Starting /dee2/code/volunteer_pipeline.sh SRR7168982 current disk space = 3059076915200 free memory = 1470117084 SRR7168982 SRAfilesize 0c5aff27933a21c308e737a04fc282a7 SRR7168982.sra SRR7168982.sra file validated SRR7168982 is paired end SRR7168982 is conventional basespace SRR7168982 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168982_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.00275 34.0 33.0 34.0 28.0 34.0 2 32.7795 34.0 33.0 34.0 28.0 34.0 3 33.002 34.0 33.0 34.0 32.0 34.0 4 33.19 34.0 33.0 34.0 32.0 34.0 5 33.1865 34.0 33.0 34.0 32.0 34.0 6 36.7915 38.0 37.0 38.0 35.0 38.0 7 37.12225 38.0 38.0 38.0 36.0 38.0 8 37.236 38.0 38.0 38.0 36.0 38.0 9 37.29625 38.0 38.0 38.0 37.0 38.0 10-14 37.33685 38.0 38.0 38.0 36.8 38.0 15-19 37.3077 38.0 38.0 38.0 37.0 38.0 20-24 37.29600000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.2761 38.0 38.0 38.0 36.8 38.0 30-34 37.2004 38.0 38.0 38.0 36.0 38.0 35-39 37.158100000000005 38.0 38.0 38.0 36.2 38.0 40-44 36.9383 38.0 38.0 38.0 35.6 38.0 45-49 36.774899999999995 38.0 38.0 38.0 34.8 38.0 50-54 36.69225 38.0 38.0 38.0 34.4 38.0 55-59 36.668850000000006 38.0 38.0 38.0 34.0 38.0 60-64 36.495349999999995 38.0 38.0 38.0 34.0 38.0 65-69 36.4731 38.0 37.8 38.0 34.0 38.0 70-74 36.394850000000005 38.0 37.0 38.0 33.8 38.0 75-79 36.2393 38.0 37.0 38.0 33.2 38.0 80-84 36.044200000000004 38.0 37.0 38.0 32.6 38.0 85-89 36.06725 38.0 37.0 38.0 33.0 38.0 90-94 35.873400000000004 38.0 37.0 38.0 31.2 38.0 95-99 35.526250000000005 38.0 36.4 38.0 29.6 38.0 100-104 35.1422 38.0 36.0 38.0 28.6 38.0 105-109 35.022749999999995 38.0 36.0 38.0 28.0 38.0 110-114 34.86385 38.0 35.4 38.0 27.2 38.0 115-119 34.48465 38.0 34.8 38.0 25.2 38.0 120-124 33.85645 38.0 34.0 38.0 21.6 38.0 125-129 33.4658 38.0 33.8 38.0 17.8 38.0 130-134 33.5327 38.0 34.0 38.0 20.2 38.0 135-139 32.92654999999999 38.0 33.2 38.0 15.0 38.0 140-144 32.20025 36.4 32.8 38.0 14.2 38.0 145-149 30.7418 36.0 30.6 38.0 8.6 38.0 150-151 27.038625000000003 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 2.0 14 3.0 15 3.0 16 2.0 17 3.0 18 5.0 19 8.0 20 8.0 21 8.0 22 9.0 23 19.0 24 18.0 25 23.0 26 28.0 27 28.0 28 50.0 29 55.0 30 68.0 31 100.0 32 147.0 33 186.0 34 246.0 35 441.0 36 956.0 37 1582.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.81896320171904 12.03330647327424 9.965081923180232 40.182648401826484 2 21.7 15.525 34.875 27.900000000000002 3 20.25 17.95 27.025 34.775 4 23.200000000000003 27.025 23.200000000000003 26.575 5 22.455613903475868 31.43285821455364 24.5311327831958 21.580395098774694 6 20.25 36.475 23.625 19.650000000000002 7 15.4 26.375 40.1 18.125 8 18.6 25.95 30.425 25.025 9 17.224999999999998 25.275 34.4 23.1 10-14 19.835 29.53 27.155 23.48 15-19 20.150000000000002 28.485 27.694999999999997 23.669999999999998 20-24 20.150000000000002 29.304999999999996 26.825 23.72 25-29 20.41 29.18 27.215 23.195 30-34 19.675 29.154999999999998 27.474999999999998 23.695 35-39 20.77 28.655 27.089999999999996 23.485 40-44 20.215 28.754999999999995 27.939999999999998 23.09 45-49 19.895 28.34 27.650000000000002 24.115000000000002 50-54 20.0 28.76 27.095000000000002 24.145 55-59 20.555 28.96 26.805 23.68 60-64 19.765 28.955 27.21 24.07 65-69 20.275000000000002 28.865000000000002 27.229999999999997 23.630000000000003 70-74 20.515 28.970000000000002 27.005000000000003 23.51 75-79 20.28 28.95 27.750000000000004 23.02 80-84 20.595 28.37 27.36 23.674999999999997 85-89 20.3 28.425 27.310000000000002 23.965 90-94 20.549999999999997 28.395 27.11 23.945 95-99 20.805 28.375 26.995 23.825 100-104 19.955000000000002 29.18 27.345000000000002 23.52 105-109 20.330000000000002 28.110000000000003 27.345000000000002 24.215 110-114 20.495 28.355000000000004 27.345000000000002 23.805 115-119 20.635 28.42 27.634999999999998 23.31 120-124 20.68 27.694999999999997 28.025 23.599999999999998 125-129 20.905 27.61 27.465 24.02 130-134 20.47 28.265 27.779999999999998 23.485 135-139 21.099999999999998 28.025 27.625 23.25 140-144 21.065 28.139999999999997 27.445000000000004 23.35 145-149 21.285 27.884999999999998 27.435 23.395 150-151 20.25 28.4125 26.937499999999996 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 2.0 24 2.0 25 2.0 26 4.0 27 6.0 28 10.5 29 12.0 30 15.0 31 25.0 32 27.5 33 36.0 34 50.5 35 62.5 36 83.0 37 112.0 38 136.0 39 153.0 40 175.0 41 207.0 42 238.5 43 267.5 44 278.0 45 276.0 46 279.5 47 265.0 48 239.5 49 202.5 50 169.5 51 147.5 52 118.0 53 98.0 54 81.0 55 62.5 56 47.5 57 31.0 58 22.0 59 15.0 60 8.5 61 6.0 62 5.0 63 3.5 64 2.5 65 2.5 66 2.0 67 2.5 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.925000000000001 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.8374999999999999 0.0 0.0 0.0 0.0 126-127 0.9125 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.3250000000000002 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.675 0.0 0.0 0.0 0.0 136-137 2.0625 0.0 0.0 0.0 0.0 138-139 2.2750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGGAT 10 0.0068396386 144.9375 8 >>END_MODULE SRR7168982 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168982_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6625 33.0 33.0 34.0 32.0 34.0 2 32.7915 33.0 33.0 34.0 32.0 34.0 3 32.7495 34.0 33.0 34.0 32.0 34.0 4 32.72875 34.0 33.0 34.0 32.0 34.0 5 32.75525 34.0 33.0 34.0 32.0 34.0 6 36.882 38.0 38.0 38.0 36.0 38.0 7 36.97125 38.0 38.0 38.0 36.0 38.0 8 36.98725 38.0 38.0 38.0 36.0 38.0 9 36.998 38.0 38.0 38.0 36.0 38.0 10-14 36.9338 38.0 38.0 38.0 36.0 38.0 15-19 36.9188 38.0 38.0 38.0 36.0 38.0 20-24 36.92015 38.0 38.0 38.0 36.0 38.0 25-29 36.780899999999995 38.0 38.0 38.0 35.8 38.0 30-34 36.669650000000004 38.0 38.0 38.0 35.4 38.0 35-39 36.7598 38.0 38.0 38.0 36.0 38.0 40-44 36.76615 38.0 38.0 38.0 35.8 38.0 45-49 36.6923 38.0 38.0 38.0 35.2 38.0 50-54 36.677049999999994 38.0 38.0 38.0 35.2 38.0 55-59 36.538850000000004 38.0 38.0 38.0 34.6 38.0 60-64 36.591449999999995 38.0 38.0 38.0 34.8 38.0 65-69 36.37179999999999 38.0 38.0 38.0 34.0 38.0 70-74 36.37455 38.0 38.0 38.0 34.0 38.0 75-79 36.33145 38.0 38.0 38.0 34.0 38.0 80-84 36.10945 38.0 38.0 38.0 33.4 38.0 85-89 35.99515 38.0 38.0 38.0 33.0 38.0 90-94 35.9455 38.0 38.0 38.0 33.0 38.0 95-99 35.651599999999995 38.0 37.2 38.0 30.2 38.0 100-104 35.47235 38.0 37.0 38.0 29.8 38.0 105-109 35.49115 38.0 37.0 38.0 30.2 38.0 110-114 35.2699 38.0 37.0 38.0 28.8 38.0 115-119 34.96915 38.0 36.0 38.0 27.8 38.0 120-124 34.9153 38.0 36.0 38.0 28.0 38.0 125-129 34.522149999999996 38.0 35.8 38.0 25.6 38.0 130-134 34.03435 38.0 35.0 38.0 22.2 38.0 135-139 33.7094 38.0 35.0 38.0 21.0 38.0 140-144 33.34545000000001 38.0 34.6 38.0 16.2 38.0 145-149 32.510749999999994 38.0 33.6 38.0 11.2 38.0 150-151 28.2625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 3.0 5 4.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 1.0 13 8.0 14 4.0 15 1.0 16 12.0 17 6.0 18 9.0 19 10.0 20 5.0 21 12.0 22 26.0 23 15.0 24 24.0 25 27.0 26 23.0 27 36.0 28 31.0 29 45.0 30 53.0 31 83.0 32 93.0 33 125.0 34 151.0 35 239.0 36 557.0 37 2382.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.243486973947896 20.86673346693387 14.679358717434871 30.210420841683366 2 27.004008016032067 26.302605210420843 30.160320641282567 16.53306613226453 3 20.716432865731463 28.557114228456914 30.335671342685373 20.390781563126254 4 24.19839679358717 31.738476953907817 24.874749498997996 19.188376753507015 5 24.949899799599198 34.66933867735471 23.071142284569138 17.30961923847695 6 21.296296296296298 37.33733733733734 23.94894894894895 17.417417417417415 7 19.344344344344343 21.47147147147147 39.214214214214216 19.96996996996997 8 21.67167167167167 26.926926926926924 27.2022022022022 24.1991991991992 9 21.371371371371374 26.326326326326328 29.504504504504503 22.7977977977978 10-14 23.23823823823824 28.873873873873872 25.885885885885884 22.002002002002 15-19 22.93793793793794 27.34234234234234 28.16816816816817 21.55155155155155 20-24 23.033033033033032 27.217217217217215 27.992992992992992 21.756756756756758 25-29 22.927927927927925 27.677677677677675 28.258258258258255 21.136136136136134 30-34 23.30830830830831 27.87787787787788 27.85785785785786 20.955955955955957 35-39 22.58258258258258 27.972972972972972 28.053053053053052 21.39139139139139 40-44 23.28828828828829 27.762762762762762 28.048048048048045 20.9009009009009 45-49 23.254417137994896 27.38375294058762 28.15956754592322 21.202262375494268 50-54 23.193193193193192 27.882882882882882 28.073073073073076 20.85085085085085 55-59 22.982982982982982 28.163163163163162 27.922922922922922 20.93093093093093 60-64 22.76776776776777 28.053053053053052 28.163163163163162 21.016016016016014 65-69 23.5096851694279 27.654036738575506 28.23464637869763 20.601631713298964 70-74 22.80122140461531 28.392651549281673 27.907093157130703 20.89903388897232 75-79 23.431946738749563 27.837012564449115 28.297542173499522 20.433498523301797 80-84 24.299158990788946 27.6431718061674 27.913496195434522 20.14417300760913 85-89 23.388065678814577 28.04865839006808 27.973568281938327 20.589707649179015 90-94 23.58830596716059 28.01862234681618 28.00861033239888 20.38446135362435 95-99 23.46433041301627 27.614518147684606 28.410513141426787 20.51063829787234 100-104 23.81476846057572 27.88986232790989 27.729662077596995 20.565707133917396 105-109 23.371877659308204 28.117334935175453 28.217450067577715 20.29333733793863 110-114 23.945142399519494 27.774162871014564 27.563942139246205 20.71675259021973 115-119 24.250312891113893 27.43929912390488 27.939924906132667 20.370463078848562 120-124 23.713456147376853 27.638165798958752 27.97857428914698 20.66980376451742 125-129 24.221643808189008 28.155971568725597 27.219941936129743 20.402442686955652 130-134 23.898678414096917 28.04865839006808 27.417901481778134 20.634761714056868 135-139 24.232867797967664 27.76192621514742 27.756920458527308 20.248285528357613 140-144 24.508184412073884 28.102317665315113 26.961005155929318 20.428492766681682 145-149 24.739687625150182 27.62815378454145 27.472967561073286 20.15919102923508 150-151 24.78728728728729 27.3023023023023 27.414914914914917 20.495495495495494 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.5 27 2.0 28 4.0 29 7.0 30 10.0 31 13.0 32 16.0 33 27.0 34 41.5 35 54.5 36 67.0 37 99.5 38 150.5 39 170.0 40 200.0 41 253.0 42 274.0 43 271.5 44 270.0 45 285.0 46 299.0 47 277.5 48 232.5 49 200.5 50 186.0 51 151.0 52 110.0 53 83.0 54 61.0 55 47.5 56 35.5 57 27.0 58 18.5 59 12.0 60 8.5 61 6.0 62 3.5 63 3.5 64 2.5 65 1.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.2 3 0.2 4 0.2 5 0.2 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.1 15-19 0.1 20-24 0.1 25-29 0.1 30-34 0.1 35-39 0.1 40-44 0.1 45-49 0.105 50-54 0.1 55-59 0.1 60-64 0.1 65-69 0.105 70-74 0.11499999999999999 75-79 0.11499999999999999 80-84 0.12 85-89 0.12 90-94 0.12 95-99 0.125 100-104 0.125 105-109 0.11499999999999999 110-114 0.105 115-119 0.125 120-124 0.12 125-129 0.11 130-134 0.12 135-139 0.11499999999999999 140-144 0.11499999999999999 145-149 0.12 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4528301886792453 0.8999999999999999 3 0.05031446540880503 0.15 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 1.05 0.0 0.0 0.0 0.0 130-131 1.2875 0.0 0.0 0.0 0.0 132-133 1.4375 0.0 0.0 0.0 0.0 134-135 1.65 0.0 0.0 0.0 0.0 136-137 2.075 0.0 0.0 0.0 0.0 138-139 2.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGAAC 10 0.006830828 145.0 5 TTGGCCG 10 0.006830828 145.0 4 >>END_MODULE Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038712 spots for SRR7168982.sra Written 1038712 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra Read 1038698 spots for SRR7168982.sra Written 1038698 spots for SRR7168982.sra SRR ids: ['SRR7168982.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8v4htbts SRR7168982.sra spots: 20773974 blocks: [[1, 1038698], [1038699, 2077396], [2077397, 3116094], [3116095, 4154792], [4154793, 5193490], [5193491, 6232188], [6232189, 7270886], [7270887, 8309584], [8309585, 9348282], [9348283, 10386980], [10386981, 11425678], [11425679, 12464376], [12464377, 13503074], [13503075, 14541772], [14541773, 15580470], [15580471, 16619168], [16619169, 17657866], [17657867, 18696564], [18696565, 19735262], [19735263, 20773974]] SRR7168982 file size 7017917 SRR7168982 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168982 SRR7168982_1.fastq SRR7168982_2.fastq Input file: SRR7168982_1.fastq Paired file: SRR7168982_2.fastq trimmed: SRR7168982-trimmed-pair1.fastq, SRR7168982-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:00:40 2025 >> started Mon Feb 10 14:01:04 2025 >> done (24.129s) 20773974 read pairs processed; of these: 25613 ( 0.12%) short read pairs filtered out after trimming by size control 68985 ( 0.33%) empty read pairs filtered out after trimming by size control 20679376 (99.54%) read pairs available; of these: 10159852 (49.13%) trimmed read pairs available after processing 10519524 (50.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 10 0.00% 23 5 0.00% 24 8 0.00% 25 7 0.00% 26 11 0.00% 27 7 0.00% 28 2 0.00% 29 5 0.00% 30 9 0.00% 31 7 0.00% 32 7 0.00% 33 8 0.00% 34 8 0.00% 35 7 0.00% 36 10 0.00% 37 15 0.00% 38 18 0.00% 39 20 0.00% 40 9 0.00% 41 17 0.00% 42 12 0.00% 43 17 0.00% 44 29 0.00% 45 23 0.00% 46 30 0.00% 47 20 0.00% 48 36 0.00% 49 37 0.00% 50 39 0.00% 51 41 0.00% 52 48 0.00% 53 56 0.00% 54 60 0.00% 55 76 0.00% 56 75 0.00% 57 92 0.00% 58 88 0.00% 59 97 0.00% 60 119 0.00% 61 140 0.00% 62 129 0.00% 63 172 0.00% 64 175 0.00% 65 204 0.00% 66 211 0.00% 67 253 0.00% 68 301 0.00% 69 285 0.00% 70 356 0.00% 71 375 0.00% 72 440 0.00% 73 455 0.00% 74 494 0.00% 75 586 0.00% 76 643 0.00% 77 745 0.00% 78 818 0.00% 79 964 0.00% 80 1079 0.01% 81 1219 0.01% 82 1387 0.01% 83 1697 0.01% 84 2652 0.01% 85 3358 0.02% 86 3420 0.02% 87 3441 0.02% 88 3670 0.02% 89 3760 0.02% 90 3947 0.02% 91 4306 0.02% 92 4673 0.02% 93 4967 0.02% 94 5211 0.03% 95 5305 0.03% 96 5584 0.03% 97 6135 0.03% 98 6330 0.03% 99 6950 0.03% 100 7356 0.04% 101 7885 0.04% 102 8452 0.04% 103 8910 0.04% 104 9581 0.05% 105 10529 0.05% 106 11133 0.05% 107 11890 0.06% 108 12474 0.06% 109 13435 0.06% 110 13956 0.07% 111 15004 0.07% 112 16175 0.08% 113 17304 0.08% 114 18597 0.09% 115 19849 0.10% 116 21234 0.10% 117 22122 0.11% 118 23618 0.11% 119 25357 0.12% 120 26539 0.13% 121 27826 0.13% 122 29790 0.14% 123 32096 0.16% 124 34724 0.17% 125 36885 0.18% 126 39432 0.19% 127 42218 0.20% 128 45363 0.22% 129 47804 0.23% 130 51541 0.25% 131 54946 0.27% 132 58700 0.28% 133 62971 0.30% 134 68004 0.33% 135 73652 0.36% 136 79811 0.39% 137 85865 0.42% 138 94113 0.46% 139 103312 0.50% 140 115103 0.56% 141 129349 0.63% 142 145657 0.70% 143 168001 0.81% 144 195334 0.94% 145 238823 1.15% 146 301734 1.46% 147 411311 1.99% 148 626776 3.03% 149 1211433 5.86% 150 5137840 24.85% 151 10519524 50.87% 20679376 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=41 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.15 sequence-density-rank=3 fanout-score=73.04 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=15.1 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=35 prefix-density=0.27 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=58.07 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=11.6 sequence=AGAAAATGGAAACCTTTCTATTCAC SRR7168982 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:01:50 Started mapping on | Feb 10 14:01:51 Finished on | Feb 10 14:04:26 Mapping speed, Million of reads per hour | 480.30 Number of input reads | 20679376 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19603676 Uniquely mapped reads % | 94.80% Average mapped length | 295.94 Number of splices: Total | 18385160 Number of splices: Annotated (sjdb) | 18089597 Number of splices: GT/AG | 18124305 Number of splices: GC/AG | 206165 Number of splices: AT/AC | 14643 Number of splices: Non-canonical | 40047 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366263 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 73588 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 729323 729323 729323 N_multimapping 366263 366263 366263 N_noFeature 427860 19368965 538735 N_ambiguous 207381 1135 82679 UnstrandedReadsAssigned:18968435 PositiveStrandReadsAssigned:233576 NegativeStrandReadsAssigned:18982262 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168982 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168982-trimmed-pair1.fastq SRR7168982-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,679,376 reads, 18,883,972 reads pseudoaligned [quant] estimated average fragment length: 259.446 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7168982.ke.tsv 34699 SRR7168982.se.tsv 87100 total ==> SRR7168982.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.55 308 8.89822 Potri.005G024800.1.v4.1 1035 776.554 30 1.96383 Potri.004G059700.1.v4.1 961 702.605 4 0.289403 Potri.007G009000.2.v4.1 1416 1157.55 0 0 Potri.003G141000.2.v4.1 2943 2684.55 319.065 6.04173 Potri.016G087400.1.v4.1 270 68.0409 1536 1147.56 Potri.015G069301.1.v4.1 564 311.488 0 0 Potri.010G195200.1.v4.1 1773 1514.55 20 0.671274 Potri.012G127500.1.v4.1 977 718.56 5248 371.267 ==> SRR7168982.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1919 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 369 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 41 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168982 completed mapping pipeline successfully