Starting /dee2/code/volunteer_pipeline.sh SRR7168984 current disk space = 3059080093696 free memory = 1347942908 SRR7168984 SRAfilesize 92f962e11ad39ede059f7bc2b9651f9f SRR7168984.sra SRR7168984.sra file validated SRR7168984 is paired end SRR7168984 is conventional basespace SRR7168984 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168984_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59825 34.0 33.0 34.0 32.0 34.0 2 33.09825 34.0 33.0 34.0 32.0 34.0 3 33.09625 34.0 33.0 34.0 32.0 34.0 4 33.09325 34.0 33.0 34.0 32.0 34.0 5 33.07275 34.0 33.0 34.0 32.0 34.0 6 36.86375 38.0 37.0 38.0 35.0 38.0 7 37.19675 38.0 38.0 38.0 36.0 38.0 8 37.2915 38.0 38.0 38.0 37.0 38.0 9 37.4035 38.0 38.0 38.0 37.0 38.0 10-14 37.40145 38.0 38.0 38.0 37.0 38.0 15-19 37.302200000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.1734 38.0 38.0 38.0 36.0 38.0 25-29 37.10934999999999 38.0 38.0 38.0 36.0 38.0 30-34 37.0437 38.0 38.0 38.0 36.0 38.0 35-39 36.9184 38.0 38.0 38.0 35.4 38.0 40-44 36.754999999999995 38.0 38.0 38.0 35.0 38.0 45-49 36.80335 38.0 38.0 38.0 35.0 38.0 50-54 36.781850000000006 38.0 38.0 38.0 34.8 38.0 55-59 36.513099999999994 38.0 38.0 38.0 34.0 38.0 60-64 36.575649999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.5931 38.0 38.0 38.0 34.0 38.0 70-74 36.52265 38.0 38.0 38.0 34.0 38.0 75-79 36.32375 38.0 37.2 38.0 33.8 38.0 80-84 35.739 38.0 36.8 38.0 30.8 38.0 85-89 35.645300000000006 38.0 37.0 38.0 30.6 38.0 90-94 35.3307 38.0 36.4 38.0 29.0 38.0 95-99 35.372749999999996 38.0 36.4 38.0 29.4 38.0 100-104 35.05409999999999 38.0 36.0 38.0 28.2 38.0 105-109 35.21235 38.0 36.0 38.0 28.8 38.0 110-114 34.77185000000001 38.0 35.2 38.0 27.0 38.0 115-119 34.4748 38.0 35.0 38.0 25.4 38.0 120-124 34.05815 37.8 34.0 38.0 23.4 38.0 125-129 33.09705 37.4 33.2 38.0 17.4 38.0 130-134 32.5433 37.2 32.2 38.0 16.0 38.0 135-139 33.045300000000005 38.0 34.0 38.0 17.4 38.0 140-144 32.83015 38.0 33.2 38.0 14.4 38.0 145-149 31.68475 37.0 31.8 38.0 11.2 38.0 150-151 26.905 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 0.0 15 3.0 16 5.0 17 7.0 18 4.0 19 14.0 20 7.0 21 10.0 22 17.0 23 12.0 24 18.0 25 25.0 26 30.0 27 40.0 28 47.0 29 59.0 30 83.0 31 90.0 32 113.0 33 196.0 34 230.0 35 435.0 36 906.0 37 1646.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.4147582697201 12.162849872773537 9.363867684478372 39.05852417302799 2 21.425 15.425 34.949999999999996 28.199999999999996 3 20.05 20.349999999999998 27.275 32.324999999999996 4 22.325 29.45 22.85 25.374999999999996 5 22.566925193895422 32.874655991994 24.54340755566675 20.01501125844383 6 19.175 36.325 25.15 19.35 7 14.649999999999999 26.575 40.65 18.125 8 18.675 24.675 32.125 24.525 9 17.1 25.05 33.225 24.625 10-14 19.975 29.970000000000002 26.305 23.75 15-19 19.7 29.134999999999998 27.084999999999997 24.08 20-24 20.01 28.7 27.74 23.549999999999997 25-29 20.285 28.735 27.185 23.794999999999998 30-34 20.595 28.525 27.51 23.369999999999997 35-39 19.776921922672937 28.625018756564796 27.659680888310913 23.93837843245136 40-44 19.725 28.544999999999998 27.534999999999997 24.195 45-49 20.03400680136027 28.760752150430086 27.38047609521904 23.8247649529906 50-54 19.86 29.354999999999997 27.275 23.51 55-59 20.24 28.815 27.015 23.93 60-64 20.25 28.389999999999997 27.439999999999998 23.919999999999998 65-69 20.225 28.849999999999998 27.49 23.435 70-74 20.219043808761754 28.870774154830965 27.15543108621724 23.754750950190036 75-79 20.285 28.76 27.12 23.835 80-84 20.141573372157236 29.509513529795672 27.149957327175063 23.198955770872033 85-89 20.202831609599357 29.1946982628778 26.799879505974495 23.802590621548347 90-94 20.125439036628197 28.449573507275467 27.385850476668338 24.039136979427997 95-99 19.935610443181247 28.945117963680268 27.17943558529101 23.939836007847475 100-104 20.47757600080265 27.952242399919736 27.75659676933882 23.813584829938797 105-109 20.470978108053824 28.56497288612171 27.46033340028118 23.50371560554328 110-114 20.21970304975923 28.6115569823435 27.3876404494382 23.78109951845907 115-119 20.139516209976914 28.209374686339455 27.230753789019374 24.420355314664256 120-124 20.991049552477623 28.271413570678533 27.371368568428423 23.36616830841542 125-129 20.622899844525804 28.542053262450473 27.52394804152666 23.311098851497068 130-134 20.81336091629245 28.381855794944244 27.105302992078308 23.699480296685 135-139 20.918856220686873 28.211205809672702 27.560643501941602 23.309294467698823 140-144 20.658712652897535 28.519149789452573 26.8748746741528 23.947262883497093 145-149 20.34359413572472 28.32384502997632 27.396846188724872 23.935714645574084 150-151 20.59192375219463 28.091296714321544 27.22598444946075 24.090795084023075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.5 24 1.0 25 3.5 26 6.0 27 8.0 28 8.0 29 10.0 30 16.0 31 23.5 32 31.0 33 50.0 34 65.5 35 71.5 36 97.5 37 117.0 38 132.5 39 154.0 40 175.0 41 197.0 42 237.0 43 256.5 44 257.5 45 270.0 46 273.5 47 266.5 48 231.5 49 203.5 50 181.0 51 144.5 52 118.5 53 98.0 54 79.5 55 60.5 56 38.5 57 31.0 58 23.5 59 13.0 60 12.0 61 11.5 62 7.0 63 4.0 64 3.0 65 2.5 66 1.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.034999999999999996 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.02 75-79 0.0 80-84 0.40499999999999997 85-89 0.41000000000000003 90-94 0.35000000000000003 95-99 0.605 100-104 0.33 105-109 0.42 110-114 0.32 115-119 0.37 120-124 0.005 125-129 0.305 130-134 0.905 135-139 0.855 140-144 0.26 145-149 0.755 150-151 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.824517422913 99.55000000000001 2 0.1504136375031336 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0250689395838556 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAAATCTCGTATGC 6 0.15 TruSeq Adapter, Index 19 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.7625 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.0499999999999998 0.0 0.0 0.0 0.0 128-129 1.1625 0.0 0.0 0.0 0.0 130-131 1.3125 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.65 0.0 0.0 0.0 0.0 136-137 1.8125 0.0 0.0 0.0 0.0 138-139 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGGCT 10 0.007059411 143.41249 3 >>END_MODULE SRR7168984 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168984_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.969 33.0 33.0 34.0 32.0 34.0 2 33.021 34.0 33.0 34.0 32.0 34.0 3 33.02775 34.0 33.0 34.0 32.0 34.0 4 32.95625 34.0 33.0 34.0 32.0 34.0 5 32.96475 34.0 33.0 34.0 32.0 34.0 6 36.90075 38.0 38.0 38.0 36.0 38.0 7 36.82625 38.0 38.0 38.0 36.0 38.0 8 36.4355 38.0 38.0 38.0 36.0 38.0 9 36.7145 38.0 38.0 38.0 36.0 38.0 10-14 36.02765 38.0 38.0 38.0 33.6 38.0 15-19 35.7516 38.0 38.0 38.0 33.4 38.0 20-24 36.131600000000006 38.0 38.0 38.0 34.2 38.0 25-29 36.3913 38.0 38.0 38.0 34.8 38.0 30-34 36.36805 38.0 38.0 38.0 35.0 38.0 35-39 36.45235 38.0 38.0 38.0 36.0 38.0 40-44 36.48285 38.0 38.0 38.0 35.8 38.0 45-49 36.41235 38.0 38.0 38.0 35.4 38.0 50-54 35.80650000000001 38.0 38.0 38.0 32.8 38.0 55-59 35.00595 38.0 38.0 38.0 28.4 38.0 60-64 35.150850000000005 38.0 38.0 38.0 29.0 38.0 65-69 35.43275 38.0 38.0 38.0 31.4 38.0 70-74 35.090500000000006 38.0 37.8 38.0 28.8 38.0 75-79 35.109750000000005 38.0 38.0 38.0 28.6 38.0 80-84 35.32855 38.0 38.0 38.0 30.8 38.0 85-89 35.307249999999996 38.0 38.0 38.0 30.8 38.0 90-94 35.12925 38.0 38.0 38.0 29.4 38.0 95-99 34.99015 38.0 37.8 38.0 28.6 38.0 100-104 34.6003 38.0 37.2 38.0 26.2 38.0 105-109 34.55505 38.0 37.0 38.0 25.2 38.0 110-114 34.29615 38.0 36.8 38.0 22.4 38.0 115-119 34.2625 38.0 36.6 38.0 23.2 38.0 120-124 34.2446 38.0 36.0 38.0 23.4 38.0 125-129 34.02025 38.0 36.0 38.0 22.6 38.0 130-134 33.586200000000005 38.0 35.0 38.0 19.0 38.0 135-139 32.990649999999995 38.0 34.2 38.0 14.2 38.0 140-144 32.76025 38.0 34.6 38.0 14.0 38.0 145-149 31.981599999999997 38.0 33.8 38.0 6.4 38.0 150-151 28.61325 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 29.0 4 7.0 5 1.0 6 0.0 7 12.0 8 18.0 9 3.0 10 11.0 11 29.0 12 17.0 13 0.0 14 4.0 15 8.0 16 5.0 17 10.0 18 8.0 19 11.0 20 7.0 21 15.0 22 9.0 23 20.0 24 25.0 25 29.0 26 34.0 27 21.0 28 39.0 29 37.0 30 56.0 31 83.0 32 85.0 33 99.0 34 131.0 35 219.0 36 436.0 37 2468.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.675000000000004 21.175 14.124999999999998 28.025 2 25.1 26.025 31.525 17.349999999999998 3 20.200000000000003 27.875 31.924999999999997 20.0 4 24.50612653163291 33.73343335833959 22.255563890972745 19.504876219054765 5 25.625625625625624 35.56056056056056 21.846846846846844 16.966966966966968 6 19.49874686716792 39.423558897243105 22.982456140350877 18.095238095238095 7 19.808949220713927 21.09100050276521 39.14027149321267 19.959778783308195 8 21.883726834221882 25.97105864432597 28.38283828382838 23.762376237623762 9 22.868605817452355 23.269809428284855 29.638916750250754 24.222668004012036 10-14 23.004790541229234 29.054122923249416 26.475384772194477 21.465701763326877 15-19 23.128831195590582 28.57878741049812 27.831865244938957 20.46051614897234 20-24 22.929031603510374 27.83949677877543 27.85978795718561 21.371683660528586 25-29 23.52970669340687 28.428177488092253 27.505640511406366 20.53647530709451 30-34 22.742897583661914 28.1063593165504 27.894045091497322 21.256698008290364 35-39 22.886649874055415 28.005037783375315 27.566750629722918 21.541561712846345 40-44 23.170547704068802 27.455615349796307 28.386058441885027 20.987778504249864 45-49 23.044046661303298 28.006838294448915 27.775543041029767 21.173572003218023 50-54 23.178334184977007 27.945835462442513 28.165559529892693 20.710270822687786 55-59 23.662615560403033 27.6046535784772 27.68775319414148 21.04497766697829 60-64 23.562681610626814 28.025114155251142 27.73972602739726 20.672478206724783 65-69 23.64267837989683 27.56014096736299 28.377343071658412 20.419837581081772 70-74 23.372948500282966 27.879816844163198 27.77692030663168 20.97031434892216 75-79 23.193389447752004 27.6739889139807 27.946006980086224 21.18661465818107 80-84 22.892803944732652 27.304946324926803 28.4400842364785 21.362165493862037 85-89 24.03334697217676 27.12254500818331 28.032937806873974 20.81117021276596 90-94 23.211896675928784 27.62169393845837 28.558196974374805 20.608212411238036 95-99 23.450244698205548 27.798735725938013 28.32891517128874 20.4221044045677 100-104 23.877264939515083 27.937282591765744 27.3038783033072 20.881574165411973 105-109 23.204930662557782 27.765793528505395 28.741653826399588 20.28762198253724 110-114 23.698764666356542 27.68387863751486 28.13872951878844 20.478627177340154 115-119 23.941485525909137 27.773771505099415 28.010713917791286 20.274029051200166 120-124 23.762577497713185 28.061794897855474 27.767049496900093 20.408578107531252 125-129 23.8616128211651 27.509539557364537 28.24217756296108 20.386670058509285 130-134 24.49419739139365 27.600903769128067 27.631714080312207 20.273184759166067 135-139 23.790528792063004 27.77948245883195 27.79482458831953 20.635164160785514 140-144 24.240895793402604 27.630384343790983 27.801876324018966 20.32684353878745 145-149 23.756962025316454 27.610126582278482 27.944303797468358 20.68860759493671 150-151 24.377155998466847 26.779097994122907 28.325028746646225 20.51871726076402 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 2.0 8 2.5 9 2.0 10 2.5 11 2.5 12 5.0 13 8.5 14 7.0 15 7.0 16 8.5 17 7.0 18 4.5 19 2.5 20 2.0 21 2.5 22 4.0 23 7.0 24 8.5 25 9.5 26 8.0 27 6.0 28 6.5 29 8.5 30 13.5 31 22.0 32 33.5 33 40.0 34 45.5 35 55.5 36 71.0 37 91.0 38 125.0 39 171.0 40 208.5 41 234.5 42 251.0 43 257.5 44 269.5 45 275.5 46 256.5 47 248.0 48 237.5 49 205.5 50 176.0 51 138.5 52 113.0 53 98.5 54 69.5 55 45.0 56 31.0 57 21.0 58 20.5 59 16.0 60 5.0 61 4.5 62 6.0 63 5.0 64 3.0 65 1.0 66 0.5 67 1.0 68 1.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.1 6 0.25 7 0.5499999999999999 8 1.525 9 0.3 10-14 1.8900000000000001 15-19 2.935 20-24 1.435 25-29 0.27499999999999997 30-34 1.09 35-39 0.75 40-44 0.585 45-49 0.5599999999999999 50-54 2.15 55-59 3.73 60-64 3.64 65-69 2.105 70-74 2.815 75-79 2.58 80-84 2.6550000000000002 85-89 2.2399999999999998 90-94 2.83 95-99 1.92 100-104 3.695 105-109 2.65 110-114 3.2649999999999997 115-119 2.93 120-124 1.6099999999999999 125-129 1.725 130-134 2.63 135-139 2.23 140-144 0.8699999999999999 145-149 1.25 150-151 2.1624999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.6735308890005 99.225 2 0.2762430939226519 0.5499999999999999 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025113008538422906 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.1375000000000002 0.0 0.0 0.0 0.0 130-131 1.2875 0.0 0.0 0.0 0.0 132-133 1.4500000000000002 0.0 0.0 0.0 0.0 134-135 1.6124999999999998 0.0 0.0 0.0 0.0 136-137 1.7374999999999998 0.0 0.0 0.0 0.0 138-139 1.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880961 spots for SRR7168984.sra Written 880961 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra Read 880952 spots for SRR7168984.sra Written 880952 spots for SRR7168984.sra SRR ids: ['SRR7168984.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vwbbn7f8 SRR7168984.sra spots: 17619049 blocks: [[1, 880952], [880953, 1761904], [1761905, 2642856], [2642857, 3523808], [3523809, 4404760], [4404761, 5285712], [5285713, 6166664], [6166665, 7047616], [7047617, 7928568], [7928569, 8809520], [8809521, 9690472], [9690473, 10571424], [10571425, 11452376], [11452377, 12333328], [12333329, 13214280], [13214281, 14095232], [14095233, 14976184], [14976185, 15857136], [15857137, 16738088], [16738089, 17619049]] SRR7168984 file size 5948817 SRR7168984 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168984 SRR7168984_1.fastq SRR7168984_2.fastq Input file: SRR7168984_1.fastq Paired file: SRR7168984_2.fastq trimmed: SRR7168984-trimmed-pair1.fastq, SRR7168984-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:49:13 2025 >> started Mon Feb 10 13:49:33 2025 >> done (19.251s) 17619049 read pairs processed; of these: 34510 ( 0.20%) short read pairs filtered out after trimming by size control 55405 ( 0.31%) empty read pairs filtered out after trimming by size control 17529134 (99.49%) read pairs available; of these: 7574137 (43.21%) trimmed read pairs available after processing 9954997 (56.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 4 0.00% 21 2 0.00% 22 5 0.00% 23 10 0.00% 24 9 0.00% 25 12 0.00% 26 5 0.00% 27 9 0.00% 28 4 0.00% 29 6 0.00% 30 9 0.00% 31 6 0.00% 32 3 0.00% 33 4 0.00% 34 8 0.00% 35 4 0.00% 36 9 0.00% 37 7 0.00% 38 8 0.00% 39 15 0.00% 40 7 0.00% 41 15 0.00% 42 9 0.00% 43 16 0.00% 44 17 0.00% 45 32 0.00% 46 16 0.00% 47 31 0.00% 48 31 0.00% 49 23 0.00% 50 26 0.00% 51 33 0.00% 52 40 0.00% 53 40 0.00% 54 44 0.00% 55 48 0.00% 56 46 0.00% 57 45 0.00% 58 73 0.00% 59 82 0.00% 60 72 0.00% 61 95 0.00% 62 114 0.00% 63 138 0.00% 64 147 0.00% 65 151 0.00% 66 174 0.00% 67 194 0.00% 68 232 0.00% 69 282 0.00% 70 346 0.00% 71 309 0.00% 72 349 0.00% 73 372 0.00% 74 463 0.00% 75 527 0.00% 76 575 0.00% 77 646 0.00% 78 718 0.00% 79 852 0.00% 80 931 0.01% 81 1027 0.01% 82 1180 0.01% 83 1436 0.01% 84 2392 0.01% 85 2899 0.02% 86 3002 0.02% 87 3012 0.02% 88 3238 0.02% 89 3229 0.02% 90 3467 0.02% 91 3581 0.02% 92 4063 0.02% 93 3926 0.02% 94 4215 0.02% 95 4515 0.03% 96 4722 0.03% 97 5124 0.03% 98 5527 0.03% 99 5719 0.03% 100 6516 0.04% 101 6800 0.04% 102 7078 0.04% 103 6800 0.04% 104 7592 0.04% 105 8063 0.05% 106 8678 0.05% 107 8960 0.05% 108 9880 0.06% 109 9820 0.06% 110 10391 0.06% 111 11152 0.06% 112 11611 0.07% 113 12264 0.07% 114 13030 0.07% 115 14161 0.08% 116 14805 0.08% 117 15492 0.09% 118 16349 0.09% 119 16890 0.10% 120 17983 0.10% 121 18749 0.11% 122 19896 0.11% 123 21229 0.12% 124 22418 0.13% 125 23873 0.14% 126 25923 0.15% 127 26918 0.15% 128 28368 0.16% 129 29850 0.17% 130 32207 0.18% 131 34424 0.20% 132 36868 0.21% 133 39713 0.23% 134 43308 0.25% 135 46640 0.27% 136 50752 0.29% 137 54630 0.31% 138 59981 0.34% 139 65639 0.37% 140 73219 0.42% 141 81479 0.46% 142 93826 0.54% 143 108810 0.62% 144 128768 0.73% 145 157416 0.90% 146 200907 1.15% 147 280278 1.60% 148 427823 2.44% 149 846757 4.83% 150 4184370 23.87% 151 9954997 56.79% 17529134 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=28 prefix-density=0.20 prefix-fanout=3.0 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.14 sequence-density-rank=7 fanout-score=91.21 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=18.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=40 prefix-density=0.25 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=126.35 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=6.5 sequence=CTTCCTCTTCACAATTAGCAAACAGTAAGTTTGAACACACTCAAGATTTGAAATATCCTACAACGATGAGAAAGCAACTCCTCTCCCCATTCGTTCCTTTCTTGATGTTCTTCCTCTACAGCTCCACCACTTTTGCTCAAACCCCATCTCCAGCACCTTCAGGTCCAACCAACATAACGGCGATCCTTGCGAAAGCTGGTCAGTTCACAACCTTAATTCGGTTGTTGAAAAGCACCCAAGAGGCTGACCAAATCAACACACAACTCAACAATTCAAACCAAGGCCTAACAGTCTTTGC SRR7168984 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:50:20 Started mapping on | Feb 10 13:50:21 Finished on | Feb 10 13:52:12 Mapping speed, Million of reads per hour | 568.51 Number of input reads | 17529134 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16338570 Uniquely mapped reads % | 93.21% Average mapped length | 296.75 Number of splices: Total | 16036407 Number of splices: Annotated (sjdb) | 15779949 Number of splices: GT/AG | 15802299 Number of splices: GC/AG | 186511 Number of splices: AT/AC | 12759 Number of splices: Non-canonical | 34838 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353538 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 269086 % of reads mapped to too many loci | 1.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.01% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 858838 858838 858838 N_multimapping 353538 353538 353538 N_noFeature 397379 16174678 472236 N_ambiguous 160621 1469 70369 UnstrandedReadsAssigned:15780570 PositiveStrandReadsAssigned:162423 NegativeStrandReadsAssigned:15795965 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168984 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168984-trimmed-pair1.fastq SRR7168984-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,529,134 reads, 15,867,961 reads pseudoaligned [quant] estimated average fragment length: 267.205 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR7168984.ke.tsv 34699 SRR7168984.se.tsv 87100 total ==> SRR7168984.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.8 259 8.85493 Potri.005G024800.1.v4.1 1035 768.795 28 2.1813 Potri.004G059700.1.v4.1 961 694.829 1 0.0861968 Potri.007G009000.2.v4.1 1416 1149.8 0 0 Potri.003G141000.2.v4.1 2943 2676.8 278 6.22012 Potri.016G087400.1.v4.1 270 65.295 1412.13 1295.28 Potri.015G069301.1.v4.1 564 303.839 0 0 Potri.010G195200.1.v4.1 1773 1506.8 19 0.755211 Potri.012G127500.1.v4.1 977 710.812 6547 551.641 ==> SRR7168984.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1110 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 266 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168984 completed mapping pipeline successfully