Starting /dee2/code/volunteer_pipeline.sh SRR7168983 current disk space = 3058972827648 free memory = 1186651764 SRR7168983 SRAfilesize 789fc63a0c778c49b5fc3acef3948bcf SRR7168983.sra SRR7168983.sra file validated SRR7168983 is paired end SRR7168983 is conventional basespace SRR7168983 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168983_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66925 34.0 33.0 34.0 32.0 34.0 2 33.20375 34.0 33.0 34.0 32.0 34.0 3 33.16025 34.0 33.0 34.0 32.0 34.0 4 33.17775 34.0 33.0 34.0 32.0 34.0 5 33.19375 34.0 33.0 34.0 32.0 34.0 6 36.9885 38.0 37.0 38.0 36.0 38.0 7 37.26675 38.0 38.0 38.0 37.0 38.0 8 37.383 38.0 38.0 38.0 37.0 38.0 9 37.458 38.0 38.0 38.0 37.0 38.0 10-14 37.467349999999996 38.0 38.0 38.0 37.4 38.0 15-19 37.3331 38.0 38.0 38.0 37.0 38.0 20-24 37.244150000000005 38.0 38.0 38.0 36.6 38.0 25-29 37.181149999999995 38.0 38.0 38.0 36.2 38.0 30-34 37.08765 38.0 38.0 38.0 36.0 38.0 35-39 37.00265 38.0 38.0 38.0 35.6 38.0 40-44 36.822649999999996 38.0 38.0 38.0 35.2 38.0 45-49 36.87329999999999 38.0 38.0 38.0 35.2 38.0 50-54 36.88495 38.0 38.0 38.0 35.2 38.0 55-59 36.58925000000001 38.0 38.0 38.0 34.2 38.0 60-64 36.65105 38.0 38.0 38.0 34.0 38.0 65-69 36.67175 38.0 38.0 38.0 34.2 38.0 70-74 36.63895 38.0 38.0 38.0 34.0 38.0 75-79 36.542950000000005 38.0 37.8 38.0 34.0 38.0 80-84 35.938300000000005 38.0 37.0 38.0 32.0 38.0 85-89 35.85515 38.0 37.0 38.0 32.0 38.0 90-94 35.562799999999996 38.0 36.6 38.0 30.0 38.0 95-99 35.39955 38.0 36.6 38.0 29.4 38.0 100-104 35.347249999999995 38.0 36.0 38.0 29.0 38.0 105-109 35.354049999999994 38.0 36.0 38.0 29.4 38.0 110-114 34.914049999999996 38.0 35.4 38.0 27.4 38.0 115-119 34.544850000000004 38.0 34.8 38.0 25.6 38.0 120-124 34.178250000000006 38.0 34.2 38.0 23.6 38.0 125-129 33.31965 38.0 33.6 38.0 18.2 38.0 130-134 32.68375 37.4 32.2 38.0 17.2 38.0 135-139 33.24145 38.0 33.8 38.0 18.6 38.0 140-144 32.8707 38.0 33.2 38.0 14.4 38.0 145-149 31.867699999999996 37.6 31.8 38.0 11.2 38.0 150-151 27.294125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 2.0 16 2.0 17 1.0 18 7.0 19 10.0 20 7.0 21 6.0 22 4.0 23 12.0 24 13.0 25 18.0 26 28.0 27 55.0 28 34.0 29 62.0 30 76.0 31 96.0 32 126.0 33 184.0 34 263.0 35 421.0 36 878.0 37 1689.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.134571355889086 13.32994149071483 9.564996184177055 35.97049096921903 2 23.125 16.925 33.75 26.200000000000003 3 18.45 23.075000000000003 28.475 30.0 4 21.375 30.75 23.075000000000003 24.8 5 20.280070017504375 35.783945986496626 23.305826456614152 20.630157539384847 6 19.25 35.025 25.224999999999998 20.5 7 14.05 25.724999999999998 41.925000000000004 18.3 8 17.925 26.35 29.299999999999997 26.424999999999997 9 18.75 24.875 31.8 24.575 10-14 19.755 29.87 26.534999999999997 23.84 15-19 19.675 28.389999999999997 28.115000000000002 23.82 20-24 19.744999999999997 29.15 27.034999999999997 24.07 25-29 20.035 29.565 26.619999999999997 23.78 30-34 19.869999999999997 28.77 27.389999999999997 23.97 35-39 19.979994998749685 28.93223305826457 27.286821705426355 23.80095023755939 40-44 20.655 28.849999999999998 26.995 23.5 45-49 20.408061209181376 28.244236635495323 27.064059608941342 24.283642546381955 50-54 20.28 29.01 26.724999999999998 23.985 55-59 20.415 28.76 26.924999999999997 23.9 60-64 20.62 28.244999999999997 27.275 23.86 65-69 19.915 29.065 26.83 24.19 70-74 20.22101105055253 28.496424821241064 27.1863593179659 24.09620481024051 75-79 20.27 28.705000000000002 26.97 24.055 80-84 20.379479971890373 29.09848408794298 26.478265234414216 24.043770705752436 85-89 20.440740926660308 28.402188645148335 27.348024697555346 23.80904573063601 90-94 20.608887551409367 28.33784732671281 27.25448891563848 23.798776206239342 95-99 20.705089519211427 28.273989136994572 26.956346811506737 24.064574532287267 100-104 20.353094593239042 28.77420002006219 27.184271240846623 23.688434145852142 105-109 20.612449799196785 28.24799196787149 26.947791164658636 24.191767068273094 110-114 20.312970207643698 28.66887350787441 27.204333433644294 23.813822850837596 115-119 20.713354068425804 28.40373231664493 27.144577104444668 23.738336510484597 120-124 20.77 28.305000000000003 27.084999999999997 23.84 125-129 21.10459580013031 28.34160276650128 26.823034130205986 23.73076730316243 130-134 20.32565408075818 28.356102233200588 27.378131773957755 23.94011191208348 135-139 20.982862903225808 27.691532258064516 27.26310483870968 24.0625 140-144 21.249937352779032 27.705107001453417 27.32922367563775 23.715731970129806 145-149 20.74626114104436 28.093056045118082 27.25212749886701 23.908555314970542 150-151 20.727728983688834 27.61606022584693 27.214554579673777 24.441656210790462 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.5 24 4.0 25 3.5 26 3.5 27 6.5 28 9.0 29 14.5 30 19.0 31 24.5 32 31.5 33 44.0 34 55.5 35 72.0 36 83.0 37 93.5 38 114.5 39 138.0 40 180.0 41 210.0 42 224.0 43 246.0 44 274.0 45 288.0 46 284.0 47 260.5 48 223.0 49 208.0 50 195.5 51 162.0 52 133.0 53 100.5 54 70.5 55 57.5 56 43.0 57 31.5 58 21.5 59 13.0 60 10.5 61 6.5 62 6.5 63 7.5 64 5.0 65 5.0 66 4.5 67 2.0 68 2.5 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.0 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.38999999999999996 85-89 0.395 90-94 0.31 95-99 0.58 100-104 0.31 105-109 0.4 110-114 0.31 115-119 0.33 120-124 0.0 125-129 0.23500000000000001 130-134 0.815 135-139 0.8 140-144 0.23500000000000001 145-149 0.705 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.6000000000000001 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.7749999999999999 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 0.9624999999999999 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.2374999999999998 0.0 0.0 0.0 0.0 128-129 1.3875000000000002 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.725 0.0 0.0 0.0 0.0 134-135 1.8875 0.0 0.0 0.0 0.0 136-137 2.0625 0.0 0.0 0.0 0.0 138-139 2.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCCAA 10 0.0069664107 144.05 5 AAGAAAC 10 0.0069664107 144.05 3 >>END_MODULE SRR7168983 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168983_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.991 33.0 33.0 34.0 32.0 34.0 2 33.01075 34.0 33.0 34.0 32.0 34.0 3 33.02925 34.0 33.0 34.0 32.0 34.0 4 33.0165 34.0 33.0 34.0 32.0 34.0 5 32.99 34.0 33.0 34.0 32.0 34.0 6 36.9745 38.0 38.0 38.0 37.0 38.0 7 36.85175 38.0 38.0 38.0 36.0 38.0 8 36.489 38.0 38.0 38.0 36.0 38.0 9 36.79325 38.0 38.0 38.0 36.0 38.0 10-14 36.1754 38.0 38.0 38.0 34.0 38.0 15-19 35.99165000000001 38.0 38.0 38.0 34.6 38.0 20-24 36.29205 38.0 38.0 38.0 35.0 38.0 25-29 36.5634 38.0 38.0 38.0 35.4 38.0 30-34 36.5171 38.0 38.0 38.0 36.0 38.0 35-39 36.63415 38.0 38.0 38.0 36.0 38.0 40-44 36.6699 38.0 38.0 38.0 36.0 38.0 45-49 36.667049999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.06645000000001 38.0 38.0 38.0 34.2 38.0 55-59 35.286249999999995 38.0 38.0 38.0 30.0 38.0 60-64 35.38720000000001 38.0 38.0 38.0 30.6 38.0 65-69 35.718300000000006 38.0 38.0 38.0 33.0 38.0 70-74 35.47695 38.0 38.0 38.0 31.0 38.0 75-79 35.4177 38.0 38.0 38.0 30.2 38.0 80-84 35.6098 38.0 38.0 38.0 33.0 38.0 85-89 35.63719999999999 38.0 38.0 38.0 33.2 38.0 90-94 35.448699999999995 38.0 38.0 38.0 32.2 38.0 95-99 35.340500000000006 38.0 38.0 38.0 30.8 38.0 100-104 34.9302 38.0 37.4 38.0 28.6 38.0 105-109 34.891200000000005 38.0 37.2 38.0 27.8 38.0 110-114 34.62825 38.0 37.0 38.0 26.0 38.0 115-119 34.509699999999995 38.0 36.8 38.0 24.6 38.0 120-124 34.6212 38.0 36.6 38.0 26.6 38.0 125-129 34.41355 38.0 36.0 38.0 25.2 38.0 130-134 33.99495 38.0 35.6 38.0 21.6 38.0 135-139 33.34755 38.0 35.0 38.0 16.0 38.0 140-144 33.060500000000005 38.0 34.6 38.0 14.2 38.0 145-149 32.31825 38.0 33.8 38.0 8.8 38.0 150-151 28.585375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 23.0 4 4.0 5 1.0 6 0.0 7 5.0 8 18.0 9 7.0 10 18.0 11 28.0 12 11.0 13 1.0 14 3.0 15 5.0 16 3.0 17 8.0 18 8.0 19 12.0 20 7.0 21 10.0 22 12.0 23 16.0 24 23.0 25 21.0 26 25.0 27 42.0 28 36.0 29 36.0 30 55.0 31 58.0 32 83.0 33 85.0 34 140.0 35 220.0 36 450.0 37 2518.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.875 21.625 13.350000000000001 26.150000000000002 2 25.324999999999996 27.0 31.574999999999996 16.1 3 19.925 28.449999999999996 30.825000000000003 20.8 4 22.1 35.449999999999996 22.95 19.5 5 23.905976494123532 34.7586896724181 22.155538884721178 19.179794948737182 6 20.750938673341675 36.195244055068834 23.57947434292866 19.474342928660825 7 19.749058971141782 22.158092848180676 38.46925972396487 19.623588456712675 8 21.200607902735563 26.266464032421478 26.089159067882473 26.443768996960486 9 21.00650976464697 24.486730095142715 29.969954932398597 24.536805207811717 10-14 23.699333774093475 27.671260743528453 26.272694909220363 22.356710573157706 15-19 23.22822514379622 27.408586688578474 28.029991783073132 21.333196384552178 20-24 23.095623987034035 28.211102106969204 27.572933549432737 21.120340356564018 25-29 23.102723267921505 28.088706447737284 27.13255907088506 21.67601121345615 30-34 23.313657232228444 28.111598809343626 27.571767317491545 21.00297664093638 35-39 23.361150211140156 28.292781017494473 27.39794892419063 20.94811984717474 40-44 23.370165745856355 28.176795580110497 27.72978402812657 20.72325464590658 45-49 23.544774245391995 27.477273868715784 27.56265380945206 21.41529807644016 50-54 23.208643359494445 27.96351034553053 27.484456222607278 21.34339007236775 55-59 23.90448565212887 26.991608826271623 28.364239096653893 20.739666424945614 60-64 23.72574385510996 27.52393272962484 28.129366106080205 20.62095730918499 65-69 23.72803666921314 27.955182072829132 28.062133944486884 20.25464731347084 70-74 23.232685702568308 27.774644999231047 27.825908648177577 21.16676065002307 75-79 23.486980099247965 26.909500179055613 28.904691256970377 20.698828464726045 80-84 23.12103215236535 27.76469383575671 28.194757321318864 20.91951669055908 85-89 23.564538355535138 27.591486755473895 27.61700607359771 21.226968815393253 90-94 23.639255117221566 27.75355255732827 28.076745498384035 20.530446827066125 95-99 23.64607170099161 27.887109077040428 28.115942028985508 20.350877192982455 100-104 23.58451506055274 27.1141703757375 28.206189835420766 21.095124728288997 105-109 23.7125012798198 27.38814374936009 27.705539060100335 21.19381591071977 110-114 24.00948013808027 27.317223968262144 27.883971353495802 20.78932454016178 115-119 24.53130617905388 27.387128255174893 27.62340130463814 20.45816426113308 120-124 24.15297220531548 27.317914384256444 27.754108338405352 20.775005072022722 125-129 23.789708718156906 27.53476098650157 28.427889982746375 20.24764031259515 130-134 24.46389272736578 26.766978862787244 28.38937509596192 20.37975331388505 135-139 24.419613245573753 26.94015000765345 27.526914638501964 21.11332210827083 140-144 24.16935159081756 27.894683850181234 27.27043898509867 20.66552557390254 145-149 24.344531447335186 26.799696893154838 28.16872947714069 20.687042182369286 150-151 24.76105518032369 26.965719383203773 27.462724608130497 20.81050082834204 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 1.0 8 2.5 9 3.0 10 2.5 11 3.0 12 4.0 13 4.5 14 6.5 15 6.0 16 5.5 17 7.5 18 4.5 19 2.5 20 2.5 21 3.0 22 4.0 23 4.0 24 4.5 25 3.5 26 5.5 27 6.5 28 6.5 29 10.0 30 14.0 31 16.5 32 23.0 33 38.0 34 46.5 35 55.0 36 71.5 37 87.0 38 120.0 39 156.0 40 182.0 41 217.0 42 234.0 43 256.0 44 296.0 45 308.5 46 288.5 47 263.0 48 239.5 49 202.5 50 174.5 51 148.5 52 123.5 53 99.0 54 68.5 55 45.0 56 29.5 57 25.0 58 19.5 59 13.5 60 9.0 61 5.5 62 5.0 63 5.5 64 4.5 65 2.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.125 7 0.375 8 1.3 9 0.15 10-14 1.685 15-19 2.64 20-24 1.28 25-29 0.12 30-34 0.895 35-39 0.54 40-44 0.44999999999999996 45-49 0.445 50-54 1.8900000000000001 55-59 3.47 60-64 3.375 65-69 1.825 70-74 2.465 75-79 2.265 80-84 2.34 85-89 2.035 90-94 2.535 95-99 1.675 100-104 3.39 105-109 2.33 110-114 2.955 115-119 2.6550000000000002 120-124 1.4200000000000002 125-129 1.47 130-134 2.305 135-139 2.005 140-144 0.6799999999999999 145-149 1.0250000000000001 150-151 1.9124999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7125 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 0.9874999999999999 0.0 0.0 0.0 0.0 126-127 1.1625 0.0 0.0 0.0 0.0 128-129 1.2999999999999998 0.0 0.0 0.0 0.0 130-131 1.4625 0.0 0.0 0.0 0.0 132-133 1.625 0.0 0.0 0.0 0.0 134-135 1.7875 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAAAT 10 0.0071151713 143.01266 1 >>END_MODULE Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822711 spots for SRR7168983.sra Written 822711 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra Read 822701 spots for SRR7168983.sra Written 822701 spots for SRR7168983.sra SRR ids: ['SRR7168983.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zyvl8hih SRR7168983.sra spots: 16454030 blocks: [[1, 822701], [822702, 1645402], [1645403, 2468103], [2468104, 3290804], [3290805, 4113505], [4113506, 4936206], [4936207, 5758907], [5758908, 6581608], [6581609, 7404309], [7404310, 8227010], [8227011, 9049711], [9049712, 9872412], [9872413, 10695113], [10695114, 11517814], [11517815, 12340515], [12340516, 13163216], [13163217, 13985917], [13985918, 14808618], [14808619, 15631319], [15631320, 16454030]] SRR7168983 file size 5554030 SRR7168983 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168983 SRR7168983_1.fastq SRR7168983_2.fastq Input file: SRR7168983_1.fastq Paired file: SRR7168983_2.fastq trimmed: SRR7168983-trimmed-pair1.fastq, SRR7168983-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:12:46 2025 >> started Mon Feb 10 14:13:12 2025 >> done (26.187s) 16454030 read pairs processed; of these: 34682 ( 0.21%) short read pairs filtered out after trimming by size control 22264 ( 0.14%) empty read pairs filtered out after trimming by size control 16397084 (99.65%) read pairs available; of these: 6998454 (42.68%) trimmed read pairs available after processing 9398630 (57.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 3 0.00% 21 6 0.00% 22 5 0.00% 23 2 0.00% 24 4 0.00% 25 6 0.00% 26 5 0.00% 27 8 0.00% 28 4 0.00% 29 8 0.00% 30 7 0.00% 31 3 0.00% 32 5 0.00% 33 9 0.00% 34 8 0.00% 35 4 0.00% 36 10 0.00% 37 5 0.00% 38 6 0.00% 39 6 0.00% 40 8 0.00% 41 10 0.00% 42 5 0.00% 43 13 0.00% 44 10 0.00% 45 12 0.00% 46 17 0.00% 47 17 0.00% 48 18 0.00% 49 15 0.00% 50 16 0.00% 51 29 0.00% 52 17 0.00% 53 26 0.00% 54 31 0.00% 55 36 0.00% 56 35 0.00% 57 37 0.00% 58 32 0.00% 59 51 0.00% 60 59 0.00% 61 56 0.00% 62 78 0.00% 63 85 0.00% 64 93 0.00% 65 103 0.00% 66 116 0.00% 67 135 0.00% 68 147 0.00% 69 163 0.00% 70 168 0.00% 71 189 0.00% 72 218 0.00% 73 260 0.00% 74 278 0.00% 75 315 0.00% 76 353 0.00% 77 399 0.00% 78 511 0.00% 79 527 0.00% 80 612 0.00% 81 749 0.00% 82 762 0.00% 83 1052 0.01% 84 2016 0.01% 85 2411 0.01% 86 2549 0.02% 87 2534 0.02% 88 2759 0.02% 89 2664 0.02% 90 2782 0.02% 91 2876 0.02% 92 3237 0.02% 93 3155 0.02% 94 3324 0.02% 95 3521 0.02% 96 3802 0.02% 97 3947 0.02% 98 4232 0.03% 99 4418 0.03% 100 5246 0.03% 101 5371 0.03% 102 5548 0.03% 103 5738 0.03% 104 6084 0.04% 105 6626 0.04% 106 6979 0.04% 107 7265 0.04% 108 7994 0.05% 109 8115 0.05% 110 8614 0.05% 111 9327 0.06% 112 9819 0.06% 113 10510 0.06% 114 11317 0.07% 115 11881 0.07% 116 12707 0.08% 117 13297 0.08% 118 13976 0.09% 119 14774 0.09% 120 15201 0.09% 121 16222 0.10% 122 17675 0.11% 123 18724 0.11% 124 20075 0.12% 125 21795 0.13% 126 23665 0.14% 127 24240 0.15% 128 25533 0.16% 129 27396 0.17% 130 29309 0.18% 131 31491 0.19% 132 33910 0.21% 133 36766 0.22% 134 39754 0.24% 135 43032 0.26% 136 47052 0.29% 137 50880 0.31% 138 55563 0.34% 139 61122 0.37% 140 67090 0.41% 141 75028 0.46% 142 85400 0.52% 143 99604 0.61% 144 119106 0.73% 145 144636 0.88% 146 184260 1.12% 147 257838 1.57% 148 391826 2.39% 149 776371 4.73% 150 3918490 23.90% 151 9398630 57.32% 16397084 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.16 sequence-density-rank=6 fanout-score=74.86 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=16.0 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.59 fanout-score-rank=15 prefix-density=0.31 prefix-fanout=4.0 sequence=CAGTTTGTTGACTGGTGCCC criterion=fanout-score sequence-density=0.16 sequence-density-rank=11 fanout-score=42.85 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=12.2 sequence=TGTTGGTGGTGG SRR7168983 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:13:58 Started mapping on | Feb 10 14:13:58 Finished on | Feb 10 14:15:24 Mapping speed, Million of reads per hour | 686.39 Number of input reads | 16397084 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15572001 Uniquely mapped reads % | 94.97% Average mapped length | 297.03 Number of splices: Total | 15121339 Number of splices: Annotated (sjdb) | 14888569 Number of splices: GT/AG | 14906828 Number of splices: GC/AG | 172149 Number of splices: AT/AC | 11117 Number of splices: Non-canonical | 31245 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291750 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 28561 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.05% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 556218 556218 556218 N_multimapping 291750 291750 291750 N_noFeature 305664 15400896 374169 N_ambiguous 165476 872 62221 UnstrandedReadsAssigned:15100861 PositiveStrandReadsAssigned:170233 NegativeStrandReadsAssigned:15135611 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168983 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168983-trimmed-pair1.fastq SRR7168983-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,397,084 reads, 15,041,319 reads pseudoaligned [quant] estimated average fragment length: 263.838 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR7168983.ke.tsv 34699 SRR7168983.se.tsv 87100 total ==> SRR7168983.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.16 278 9.96814 Potri.005G024800.1.v4.1 1035 772.162 29 2.36361 Potri.004G059700.1.v4.1 961 698.236 5 0.450665 Potri.007G009000.2.v4.1 1416 1153.16 0 0 Potri.003G141000.2.v4.1 2943 2680.16 248.025 5.824 Potri.016G087400.1.v4.1 270 65.5311 1287.87 1236.83 Potri.015G069301.1.v4.1 564 306.854 0 0 Potri.010G195200.1.v4.1 1773 1510.16 15 0.625107 Potri.012G127500.1.v4.1 977 714.214 5186 456.973 ==> SRR7168983.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1483 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 268 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168983 completed mapping pipeline successfully