.01550775387694 85-89 24.304721888755502 27.531012404961984 26.99579831932773 21.16846738695478 90-94 24.047023511755878 27.088544272136065 27.818909454727365 21.045522761380692 95-99 24.324729891956785 28.021208483393355 26.90576230492197 20.74829931972789 100-104 24.353523733306655 27.33456709848447 27.579652878507478 20.732256289701397 105-109 23.725931482870717 27.616904226056516 27.771942985746435 20.885221305326333 110-114 24.023408192867503 27.59465813034562 27.799729905466915 20.58220377131996 115-119 24.223322827555155 28.130471759467707 26.834759117514633 20.811446295462506 120-124 24.041829280496348 28.169718803162212 27.26408485940158 20.52436705693986 125-129 24.029223378702962 28.267614091273018 27.066653322658123 20.636509207365894 130-134 24.420989445250363 27.7124706117753 27.237256765544494 20.629283177429844 135-139 23.900755339902958 28.297733980291127 27.67745485468461 20.124055825121303 140-144 24.312156078039017 27.573786893446723 27.77888944472236 20.335167583791897 145-149 24.69605243408215 27.417821584029618 27.53289638264872 20.353229599239505 150-151 25.200100050025014 27.5887943971986 27.463731865932967 19.74737368684342 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 1.0 27 3.0 28 4.0 29 6.5 30 7.0 31 10.0 32 20.0 33 25.5 34 31.0 35 38.0 36 59.5 37 88.0 38 117.5 39 143.5 40 162.5 41 195.0 42 245.0 43 279.5 44 283.5 45 303.0 46 298.0 47 272.5 48 271.5 49 226.0 50 183.5 51 159.5 52 130.0 53 106.0 54 87.0 55 74.5 56 47.0 57 33.5 58 24.0 59 13.5 60 6.0 61 4.5 62 6.5 63 5.5 64 4.5 65 4.5 66 4.5 67 3.5 68 3.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.125 4 0.1 5 0.1 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.03 15-19 0.055 20-24 0.045 25-29 0.045 30-34 0.05 35-39 0.055 40-44 0.04 45-49 0.05 50-54 0.034999999999999996 55-59 0.045 60-64 0.05 65-69 0.05 70-74 0.05 75-79 0.055 80-84 0.05 85-89 0.04 90-94 0.05 95-99 0.04 100-104 0.034999999999999996 105-109 0.025 110-114 0.034999999999999996 115-119 0.055 120-124 0.06999999999999999 125-129 0.08 130-134 0.045 135-139 0.045 140-144 0.05 145-149 0.065 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.5375 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.175 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.425 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.7875 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.2750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTGAT 10 0.006830828 145.0 7 >>END_MODULE Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731182 spots for SRR7168981.sra Written 731182 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra Read 731178 spots for SRR7168981.sra Written 731178 spots for SRR7168981.sra SRR ids: ['SRR7168981.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yci9uv2v SRR7168981.sra spots: 14623564 blocks: [[1, 731178], [731179, 1462356], [1462357, 2193534], [2193535, 2924712], [2924713, 3655890], [3655891, 4387068], [4387069, 5118246], [5118247, 5849424], [5849425, 6580602], [6580603, 7311780], [7311781, 8042958], [8042959, 8774136], [8774137, 9505314], [9505315, 10236492], [10236493, 10967670], [10967671, 11698848], [11698849, 12430026], [12430027, 13161204], [13161205, 13892382], [13892383, 14623564]] SRR7168981 file size 4933745 SRR7168981 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168981 SRR7168981_1.fastq SRR7168981_2.fastq Input file: SRR7168981_1.fastq Paired file: SRR7168981_2.fastq trimmed: SRR7168981-trimmed-pair1.fastq, SRR7168981-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:56:59 2025 >> started Mon Feb 10 13:57:14 2025 >> done (15.244s) 14623564 read pairs processed; of these: 17972 ( 0.12%) short read pairs filtered out after trimming by size control 14613 ( 0.10%) empty read pairs filtered out after trimming by size control 14590979 (99.78%) read pairs available; of these: 5810407 (39.82%) trimmed read pairs available after processing 8780572 (60.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 5 0.00% 21 6 0.00% 22 4 0.00% 23 7 0.00% 24 5 0.00% 25 8 0.00% 26 5 0.00% 27 7 0.00% 28 5 0.00% 29 3 0.00% 30 15 0.00% 31 4 0.00% 32 8 0.00% 33 5 0.00% 34 3 0.00% 35 7 0.00% 36 6 0.00% 37 8 0.00% 38 7 0.00% 39 14 0.00% 40 4 0.00% 41 3 0.00% 42 8 0.00% 43 12 0.00% 44 7 0.00% 45 5 0.00% 46 10 0.00% 47 11 0.00% 48 22 0.00% 49 14 0.00% 50 17 0.00% 51 20 0.00% 52 18 0.00% 53 20 0.00% 54 30 0.00% 55 24 0.00% 56 38 0.00% 57 37 0.00% 58 33 0.00% 59 28 0.00% 60 53 0.00% 61 58 0.00% 62 80 0.00% 63 87 0.00% 64 88 0.00% 65 100 0.00% 66 92 0.00% 67 117 0.00% 68 127 0.00% 69 174 0.00% 70 192 0.00% 71 178 0.00% 72 199 0.00% 73 241 0.00% 74 253 0.00% 75 322 0.00% 76 344 0.00% 77 399 0.00% 78 425 0.00% 79 510 0.00% 80 548 0.00% 81 709 0.00% 82 820 0.01% 83 906 0.01% 84 1608 0.01% 85 2106 0.01% 86 2351 0.02% 87 2420 0.02% 88 2529 0.02% 89 2503 0.02% 90 2658 0.02% 91 2741 0.02% 92 2936 0.02% 93 3223 0.02% 94 3385 0.02% 95 3758 0.03% 96 3908 0.03% 97 4116 0.03% 98 4222 0.03% 99 4785 0.03% 100 4931 0.03% 101 5176 0.04% 102 5663 0.04% 103 5973 0.04% 104 6538 0.04% 105 6936 0.05% 106 7338 0.05% 107 7820 0.05% 108 8239 0.06% 109 8650 0.06% 110 9185 0.06% 111 9764 0.07% 112 10444 0.07% 113 11479 0.08% 114 12087 0.08% 115 13157 0.09% 116 13890 0.10% 117 14501 0.10% 118 14953 0.10% 119 15759 0.11% 120 16739 0.11% 121 17452 0.12% 122 18724 0.13% 123 20003 0.14% 124 21499 0.15% 125 22962 0.16% 126 24734 0.17% 127 25879 0.18% 128 27075 0.19% 129 28120 0.19% 130 30015 0.21% 131 31780 0.22% 132 34168 0.23% 133 37054 0.25% 134 39863 0.27% 135 42750 0.29% 136 46516 0.32% 137 50009 0.34% 138 53518 0.37% 139 57950 0.40% 140 62895 0.43% 141 69279 0.47% 142 77838 0.53% 143 88468 0.61% 144 103067 0.71% 145 123176 0.84% 146 152528 1.05% 147 203222 1.39% 148 303929 2.08% 149 599761 4.11% 150 3130177 21.45% 151 8780572 60.18% 14590979 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=2.5 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=64.39 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.0 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=37 prefix-density=0.23 prefix-fanout=2.5 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.15 sequence-density-rank=10 fanout-score=39.04 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=10.6 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAG SRR7168981 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:58:00 Started mapping on | Feb 10 13:58:00 Finished on | Feb 10 13:59:16 Mapping speed, Million of reads per hour | 691.15 Number of input reads | 14590979 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13610527 Uniquely mapped reads % | 93.28% Average mapped length | 296.67 Number of splices: Total | 12122772 Number of splices: Annotated (sjdb) | 11920876 Number of splices: GT/AG | 11957550 Number of splices: GC/AG | 128661 Number of splices: AT/AC | 10344 Number of splices: Non-canonical | 26217 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 247109 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 66024 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.50% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 747957 747957 747957 N_multimapping 247109 247109 247109 N_noFeature 292312 13434969 350409 N_ambiguous 169559 746 51607 UnstrandedReadsAssigned:13148656 PositiveStrandReadsAssigned:174812 NegativeStrandReadsAssigned:13208511 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168981 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168981-trimmed-pair1.fastq SRR7168981-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,590,979 reads, 13,142,093 reads pseudoaligned [quant] estimated average fragment length: 256.851 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR7168981.ke.tsv 34699 SRR7168981.se.tsv 87100 total ==> SRR7168981.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.15 252 9.93961 Potri.005G024800.1.v4.1 1035 779.149 14 1.24888 Potri.004G059700.1.v4.1 961 705.184 9 0.887058 Potri.007G009000.2.v4.1 1416 1160.15 0 0 Potri.003G141000.2.v4.1 2943 2687.15 167.024 4.32014 Potri.016G087400.1.v4.1 270 68.3423 1111 1129.89 Potri.015G069301.1.v4.1 564 312.941 0 0 Potri.010G195200.1.v4.1 1773 1517.15 5 0.229062 Potri.012G127500.1.v4.1 977 721.161 3762 362.575 ==> SRR7168981.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1160 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 212 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168981 completed mapping pipeline successfully