Starting /dee2/code/volunteer_pipeline.sh SRR7168985 current disk space = 3058925162496 free memory = 1228760720 SRR7168985 SRAfilesize a65f8e2c5b82a59df2bd33e9db7f72b6 SRR7168985.sra SRR7168985.sra file validated SRR7168985 is paired end SRR7168985 is conventional basespace SRR7168985 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168985_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49625 34.0 33.0 34.0 32.0 34.0 2 33.0555 34.0 33.0 34.0 32.0 34.0 3 33.03375 34.0 33.0 34.0 32.0 34.0 4 33.0795 34.0 33.0 34.0 32.0 34.0 5 33.13975 34.0 33.0 34.0 32.0 34.0 6 36.8335 38.0 37.0 38.0 35.0 38.0 7 37.15175 38.0 38.0 38.0 36.0 38.0 8 37.31375 38.0 38.0 38.0 37.0 38.0 9 37.39675 38.0 38.0 38.0 37.0 38.0 10-14 37.39915 38.0 38.0 38.0 37.0 38.0 15-19 37.342650000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.237649999999995 38.0 38.0 38.0 36.8 38.0 25-29 37.130700000000004 38.0 38.0 38.0 36.2 38.0 30-34 37.086149999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.96655 38.0 38.0 38.0 35.8 38.0 40-44 36.81484999999999 38.0 38.0 38.0 34.8 38.0 45-49 36.82555 38.0 38.0 38.0 35.0 38.0 50-54 36.830200000000005 38.0 38.0 38.0 35.2 38.0 55-59 36.5293 38.0 38.0 38.0 34.0 38.0 60-64 36.620250000000006 38.0 38.0 38.0 34.2 38.0 65-69 36.54350000000001 38.0 38.0 38.0 34.0 38.0 70-74 36.499849999999995 38.0 38.0 38.0 34.0 38.0 75-79 36.3998 38.0 37.4 38.0 34.0 38.0 80-84 35.68769999999999 38.0 36.8 38.0 30.8 38.0 85-89 35.656150000000004 38.0 37.0 38.0 30.6 38.0 90-94 35.40855 38.0 36.4 38.0 29.6 38.0 95-99 35.313900000000004 38.0 36.4 38.0 29.2 38.0 100-104 35.083349999999996 38.0 36.0 38.0 28.6 38.0 105-109 35.120400000000004 38.0 36.0 38.0 28.6 38.0 110-114 34.64795 38.0 35.2 38.0 26.0 38.0 115-119 34.3295 38.0 35.0 38.0 24.0 38.0 120-124 33.8993 37.8 34.0 38.0 22.8 38.0 125-129 33.00064999999999 37.4 33.2 38.0 16.6 38.0 130-134 32.46809999999999 37.2 32.0 38.0 16.0 38.0 135-139 33.20045 38.0 34.0 38.0 17.4 38.0 140-144 32.772800000000004 38.0 33.0 38.0 15.6 38.0 145-149 31.708450000000006 36.8 32.0 38.0 11.2 38.0 150-151 27.14725 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 2.0 14 1.0 15 7.0 16 2.0 17 9.0 18 10.0 19 16.0 20 7.0 21 5.0 22 11.0 23 11.0 24 16.0 25 17.0 26 32.0 27 39.0 28 53.0 29 51.0 30 77.0 31 87.0 32 121.0 33 185.0 34 258.0 35 433.0 36 922.0 37 1625.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.36140888208269 15.26288922919857 10.183767228177642 36.191934660541094 2 23.5 15.65 31.8 29.049999999999997 3 20.575 18.425 25.374999999999996 35.625 4 22.05 24.275 23.200000000000003 30.475 5 23.417563172379285 30.64798598949212 23.517638228671505 22.416812609457093 6 21.025 32.45 25.25 21.275 7 15.225 28.349999999999998 38.0 18.425 8 17.599999999999998 28.425 30.225 23.75 9 17.25 28.299999999999997 32.25 22.2 10-14 19.485 30.73 27.045 22.74 15-19 19.66 30.009999999999998 26.825 23.505000000000003 20-24 19.185 30.025000000000002 27.500000000000004 23.29 25-29 19.35 30.075000000000003 26.279999999999998 24.295 30-34 19.415 29.549999999999997 27.445000000000004 23.59 35-39 19.299649824912457 29.824912456228112 27.388694347173587 23.486743371685844 40-44 20.185 29.459999999999997 26.775 23.580000000000002 45-49 20.319063812762554 29.305861172234447 27.19543908781756 23.179635927185437 50-54 19.935 28.945 27.775 23.345 55-59 19.685 29.845 26.88 23.59 60-64 19.7 28.854999999999997 27.365000000000002 24.08 65-69 20.1970197019702 29.072907290729074 27.077707770777078 23.652365236523654 70-74 20.0 29.167291822955736 27.316829207301822 23.515878969742435 75-79 20.16 28.67 27.315 23.855 80-84 20.307785153892578 28.988131160732244 26.805471736069205 23.898611949305977 85-89 19.6059707493592 29.5069608483691 27.47650399557722 23.410564406694476 90-94 20.212979706650593 28.0239099859353 27.22523608599558 24.537874221418527 95-99 20.077531087952476 28.329054020037255 27.458087902129584 24.13532698988068 100-104 20.67978712722161 28.602269304147004 27.261773270408675 23.456170298222716 105-109 20.58202653799759 28.57860876558102 27.181342983514273 23.658021712907118 110-114 20.555165144061842 28.52123280795101 27.055516514406186 23.868085533580967 115-119 20.21896343913218 28.344716753716355 27.71695460024106 23.719365206910407 120-124 21.21530382595649 28.24206051512878 27.016754188547136 23.52588147036759 125-129 20.536609829488466 27.988966900702106 27.467402206619862 24.00702106318957 130-134 20.490562228727164 28.43948723125063 27.056626627637026 24.013323912385182 135-139 20.886331516252778 27.86694932364224 27.24106602059358 24.005653139511406 140-144 21.144291091593477 27.643663739021328 27.01129234629862 24.200752823086574 145-149 20.779941479164567 28.02946221370195 26.823731207748963 24.366865099384523 150-151 21.352268442880483 27.811989443257506 26.303883373130578 24.531858740731433 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.0 23 1.5 24 1.0 25 2.5 26 5.5 27 8.5 28 14.5 29 22.0 30 27.5 31 34.0 32 46.5 33 56.5 34 63.0 35 82.5 36 102.5 37 118.5 38 139.5 39 159.5 40 188.0 41 204.0 42 232.5 43 254.0 44 249.5 45 238.5 46 225.5 47 240.0 48 234.5 49 190.5 50 167.0 51 146.0 52 121.5 53 107.0 54 86.0 55 62.0 56 38.0 57 31.0 58 26.5 59 18.5 60 13.5 61 9.5 62 7.5 63 6.0 64 2.0 65 1.0 66 1.5 67 2.0 68 1.5 69 1.5 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.05 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.025 75-79 0.0 80-84 0.58 85-89 0.515 90-94 0.45999999999999996 95-99 0.685 100-104 0.41000000000000003 105-109 0.52 110-114 0.38999999999999996 115-119 0.44 120-124 0.025 125-129 0.3 130-134 0.9299999999999999 135-139 0.9400000000000001 140-144 0.375 145-149 0.89 150-151 0.5375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.36250000000000004 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.5875 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.275 0.0 0.0 0.0 0.0 130-131 2.5250000000000004 0.0 0.0 0.0 0.0 132-133 2.7125 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.4000000000000004 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAAAC 10 0.0070723044 143.325 5 >>END_MODULE SRR7168985 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168985_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97425 33.0 33.0 34.0 32.0 34.0 2 33.0775 34.0 33.0 34.0 32.0 34.0 3 33.05675 34.0 33.0 34.0 32.0 34.0 4 32.97925 34.0 33.0 34.0 32.0 34.0 5 33.03325 34.0 33.0 34.0 32.0 34.0 6 36.92375 38.0 38.0 38.0 36.0 38.0 7 36.762 38.0 38.0 38.0 36.0 38.0 8 36.4065 38.0 38.0 38.0 35.0 38.0 9 36.72775 38.0 38.0 38.0 36.0 38.0 10-14 36.099849999999996 38.0 38.0 38.0 34.0 38.0 15-19 35.86535000000001 38.0 38.0 38.0 34.0 38.0 20-24 36.18625 38.0 38.0 38.0 34.6 38.0 25-29 36.3656 38.0 38.0 38.0 35.2 38.0 30-34 36.3339 38.0 38.0 38.0 35.2 38.0 35-39 36.430949999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.4519 38.0 38.0 38.0 36.0 38.0 45-49 36.4864 38.0 38.0 38.0 35.8 38.0 50-54 35.896950000000004 38.0 38.0 38.0 33.6 38.0 55-59 35.211 38.0 38.0 38.0 29.6 38.0 60-64 35.36475 38.0 38.0 38.0 30.8 38.0 65-69 35.63824999999999 38.0 38.0 38.0 33.0 38.0 70-74 35.35165 38.0 38.0 38.0 30.4 38.0 75-79 35.334450000000004 38.0 38.0 38.0 29.8 38.0 80-84 35.498450000000005 38.0 38.0 38.0 32.6 38.0 85-89 35.578050000000005 38.0 38.0 38.0 33.0 38.0 90-94 35.3089 38.0 38.0 38.0 30.8 38.0 95-99 35.3107 38.0 38.0 38.0 30.4 38.0 100-104 34.91519999999999 38.0 37.4 38.0 28.8 38.0 105-109 34.78205 38.0 37.0 38.0 27.2 38.0 110-114 34.6156 38.0 37.0 38.0 26.0 38.0 115-119 34.525800000000004 38.0 36.8 38.0 25.6 38.0 120-124 34.568 38.0 36.6 38.0 26.2 38.0 125-129 34.34355 38.0 36.0 38.0 23.6 38.0 130-134 33.9521 38.0 35.6 38.0 21.4 38.0 135-139 33.41735 38.0 35.0 38.0 16.4 38.0 140-144 33.13865 38.0 34.8 38.0 14.4 38.0 145-149 32.17645 38.0 33.8 38.0 8.8 38.0 150-151 28.6675 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 45.0 4 6.0 5 1.0 6 3.0 7 5.0 8 12.0 9 8.0 10 21.0 11 18.0 12 10.0 13 2.0 14 2.0 15 4.0 16 6.0 17 3.0 18 5.0 19 3.0 20 12.0 21 6.0 22 15.0 23 12.0 24 23.0 25 24.0 26 21.0 27 33.0 28 38.0 29 47.0 30 58.0 31 66.0 32 64.0 33 101.0 34 147.0 35 214.0 36 464.0 37 2494.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.2 21.525 15.125 29.15 2 26.400000000000002 28.95 28.525 16.125 3 21.43035758939735 28.80720180045011 29.80745186296574 19.954988747186796 4 22.486243121560783 33.06653326663332 24.262131065532767 20.185092546273136 5 25.819364523392547 34.025519139354515 22.266700025018764 17.888416312234177 6 21.233391827525697 36.224617698671345 24.241664577588367 18.300325896214588 7 21.48427672955975 21.534591194968552 37.20754716981132 19.77358490566038 8 22.44794311833418 25.139664804469277 27.907567293042153 24.504824784154394 9 22.98821759839559 25.971421408874406 27.92679869641514 23.113562296314864 10-14 24.15515571639737 28.508078903104135 25.852489933227996 21.484275447270505 15-19 23.38925483738164 28.067105804857967 27.4752984767394 21.068340881020998 20-24 23.53179835683132 27.84765189167258 27.771579267674205 20.848970483821887 25-29 23.90214557850411 27.757168638459994 27.85241628233407 20.488269500701826 30-34 23.268403743991904 28.11535542625854 27.619529471287628 20.99671135846193 35-39 24.455864570737607 27.866787585650947 27.262192664248285 20.415155179363158 40-44 23.881198087087842 27.701988421847467 27.495595268059404 20.921218223005287 45-49 23.53592272086939 28.164620648017706 27.30428657677601 20.99517005433689 50-54 24.33427038078201 27.96319959110657 26.843853820598007 20.858676207513415 55-59 24.403774367482374 27.146412277063458 27.882621318954794 20.567192036499378 60-64 23.48951592026922 28.288894641470357 27.23789800673052 20.9836914315299 65-69 24.219667943805874 27.197956577266925 28.025542784163477 20.55683269476373 70-74 24.25706940874036 27.856041131105396 26.853470437017997 21.033419023136247 75-79 24.01661623673009 28.119390737986567 27.309092773988407 20.55490025129494 80-84 23.870868404844998 27.94087456374461 27.011907205912543 21.176349825497844 85-89 24.050568123656465 27.53096529839287 27.505374142696283 20.913092435254377 90-94 24.215615677399445 27.594897644275278 27.55889311799198 20.6305935603333 95-99 24.050245098039216 27.849264705882355 27.747140522875817 20.353349673202615 100-104 23.58671433753044 28.198352246230375 28.234623555624644 19.98030986061454 105-109 23.93100970176069 27.96571017914891 27.67825060315179 20.425029515938604 110-114 23.684346433920364 27.87791148065899 28.0431751278211 20.394566957599544 115-119 24.733892117036046 26.84218645549442 28.323134673728596 20.100786753740937 120-124 24.619844377765347 27.249148146264556 27.89503127701775 20.235976198952347 125-129 23.936711436711438 27.74216524216524 28.057590557590554 20.263532763532762 130-134 24.427441717161344 27.667659443360375 27.888466673513403 20.016432165964876 135-139 24.294710972300447 27.581793046951002 27.289949311351187 20.833546669397368 140-144 24.6001715352404 27.208516220170527 27.849250794611773 20.342061449977297 145-149 24.813820355641116 27.503926237398048 27.954810274076703 19.727443132884137 150-151 24.913715965742043 26.882270228812477 28.569602454301418 19.634411351144063 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 1.0 5 1.5 6 1.0 7 1.0 8 1.5 9 3.0 10 5.5 11 7.5 12 8.0 13 8.0 14 5.0 15 5.5 16 5.5 17 2.5 18 4.0 19 5.0 20 6.0 21 5.5 22 4.0 23 6.0 24 5.0 25 1.5 26 2.5 27 4.0 28 3.5 29 6.0 30 11.0 31 13.5 32 14.5 33 25.5 34 38.0 35 47.5 36 62.0 37 85.0 38 117.5 39 159.0 40 188.5 41 211.5 42 243.0 43 268.5 44 292.0 45 295.5 46 270.5 47 255.0 48 245.5 49 212.5 50 179.0 51 143.5 52 129.5 53 116.5 54 74.5 55 44.5 56 34.0 57 28.0 58 22.0 59 15.5 60 11.5 61 10.0 62 4.5 63 5.5 64 5.0 65 1.5 66 1.0 67 2.0 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.05 5 0.075 6 0.27499999999999997 7 0.625 8 1.55 9 0.27499999999999997 10-14 1.905 15-19 2.8400000000000003 20-24 1.41 25-29 0.26 30-34 1.175 35-39 0.76 40-44 0.675 45-49 0.62 50-54 2.175 55-59 3.56 60-64 3.4250000000000003 65-69 2.125 70-74 2.75 75-79 2.505 80-84 2.58 85-89 2.31 90-94 2.79 95-99 2.08 100-104 3.505 105-109 2.595 110-114 3.1850000000000005 115-119 2.765 120-124 1.685 125-129 1.72 130-134 2.63 135-139 2.3449999999999998 140-144 0.895 145-149 1.3050000000000002 150-151 2.2125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.8999999999999999 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.5499999999999998 0.0 0.0 0.0 0.0 124-125 1.7625 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.4 0.0 0.0 0.0 0.0 130-131 2.6500000000000004 0.0 0.0 0.0 0.0 132-133 2.8375 0.0 0.0 0.0 0.0 134-135 3.1125 0.0 0.0 0.0 0.0 136-137 3.5250000000000004 0.0 0.0 0.0 0.0 138-139 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTGGG 10 0.0067590103 145.44156 7 >>END_MODULE Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892545 spots for SRR7168985.sra Written 892545 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra Read 892540 spots for SRR7168985.sra Written 892540 spots for SRR7168985.sra SRR ids: ['SRR7168985.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hqxmdof8 SRR7168985.sra spots: 17850805 blocks: [[1, 892540], [892541, 1785080], [1785081, 2677620], [2677621, 3570160], [3570161, 4462700], [4462701, 5355240], [5355241, 6247780], [6247781, 7140320], [7140321, 8032860], [8032861, 8925400], [8925401, 9817940], [9817941, 10710480], [10710481, 11603020], [11603021, 12495560], [12495561, 13388100], [13388101, 14280640], [14280641, 15173180], [15173181, 16065720], [16065721, 16958260], [16958261, 17850805]] SRR7168985 file size 6027351 SRR7168985 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168985 SRR7168985_1.fastq SRR7168985_2.fastq Input file: SRR7168985_1.fastq Paired file: SRR7168985_2.fastq trimmed: SRR7168985-trimmed-pair1.fastq, SRR7168985-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:21:15 2025 >> started Mon Feb 10 14:21:33 2025 >> done (18.343s) 17850805 read pairs processed; of these: 35602 ( 0.20%) short read pairs filtered out after trimming by size control 24793 ( 0.14%) empty read pairs filtered out after trimming by size control 17790410 (99.66%) read pairs available; of these: 7912323 (44.48%) trimmed read pairs available after processing 9878087 (55.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 8 0.00% 20 8 0.00% 21 5 0.00% 22 10 0.00% 23 4 0.00% 24 8 0.00% 25 9 0.00% 26 16 0.00% 27 7 0.00% 28 4 0.00% 29 9 0.00% 30 7 0.00% 31 11 0.00% 32 6 0.00% 33 10 0.00% 34 14 0.00% 35 4 0.00% 36 12 0.00% 37 14 0.00% 38 18 0.00% 39 8 0.00% 40 9 0.00% 41 10 0.00% 42 9 0.00% 43 11 0.00% 44 24 0.00% 45 13 0.00% 46 18 0.00% 47 30 0.00% 48 22 0.00% 49 20 0.00% 50 23 0.00% 51 25 0.00% 52 32 0.00% 53 30 0.00% 54 44 0.00% 55 37 0.00% 56 34 0.00% 57 67 0.00% 58 63 0.00% 59 74 0.00% 60 66 0.00% 61 81 0.00% 62 83 0.00% 63 126 0.00% 64 124 0.00% 65 132 0.00% 66 164 0.00% 67 176 0.00% 68 206 0.00% 69 286 0.00% 70 256 0.00% 71 310 0.00% 72 324 0.00% 73 382 0.00% 74 440 0.00% 75 533 0.00% 76 588 0.00% 77 625 0.00% 78 723 0.00% 79 823 0.00% 80 927 0.01% 81 1103 0.01% 82 1270 0.01% 83 1484 0.01% 84 2650 0.01% 85 3198 0.02% 86 3430 0.02% 87 3569 0.02% 88 3885 0.02% 89 3949 0.02% 90 4140 0.02% 91 4338 0.02% 92 4831 0.03% 93 4796 0.03% 94 5350 0.03% 95 5758 0.03% 96 6104 0.03% 97 6828 0.04% 98 7261 0.04% 99 7500 0.04% 100 8577 0.05% 101 8657 0.05% 102 9278 0.05% 103 9342 0.05% 104 10216 0.06% 105 11303 0.06% 106 12207 0.07% 107 12701 0.07% 108 13530 0.08% 109 14182 0.08% 110 14796 0.08% 111 15474 0.09% 112 16497 0.09% 113 17451 0.10% 114 17940 0.10% 115 19416 0.11% 116 20700 0.12% 117 21993 0.12% 118 23062 0.13% 119 23877 0.13% 120 24681 0.14% 121 26151 0.15% 122 27550 0.15% 123 29456 0.17% 124 30775 0.17% 125 32664 0.18% 126 34704 0.20% 127 36218 0.20% 128 38415 0.22% 129 40283 0.23% 130 42611 0.24% 131 44899 0.25% 132 47780 0.27% 133 51006 0.29% 134 54131 0.30% 135 57712 0.32% 136 62187 0.35% 137 66173 0.37% 138 71886 0.40% 139 78364 0.44% 140 85437 0.48% 141 93777 0.53% 142 105490 0.59% 143 119639 0.67% 144 139409 0.78% 145 166429 0.94% 146 206855 1.16% 147 283434 1.59% 148 424681 2.39% 149 828882 4.66% 150 4169831 23.44% 151 9878087 55.52% 17790410 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=42 prefix-density=0.28 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=14 fanout-score=90.65 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=16.9 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=39 prefix-density=0.30 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=53.16 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=13.0 sequence=TGTTGGTGGTGG SRR7168985 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:22:18 Started mapping on | Feb 10 14:22:18 Finished on | Feb 10 14:24:03 Mapping speed, Million of reads per hour | 609.96 Number of input reads | 17790410 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16875008 Uniquely mapped reads % | 94.85% Average mapped length | 295.89 Number of splices: Total | 14615163 Number of splices: Annotated (sjdb) | 14365739 Number of splices: GT/AG | 14411846 Number of splices: GC/AG | 160512 Number of splices: AT/AC | 12347 Number of splices: Non-canonical | 30458 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304545 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 37238 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 631838 631838 631838 N_multimapping 304545 304545 304545 N_noFeature 371423 16621654 475411 N_ambiguous 215218 1062 65112 UnstrandedReadsAssigned:16288367 PositiveStrandReadsAssigned:252292 NegativeStrandReadsAssigned:16334485 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168985 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168985-trimmed-pair1.fastq SRR7168985-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,790,410 reads, 16,271,756 reads pseudoaligned [quant] estimated average fragment length: 240.655 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR7168985.ke.tsv 34699 SRR7168985.se.tsv 87100 total ==> SRR7168985.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.35 242 7.31102 Potri.005G024800.1.v4.1 1035 795.345 28 1.89139 Potri.004G059700.1.v4.1 961 721.366 2 0.148954 Potri.007G009000.2.v4.1 1416 1176.35 0 0 Potri.003G141000.2.v4.1 2943 2703.35 224 4.45169 Potri.016G087400.1.v4.1 270 72.6501 2064.51 1526.72 Potri.015G069301.1.v4.1 564 326.887 0 0 Potri.010G195200.1.v4.1 1773 1533.35 18 0.630683 Potri.012G127500.1.v4.1 977 737.356 4342 316.367 ==> SRR7168985.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1541 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 32 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7168985 completed mapping pipeline successfully