Starting /dee2/code/volunteer_pipeline.sh SRR7168986 current disk space = 3058901819392 free memory = 1203847432 SRR7168986 SRAfilesize 2e04fdcba51b25d3638b43be3c8d4eee SRR7168986.sra SRR7168986.sra file validated SRR7168986 is paired end SRR7168986 is conventional basespace SRR7168986 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168986_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.853 34.0 33.0 34.0 33.0 34.0 2 33.32375 34.0 34.0 34.0 33.0 34.0 3 33.4325 34.0 34.0 34.0 33.0 34.0 4 33.50025 34.0 34.0 34.0 33.0 34.0 5 33.46175 34.0 34.0 34.0 33.0 34.0 6 37.101 38.0 38.0 38.0 36.0 38.0 7 37.4415 38.0 38.0 38.0 37.0 38.0 8 37.49925 38.0 38.0 38.0 37.0 38.0 9 37.51775 38.0 38.0 38.0 38.0 38.0 10-14 37.55655 38.0 38.0 38.0 38.0 38.0 15-19 37.5702 38.0 38.0 38.0 38.0 38.0 20-24 37.5366 38.0 38.0 38.0 38.0 38.0 25-29 37.49105 38.0 38.0 38.0 38.0 38.0 30-34 37.474450000000004 38.0 38.0 38.0 37.6 38.0 35-39 37.375550000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.27635 38.0 38.0 38.0 37.0 38.0 45-49 37.2116 38.0 38.0 38.0 36.4 38.0 50-54 37.186 38.0 38.0 38.0 36.0 38.0 55-59 37.13355 38.0 38.0 38.0 36.0 38.0 60-64 37.048500000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.021249999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.07335 38.0 38.0 38.0 36.0 38.0 75-79 36.90335 38.0 38.0 38.0 35.8 38.0 80-84 36.90475 38.0 38.0 38.0 35.4 38.0 85-89 36.79084999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.67645 38.0 38.0 38.0 34.8 38.0 95-99 36.52865 38.0 38.0 38.0 34.2 38.0 100-104 36.437400000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.35925 38.0 38.0 38.0 34.0 38.0 110-114 36.0794 38.0 37.0 38.0 33.4 38.0 115-119 35.89105 38.0 37.0 38.0 32.2 38.0 120-124 35.846799999999995 38.0 37.0 38.0 32.2 38.0 125-129 35.604099999999995 38.0 36.4 38.0 31.0 38.0 130-134 35.3339 38.0 36.0 38.0 30.6 38.0 135-139 35.1563 38.0 36.0 38.0 29.6 38.0 140-144 34.7476 38.0 35.0 38.0 27.8 38.0 145-149 34.20005 38.0 35.0 38.0 25.4 38.0 150-151 30.999125 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 0.0 15 0.0 16 1.0 17 7.0 18 3.0 19 1.0 20 7.0 21 2.0 22 4.0 23 5.0 24 9.0 25 15.0 26 19.0 27 15.0 28 26.0 29 28.0 30 38.0 31 51.0 32 66.0 33 86.0 34 142.0 35 228.0 36 637.0 37 2606.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.12821820035687 13.382615345398928 12.388478205455009 35.10068824878919 2 22.25 14.975 33.85 28.925 3 19.075 21.6 27.325 32.0 4 21.925 27.275 23.5 27.3 5 22.625 32.875 23.0 21.5 6 20.474999999999998 34.849999999999994 23.474999999999998 21.2 7 15.7 27.875 39.475 16.950000000000003 8 19.525000000000002 26.8 29.425 24.25 9 16.075 26.625 32.15 25.15 10-14 19.905 29.425 26.950000000000003 23.72 15-19 19.445 28.410000000000004 27.85 24.295 20-24 19.535 29.060000000000002 27.425 23.98 25-29 19.415 29.12 27.860000000000003 23.605 30-34 20.066003300165008 29.091454572728637 27.406370318515926 23.43617180859043 35-39 20.458068710306545 29.189378406761012 26.704005600840127 23.648547282092313 40-44 20.044999999999998 28.515 27.185 24.255 45-49 20.57 28.21 27.169999999999998 24.05 50-54 20.01 28.535 27.639999999999997 23.815 55-59 20.54 28.360000000000003 27.235 23.865 60-64 20.23 28.9 27.015 23.855 65-69 20.4 29.099999999999998 26.665 23.835 70-74 19.955000000000002 28.74 27.02 24.285 75-79 19.845 29.01 27.07 24.075 80-84 20.84 28.499999999999996 26.450000000000003 24.21 85-89 20.77 28.499999999999996 26.834999999999997 23.895 90-94 21.005 28.22 26.525 24.25 95-99 20.265 28.875 27.060000000000002 23.799999999999997 100-104 20.695 28.515 27.04 23.75 105-109 20.645 28.355000000000004 26.88 24.12 110-114 20.5 28.050000000000004 27.24 24.21 115-119 20.369999999999997 27.96 27.084999999999997 24.585 120-124 21.43 27.589999999999996 26.595000000000002 24.385 125-129 20.495 28.065 27.155 24.285 130-134 20.935000000000002 28.18 27.105 23.78 135-139 20.981049052452622 27.631381569078457 27.591379568978446 23.796189809490475 140-144 21.065 27.68 27.35 23.905 145-149 20.855 28.115000000000002 27.095000000000002 23.935000000000002 150-151 21.087500000000002 27.425 26.950000000000003 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 1.5 24 3.0 25 2.5 26 4.5 27 7.5 28 8.5 29 14.0 30 20.0 31 28.5 32 39.0 33 45.5 34 52.5 35 67.0 36 89.0 37 104.0 38 117.0 39 131.0 40 153.5 41 205.0 42 227.5 43 240.5 44 268.0 45 278.5 46 266.0 47 249.5 48 246.5 49 223.0 50 191.0 51 151.5 52 118.5 53 104.0 54 90.5 55 77.5 56 52.5 57 29.5 58 22.5 59 16.5 60 10.0 61 8.0 62 6.0 63 4.0 64 3.5 65 5.5 66 4.5 67 0.5 68 2.0 69 3.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.7875000000000001 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.0750000000000002 0.0 0.0 0.0 0.0 128-129 1.2374999999999998 0.0 0.0 0.0 0.0 130-131 1.45 0.0 0.0 0.0 0.0 132-133 1.825 0.0 0.0 0.0 0.0 134-135 2.05 0.0 0.0 0.0 0.0 136-137 2.2125 0.0 0.0 0.0 0.0 138-139 2.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAATC 10 0.006836113 144.9625 4 >>END_MODULE SRR7168986 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168986_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0175 33.0 33.0 34.0 32.0 34.0 2 33.099 34.0 33.0 34.0 33.0 34.0 3 33.1245 34.0 33.0 34.0 33.0 34.0 4 33.108 34.0 33.0 34.0 33.0 34.0 5 33.088 34.0 33.0 34.0 33.0 34.0 6 37.33675 38.0 38.0 38.0 37.0 38.0 7 37.3115 38.0 38.0 38.0 37.0 38.0 8 37.3245 38.0 38.0 38.0 37.0 38.0 9 37.288 38.0 38.0 38.0 37.0 38.0 10-14 37.22425 38.0 38.0 38.0 37.0 38.0 15-19 37.2094 38.0 38.0 38.0 37.0 38.0 20-24 37.14345 38.0 38.0 38.0 37.0 38.0 25-29 37.0798 38.0 38.0 38.0 37.0 38.0 30-34 37.1491 38.0 38.0 38.0 37.0 38.0 35-39 37.065450000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.0692 38.0 38.0 38.0 37.0 38.0 45-49 37.05435 38.0 38.0 38.0 37.0 38.0 50-54 37.006299999999996 38.0 38.0 38.0 36.8 38.0 55-59 36.94815 38.0 38.0 38.0 36.4 38.0 60-64 36.938900000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.790350000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.717150000000004 38.0 38.0 38.0 35.4 38.0 75-79 36.654250000000005 38.0 38.0 38.0 35.4 38.0 80-84 36.5972 38.0 38.0 38.0 35.2 38.0 85-89 36.490750000000006 38.0 38.0 38.0 34.6 38.0 90-94 36.4363 38.0 38.0 38.0 34.4 38.0 95-99 36.33905 38.0 38.0 38.0 34.2 38.0 100-104 36.20235 38.0 38.0 38.0 34.0 38.0 105-109 36.09885 38.0 38.0 38.0 33.8 38.0 110-114 35.84795 38.0 38.0 38.0 33.0 38.0 115-119 35.72515 38.0 37.0 38.0 32.6 38.0 120-124 35.45615 38.0 37.0 38.0 31.0 38.0 125-129 35.165800000000004 38.0 36.2 38.0 29.0 38.0 130-134 34.879850000000005 38.0 36.0 38.0 27.8 38.0 135-139 34.554700000000004 38.0 35.4 38.0 26.2 38.0 140-144 34.09125 38.0 35.0 38.0 23.2 38.0 145-149 33.623599999999996 38.0 34.6 38.0 20.8 38.0 150-151 29.549999999999997 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 2.0 5 3.0 6 3.0 7 2.0 8 2.0 9 2.0 10 3.0 11 6.0 12 2.0 13 4.0 14 4.0 15 1.0 16 2.0 17 4.0 18 3.0 19 5.0 20 5.0 21 4.0 22 18.0 23 16.0 24 7.0 25 11.0 26 21.0 27 20.0 28 26.0 29 38.0 30 36.0 31 40.0 32 68.0 33 89.0 34 131.0 35 201.0 36 577.0 37 2637.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.25 21.099999999999998 16.150000000000002 26.5 2 26.575 26.8 28.375 18.25 3 21.025 29.349999999999998 29.925 19.7 4 24.875 34.675 21.425 19.025 5 23.849999999999998 35.175 22.75 18.224999999999998 6 21.6 35.699999999999996 24.425 18.275 7 20.150000000000002 20.95 37.2 21.7 8 23.400000000000002 25.4 26.375 24.825 9 22.7 25.974999999999998 28.449999999999996 22.875 10-14 24.25 27.810000000000002 25.995 21.945 15-19 24.060000000000002 27.855 27.284999999999997 20.8 20-24 23.575 28.055000000000003 27.175 21.195 25-29 24.060000000000002 28.325 26.515 21.099999999999998 30-34 23.265 27.855 27.755000000000003 21.125 35-39 23.64 28.244999999999997 26.765 21.349999999999998 40-44 23.57 28.134999999999998 26.88 21.415 45-49 23.605 27.805000000000003 27.485 21.105 50-54 23.919999999999998 28.189999999999998 26.935 20.955 55-59 23.7 27.74 27.474999999999998 21.085 60-64 23.835 27.744999999999997 27.560000000000002 20.86 65-69 24.104999999999997 27.405 27.495000000000005 20.995 70-74 24.169999999999998 27.955000000000002 27.089999999999996 20.785 75-79 24.145 27.150000000000002 28.03 20.674999999999997 80-84 23.345 27.860000000000003 27.925 20.87 85-89 24.36 27.744999999999997 26.68 21.215 90-94 23.45 28.1 27.47 20.979999999999997 95-99 23.919999999999998 27.35 27.415 21.315 100-104 23.915 27.439999999999998 27.675 20.97 105-109 24.07 27.125 27.765 21.04 110-114 23.849999999999998 27.08 28.22 20.849999999999998 115-119 23.905 27.77 27.889999999999997 20.435 120-124 24.11 26.99 28.08 20.82 125-129 24.55 27.38 27.73 20.34 130-134 24.224999999999998 27.37 27.700000000000003 20.705000000000002 135-139 23.919999999999998 27.095000000000002 27.495000000000005 21.490000000000002 140-144 23.830000000000002 27.295 28.275 20.599999999999998 145-149 24.169999999999998 27.21 27.939999999999998 20.68 150-151 24.0625 27.6125 27.474999999999998 20.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.0 26 1.0 27 2.0 28 3.0 29 4.5 30 7.5 31 13.0 32 16.5 33 22.0 34 25.0 35 35.0 36 59.0 37 80.0 38 113.0 39 158.5 40 192.5 41 218.0 42 245.5 43 271.5 44 293.5 45 299.5 46 284.0 47 267.0 48 247.5 49 220.0 50 192.5 51 162.5 52 131.5 53 106.5 54 84.0 55 61.5 56 42.5 57 30.0 58 24.5 59 19.0 60 12.5 61 11.5 62 9.5 63 5.5 64 6.0 65 5.0 66 2.0 67 1.0 68 1.5 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.1625 0.0 0.0 0.0 0.0 130-131 1.3625 0.0 0.0 0.0 0.0 132-133 1.725 0.0 0.0 0.0 0.0 134-135 1.975 0.0 0.0 0.0 0.0 136-137 2.1125 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCATCC 10 0.006830828 145.0 5 GTTATAC 10 0.006830828 145.0 1 >>END_MODULE Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700132 spots for SRR7168986.sra Written 700132 spots for SRR7168986.sra Read 700138 spots for SRR7168986.sra Written 700138 spots for SRR7168986.sra SRR ids: ['SRR7168986.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pbmhfdbw SRR7168986.sra spots: 14002646 blocks: [[1, 700132], [700133, 1400264], [1400265, 2100396], [2100397, 2800528], [2800529, 3500660], [3500661, 4200792], [4200793, 4900924], [4900925, 5601056], [5601057, 6301188], [6301189, 7001320], [7001321, 7701452], [7701453, 8401584], [8401585, 9101716], [9101717, 9801848], [9801849, 10501980], [10501981, 11202112], [11202113, 11902244], [11902245, 12602376], [12602377, 13302508], [13302509, 14002646]] SRR7168986 file size 4723336 SRR7168986 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168986 SRR7168986_1.fastq SRR7168986_2.fastq Input file: SRR7168986_1.fastq Paired file: SRR7168986_2.fastq trimmed: SRR7168986-trimmed-pair1.fastq, SRR7168986-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:25:13 2025 >> started Mon Feb 10 14:25:36 2025 >> done (23.210s) 14002646 read pairs processed; of these: 21704 ( 0.15%) short read pairs filtered out after trimming by size control 18345 ( 0.13%) empty read pairs filtered out after trimming by size control 13962597 (99.71%) read pairs available; of these: 5430879 (38.90%) trimmed read pairs available after processing 8531718 (61.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 7 0.00% 23 2 0.00% 24 4 0.00% 25 7 0.00% 26 1 0.00% 27 6 0.00% 28 2 0.00% 29 5 0.00% 30 6 0.00% 31 6 0.00% 32 4 0.00% 33 5 0.00% 34 5 0.00% 35 6 0.00% 36 3 0.00% 37 3 0.00% 38 7 0.00% 39 4 0.00% 40 11 0.00% 41 7 0.00% 42 7 0.00% 43 5 0.00% 44 13 0.00% 45 10 0.00% 46 7 0.00% 47 16 0.00% 48 10 0.00% 49 11 0.00% 50 22 0.00% 51 17 0.00% 52 22 0.00% 53 21 0.00% 54 29 0.00% 55 12 0.00% 56 17 0.00% 57 32 0.00% 58 42 0.00% 59 36 0.00% 60 33 0.00% 61 44 0.00% 62 61 0.00% 63 68 0.00% 64 67 0.00% 65 72 0.00% 66 96 0.00% 67 92 0.00% 68 120 0.00% 69 132 0.00% 70 166 0.00% 71 139 0.00% 72 146 0.00% 73 193 0.00% 74 190 0.00% 75 235 0.00% 76 301 0.00% 77 256 0.00% 78 337 0.00% 79 402 0.00% 80 414 0.00% 81 527 0.00% 82 580 0.00% 83 719 0.01% 84 1587 0.01% 85 2238 0.02% 86 2337 0.02% 87 2427 0.02% 88 2532 0.02% 89 2506 0.02% 90 2562 0.02% 91 2686 0.02% 92 2823 0.02% 93 3053 0.02% 94 3063 0.02% 95 3305 0.02% 96 3465 0.02% 97 3582 0.03% 98 4088 0.03% 99 4118 0.03% 100 4430 0.03% 101 4708 0.03% 102 4999 0.04% 103 5426 0.04% 104 5646 0.04% 105 6258 0.04% 106 6747 0.05% 107 6963 0.05% 108 7458 0.05% 109 7811 0.06% 110 8343 0.06% 111 8661 0.06% 112 9315 0.07% 113 10123 0.07% 114 10670 0.08% 115 11566 0.08% 116 12150 0.09% 117 12927 0.09% 118 13724 0.10% 119 14268 0.10% 120 15152 0.11% 121 15518 0.11% 122 16673 0.12% 123 17886 0.13% 124 18945 0.14% 125 20384 0.15% 126 21753 0.16% 127 22829 0.16% 128 24377 0.17% 129 25473 0.18% 130 27459 0.20% 131 29025 0.21% 132 30861 0.22% 133 33281 0.24% 134 35768 0.26% 135 38472 0.28% 136 41147 0.29% 137 44175 0.32% 138 47866 0.34% 139 51565 0.37% 140 57305 0.41% 141 64065 0.46% 142 70484 0.50% 143 80023 0.57% 144 92956 0.67% 145 110160 0.79% 146 136753 0.98% 147 184633 1.32% 148 280822 2.01% 149 555273 3.98% 150 2995402 21.45% 151 8531718 61.10% 13962597 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=44 prefix-density=0.26 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=351.84 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=19.4 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=44 prefix-density=0.20 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=14 fanout-score=54.14 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=12.9 sequence=TGTTGGTGGTGG SRR7168986 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:26:21 Started mapping on | Feb 10 14:26:21 Finished on | Feb 10 14:27:45 Mapping speed, Million of reads per hour | 598.40 Number of input reads | 13962597 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13111079 Uniquely mapped reads % | 93.90% Average mapped length | 296.93 Number of splices: Total | 12144054 Number of splices: Annotated (sjdb) | 11951822 Number of splices: GT/AG | 11973775 Number of splices: GC/AG | 134820 Number of splices: AT/AC | 10507 Number of splices: Non-canonical | 24952 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 248244 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 29972 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 621719 621719 621719 N_multimapping 248244 248244 248244 N_noFeature 259855 12956420 317013 N_ambiguous 148779 943 50602 UnstrandedReadsAssigned:12702445 PositiveStrandReadsAssigned:153716 NegativeStrandReadsAssigned:12743464 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168986 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168986-trimmed-pair1.fastq SRR7168986-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,962,597 reads, 12,675,983 reads pseudoaligned [quant] estimated average fragment length: 256.02 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR7168986.ke.tsv 34699 SRR7168986.se.tsv 87100 total ==> SRR7168986.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.98 231 8.85246 Potri.005G024800.1.v4.1 1035 779.98 24 2.07887 Potri.004G059700.1.v4.1 961 706.012 0 0 Potri.007G009000.2.v4.1 1416 1160.98 0 0 Potri.003G141000.2.v4.1 2943 2687.98 195 4.90126 Potri.016G087400.1.v4.1 270 67.5043 1276.68 1277.76 Potri.015G069301.1.v4.1 564 313.285 0 0 Potri.010G195200.1.v4.1 1773 1517.98 17 0.756628 Potri.012G127500.1.v4.1 977 721.999 7461 698.168 ==> SRR7168986.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 776 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7168986 completed mapping pipeline successfully