Starting /dee2/code/volunteer_pipeline.sh SRR7168987 current disk space = 3059079565312 free memory = 1339783568 SRR7168987 SRAfilesize ca26d75301bf2ac221b9d6ce005fbfa1 SRR7168987.sra SRR7168987.sra file validated SRR7168987 is paired end SRR7168987 is conventional basespace SRR7168987 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168987_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.023 34.0 34.0 34.0 33.0 34.0 2 33.389 34.0 34.0 34.0 33.0 34.0 3 33.492 34.0 34.0 34.0 33.0 34.0 4 33.52575 34.0 34.0 34.0 33.0 34.0 5 33.45875 34.0 34.0 34.0 33.0 34.0 6 37.24175 38.0 38.0 38.0 36.0 38.0 7 37.4855 38.0 38.0 38.0 37.0 38.0 8 37.54475 38.0 38.0 38.0 38.0 38.0 9 37.587 38.0 38.0 38.0 38.0 38.0 10-14 37.5696 38.0 38.0 38.0 38.0 38.0 15-19 37.56465 38.0 38.0 38.0 38.0 38.0 20-24 37.557050000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.541999999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.5055 38.0 38.0 38.0 37.8 38.0 35-39 37.402550000000005 38.0 38.0 38.0 37.2 38.0 40-44 37.29105 38.0 38.0 38.0 37.0 38.0 45-49 37.2856 38.0 38.0 38.0 37.0 38.0 50-54 37.196600000000004 38.0 38.0 38.0 36.4 38.0 55-59 37.15815 38.0 38.0 38.0 36.0 38.0 60-64 37.13635000000001 38.0 38.0 38.0 36.0 38.0 65-69 37.10705 38.0 38.0 38.0 36.0 38.0 70-74 37.090999999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.96155 38.0 38.0 38.0 36.0 38.0 80-84 36.9655 38.0 38.0 38.0 36.0 38.0 85-89 36.872400000000006 38.0 38.0 38.0 35.4 38.0 90-94 36.81165 38.0 38.0 38.0 35.0 38.0 95-99 36.671049999999994 38.0 38.0 38.0 34.4 38.0 100-104 36.55925 38.0 38.0 38.0 34.2 38.0 105-109 36.38525 38.0 38.0 38.0 34.0 38.0 110-114 36.18895 38.0 37.4 38.0 33.6 38.0 115-119 36.01975 38.0 37.0 38.0 33.0 38.0 120-124 35.88585 38.0 37.0 38.0 33.0 38.0 125-129 35.699349999999995 38.0 37.0 38.0 31.6 38.0 130-134 35.46385 38.0 36.0 38.0 31.0 38.0 135-139 35.22924999999999 38.0 36.0 38.0 30.6 38.0 140-144 34.875750000000004 38.0 35.6 38.0 28.2 38.0 145-149 34.1671 38.0 35.0 38.0 24.8 38.0 150-151 31.047250000000002 36.5 31.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 5.0 17 2.0 18 4.0 19 1.0 20 3.0 21 5.0 22 2.0 23 5.0 24 11.0 25 9.0 26 15.0 27 27.0 28 23.0 29 31.0 30 33.0 31 41.0 32 64.0 33 74.0 34 122.0 35 240.0 36 633.0 37 2646.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.95296211543351 15.001271294177473 7.958301550978897 32.08746503941012 2 22.925 16.25 34.425 26.400000000000002 3 19.075 22.175 28.075 30.675 4 21.25 29.2 25.45 24.099999999999998 5 23.080770192548137 33.33333333333333 23.080770192548137 20.505126281570394 6 19.45 34.300000000000004 24.85 21.4 7 15.275 26.825 41.0 16.900000000000002 8 17.2 25.650000000000002 29.299999999999997 27.85 9 17.375 24.349999999999998 33.575 24.7 10-14 19.85 29.325000000000003 26.955000000000002 23.87 15-19 19.29 29.270000000000003 27.13 24.310000000000002 20-24 19.945 28.88 27.205000000000002 23.97 25-29 19.645000000000003 28.904999999999998 27.48 23.97 30-34 19.970998549927497 28.926446322316117 27.396369818490925 23.70618530926546 35-39 20.01800270040506 28.46927039055858 27.524128619292892 23.98859828974346 40-44 20.146007300365017 28.48142407120356 27.611380569028455 23.761188059402972 45-49 20.235 28.82 26.86 24.085 50-54 20.125 28.24 27.49 24.145 55-59 20.306015300765036 28.241412070603527 27.376368818440923 24.07620381019051 60-64 20.19 28.645 27.139999999999997 24.025 65-69 19.845 28.255000000000003 27.855 24.044999999999998 70-74 20.235 29.294999999999998 26.55 23.919999999999998 75-79 20.29 28.22 27.495000000000005 23.995 80-84 20.47 28.08 26.955000000000002 24.495 85-89 20.605 27.815 27.71 23.87 90-94 20.705000000000002 28.035 27.13 24.13 95-99 20.085 27.83 27.82 24.265 100-104 20.345 28.810000000000002 26.945000000000004 23.9 105-109 20.29 27.675 27.27 24.765 110-114 20.22 28.360000000000003 27.605 23.815 115-119 20.275000000000002 28.199999999999996 27.29 24.235 120-124 20.4 27.355 27.955000000000002 24.29 125-129 20.244999999999997 27.939999999999998 27.72 24.095 130-134 20.87 27.944999999999997 27.38 23.805 135-139 20.38101905095255 27.531376568828442 27.466373318665934 24.62123106155308 140-144 20.64 28.084999999999997 27.544999999999998 23.73 145-149 20.78 28.294999999999998 26.38 24.545 150-151 20.925 27.3125 27.5125 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.5 24 4.0 25 4.5 26 3.0 27 5.5 28 8.5 29 10.5 30 16.5 31 22.0 32 31.5 33 43.5 34 50.0 35 59.5 36 79.5 37 106.0 38 129.5 39 154.5 40 174.5 41 197.0 42 240.0 43 254.0 44 262.0 45 271.5 46 275.5 47 268.0 48 235.5 49 220.5 50 190.5 51 151.5 52 121.0 53 96.0 54 87.0 55 66.0 56 37.5 57 28.5 58 21.5 59 14.5 60 15.5 61 11.5 62 5.0 63 2.5 64 2.0 65 2.5 66 3.5 67 4.0 68 1.5 69 1.0 70 1.5 71 0.5 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.015 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.025 0.0 0.0 0.0 92-93 0.0875 0.025 0.0 0.0 0.0 94-95 0.1 0.025 0.0 0.0 0.0 96-97 0.1 0.025 0.0 0.0 0.0 98-99 0.15 0.025 0.0 0.0 0.0 100-101 0.2 0.025 0.0 0.0 0.0 102-103 0.21250000000000002 0.025 0.0 0.0 0.0 104-105 0.25 0.025 0.0 0.0 0.0 106-107 0.35 0.025 0.0 0.0 0.0 108-109 0.4 0.025 0.0 0.0 0.0 110-111 0.4625 0.025 0.0 0.0 0.0 112-113 0.5874999999999999 0.025 0.0 0.0 0.0 114-115 0.6 0.025 0.0 0.0 0.0 116-117 0.675 0.025 0.0 0.0 0.0 118-119 0.75 0.025 0.0 0.0 0.0 120-121 0.825 0.025 0.0 0.0 0.0 122-123 0.9125 0.025 0.0 0.0 0.0 124-125 1.075 0.025 0.0 0.0 0.0 126-127 1.1875 0.025 0.0 0.0 0.0 128-129 1.3625 0.025 0.0 0.0 0.0 130-131 1.625 0.025 0.0 0.0 0.0 132-133 1.925 0.025 0.0 0.0 0.0 134-135 2.075 0.025 0.0 0.0 0.0 136-137 2.3375 0.025 0.0 0.0 0.0 138-139 2.6500000000000004 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168987 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168987_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03725 33.0 33.0 34.0 32.0 34.0 2 33.16025 34.0 33.0 34.0 33.0 34.0 3 33.16825 34.0 33.0 34.0 33.0 34.0 4 33.159 34.0 33.0 34.0 33.0 34.0 5 33.17325 34.0 33.0 34.0 33.0 34.0 6 37.402 38.0 38.0 38.0 37.0 38.0 7 37.347 38.0 38.0 38.0 38.0 38.0 8 37.375 38.0 38.0 38.0 38.0 38.0 9 37.33025 38.0 38.0 38.0 38.0 38.0 10-14 37.29145 38.0 38.0 38.0 37.2 38.0 15-19 37.27055 38.0 38.0 38.0 37.2 38.0 20-24 37.199 38.0 38.0 38.0 37.0 38.0 25-29 37.1673 38.0 38.0 38.0 37.0 38.0 30-34 37.197050000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.132999999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.153 38.0 38.0 38.0 37.0 38.0 45-49 37.10085 38.0 38.0 38.0 37.0 38.0 50-54 37.071749999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.061249999999994 38.0 38.0 38.0 36.8 38.0 60-64 36.9822 38.0 38.0 38.0 36.4 38.0 65-69 36.8673 38.0 38.0 38.0 35.8 38.0 70-74 36.7904 38.0 38.0 38.0 36.0 38.0 75-79 36.78 38.0 38.0 38.0 36.0 38.0 80-84 36.68215 38.0 38.0 38.0 35.4 38.0 85-89 36.56275 38.0 38.0 38.0 35.0 38.0 90-94 36.463049999999996 38.0 38.0 38.0 34.4 38.0 95-99 36.334050000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.192949999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.12365 38.0 38.0 38.0 34.0 38.0 110-114 35.92560000000001 38.0 37.8 38.0 33.2 38.0 115-119 35.73055 38.0 37.2 38.0 32.4 38.0 120-124 35.4334 38.0 37.0 38.0 30.6 38.0 125-129 35.2735 38.0 36.2 38.0 30.6 38.0 130-134 34.8801 38.0 36.0 38.0 28.0 38.0 135-139 34.54365 38.0 35.6 38.0 26.4 38.0 140-144 34.1779 38.0 35.0 38.0 24.2 38.0 145-149 33.58895 38.0 34.6 38.0 19.6 38.0 150-151 29.396625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 3.0 5 2.0 6 1.0 7 2.0 8 2.0 9 0.0 10 1.0 11 1.0 12 4.0 13 1.0 14 2.0 15 3.0 16 5.0 17 5.0 18 2.0 19 3.0 20 8.0 21 10.0 22 17.0 23 14.0 24 8.0 25 11.0 26 14.0 27 25.0 28 25.0 29 20.0 30 40.0 31 51.0 32 64.0 33 89.0 34 111.0 35 233.0 36 556.0 37 2658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.2 23.575 10.575 22.650000000000002 2 27.150000000000002 26.150000000000002 30.599999999999998 16.1 3 20.150000000000002 29.7 31.075000000000003 19.075 4 23.674999999999997 35.0 23.425 17.9 5 24.474999999999998 37.025000000000006 21.55 16.950000000000003 6 21.55 37.55 22.575 18.325 7 20.150000000000002 23.474999999999998 37.275000000000006 19.1 8 21.875 25.724999999999998 25.174999999999997 27.224999999999998 9 21.25 25.825 29.225 23.7 10-14 23.925 28.615000000000002 26.025 21.435000000000002 15-19 23.605 28.345 26.995 21.055 20-24 23.485 27.72 26.790000000000003 22.005 25-29 23.73 27.925 27.24 21.105 30-34 23.195 28.249999999999996 27.750000000000004 20.805 35-39 24.05 27.43 27.18 21.34 40-44 23.369999999999997 28.084999999999997 27.13 21.415 45-49 23.915 27.900000000000002 27.18 21.005 50-54 23.515 28.189999999999998 27.165 21.13 55-59 23.73 28.144999999999996 27.560000000000002 20.565 60-64 23.155 28.139999999999997 27.73 20.974999999999998 65-69 24.505 27.42 27.805000000000003 20.27 70-74 23.49 27.944999999999997 27.62 20.945 75-79 24.215 28.139999999999997 27.165 20.48 80-84 23.825 27.994999999999997 27.1 21.08 85-89 24.529999999999998 27.185 27.6 20.685000000000002 90-94 23.935000000000002 27.025 28.144999999999996 20.895 95-99 24.29 27.675 27.915 20.119999999999997 100-104 24.345 27.73 27.775 20.150000000000002 105-109 24.4 26.939999999999998 28.18 20.48 110-114 24.154999999999998 27.560000000000002 27.73 20.555 115-119 24.205 27.595 27.72 20.48 120-124 24.625 27.150000000000002 27.715 20.51 125-129 24.38 27.99 27.250000000000004 20.380000000000003 130-134 24.08 27.779999999999998 27.395000000000003 20.745 135-139 24.745 27.400000000000002 27.36 20.495 140-144 24.335 27.85 27.495000000000005 20.32 145-149 24.545 28.139999999999997 27.07 20.244999999999997 150-151 25.124999999999996 27.3875 27.1 20.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 2.5 26 2.0 27 0.5 28 0.5 29 3.0 30 7.0 31 12.0 32 10.5 33 14.5 34 30.0 35 48.0 36 68.0 37 83.5 38 110.5 39 154.5 40 188.5 41 226.0 42 272.5 43 275.0 44 279.0 45 291.5 46 292.0 47 302.0 48 269.0 49 222.0 50 194.0 51 157.5 52 128.5 53 100.0 54 74.5 55 52.5 56 29.5 57 21.5 58 13.5 59 9.5 60 12.5 61 10.5 62 7.0 63 7.0 64 5.0 65 2.0 66 2.0 67 2.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.6625 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.825 0.0 0.0 0.0 0.0 134-135 1.975 0.0 0.0 0.0 0.0 136-137 2.2 0.0 0.0 0.0 0.0 138-139 2.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786142 spots for SRR7168987.sra Written 786142 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra Read 786127 spots for SRR7168987.sra Written 786127 spots for SRR7168987.sra SRR ids: ['SRR7168987.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2hgm3m3e SRR7168987.sra spots: 15722555 blocks: [[1, 786127], [786128, 1572254], [1572255, 2358381], [2358382, 3144508], [3144509, 3930635], [3930636, 4716762], [4716763, 5502889], [5502890, 6289016], [6289017, 7075143], [7075144, 7861270], [7861271, 8647397], [8647398, 9433524], [9433525, 10219651], [10219652, 11005778], [11005779, 11791905], [11791906, 12578032], [12578033, 13364159], [13364160, 14150286], [14150287, 14936413], [14936414, 15722555]] SRR7168987 file size 5306157 SRR7168987 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168987 SRR7168987_1.fastq SRR7168987_2.fastq Input file: SRR7168987_1.fastq Paired file: SRR7168987_2.fastq trimmed: SRR7168987-trimmed-pair1.fastq, SRR7168987-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:00:22 2025 >> started Mon Feb 10 14:00:40 2025 >> done (18.437s) 15722555 read pairs processed; of these: 20798 ( 0.13%) short read pairs filtered out after trimming by size control 13243 ( 0.08%) empty read pairs filtered out after trimming by size control 15688514 (99.78%) read pairs available; of these: 6103193 (38.90%) trimmed read pairs available after processing 9585321 (61.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 3 0.00% 21 8 0.00% 22 8 0.00% 23 6 0.00% 24 2 0.00% 25 8 0.00% 26 12 0.00% 27 10 0.00% 28 5 0.00% 29 11 0.00% 30 9 0.00% 31 4 0.00% 32 6 0.00% 33 3 0.00% 34 7 0.00% 35 11 0.00% 36 6 0.00% 37 6 0.00% 38 8 0.00% 39 11 0.00% 40 8 0.00% 41 4 0.00% 42 13 0.00% 43 5 0.00% 44 11 0.00% 45 8 0.00% 46 18 0.00% 47 15 0.00% 48 11 0.00% 49 20 0.00% 50 19 0.00% 51 26 0.00% 52 16 0.00% 53 23 0.00% 54 28 0.00% 55 32 0.00% 56 34 0.00% 57 37 0.00% 58 46 0.00% 59 53 0.00% 60 51 0.00% 61 66 0.00% 62 70 0.00% 63 92 0.00% 64 88 0.00% 65 95 0.00% 66 102 0.00% 67 108 0.00% 68 138 0.00% 69 186 0.00% 70 226 0.00% 71 216 0.00% 72 229 0.00% 73 257 0.00% 74 308 0.00% 75 334 0.00% 76 359 0.00% 77 342 0.00% 78 447 0.00% 79 545 0.00% 80 597 0.00% 81 716 0.00% 82 755 0.00% 83 973 0.01% 84 1880 0.01% 85 2397 0.02% 86 2513 0.02% 87 2661 0.02% 88 2806 0.02% 89 2863 0.02% 90 3053 0.02% 91 3177 0.02% 92 3179 0.02% 93 3529 0.02% 94 3728 0.02% 95 4043 0.03% 96 4168 0.03% 97 4273 0.03% 98 4588 0.03% 99 4978 0.03% 100 5252 0.03% 101 5531 0.04% 102 6052 0.04% 103 6409 0.04% 104 6919 0.04% 105 7360 0.05% 106 7814 0.05% 107 8263 0.05% 108 8324 0.05% 109 8890 0.06% 110 9441 0.06% 111 10039 0.06% 112 10807 0.07% 113 11674 0.07% 114 12502 0.08% 115 13299 0.08% 116 14062 0.09% 117 14659 0.09% 118 15423 0.10% 119 15884 0.10% 120 17079 0.11% 121 17924 0.11% 122 18831 0.12% 123 20403 0.13% 124 22015 0.14% 125 23514 0.15% 126 24780 0.16% 127 26536 0.17% 128 27374 0.17% 129 29032 0.19% 130 30724 0.20% 131 32771 0.21% 132 35446 0.23% 133 37973 0.24% 134 40992 0.26% 135 44273 0.28% 136 47485 0.30% 137 51026 0.33% 138 55532 0.35% 139 59164 0.38% 140 64719 0.41% 141 72317 0.46% 142 79747 0.51% 143 91613 0.58% 144 106090 0.68% 145 123997 0.79% 146 154651 0.99% 147 208017 1.33% 148 314673 2.01% 149 618228 3.94% 150 3345944 21.33% 151 9585321 61.10% 15688514 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=12.50 fanout-score-rank=7 prefix-density=0.43 prefix-fanout=6.6 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=201.65 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.60 fanout-score-rank=18 prefix-density=0.34 prefix-fanout=4.1 sequence=CAGTTTGTTGACTGGTGCCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=54.45 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.2 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7168987 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:01:31 Started mapping on | Feb 10 14:01:31 Finished on | Feb 10 14:03:03 Mapping speed, Million of reads per hour | 613.90 Number of input reads | 15688514 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14846058 Uniquely mapped reads % | 94.63% Average mapped length | 296.90 Number of splices: Total | 14138624 Number of splices: Annotated (sjdb) | 13923437 Number of splices: GT/AG | 13944184 Number of splices: GC/AG | 157651 Number of splices: AT/AC | 10490 Number of splices: Non-canonical | 26299 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 277216 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 85554 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 583151 583151 583151 N_multimapping 277216 277216 277216 N_noFeature 252012 14673817 321774 N_ambiguous 162307 774 59353 UnstrandedReadsAssigned:14431739 PositiveStrandReadsAssigned:171467 NegativeStrandReadsAssigned:14464931 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168987 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168987-trimmed-pair1.fastq SRR7168987-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,688,514 reads, 14,397,046 reads pseudoaligned [quant] estimated average fragment length: 257.859 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR7168987.ke.tsv 34699 SRR7168987.se.tsv 87100 total ==> SRR7168987.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.14 216 7.51775 Potri.005G024800.1.v4.1 1035 778.141 24 1.89052 Potri.004G059700.1.v4.1 961 704.209 1 0.0870415 Potri.007G009000.2.v4.1 1416 1159.14 0 0 Potri.003G141000.2.v4.1 2943 2686.14 253.065 5.77472 Potri.016G087400.1.v4.1 270 68.6218 1782.51 1592.2 Potri.015G069301.1.v4.1 564 313.267 0 0 Potri.010G195200.1.v4.1 1773 1516.14 14 0.566001 Potri.012G127500.1.v4.1 977 720.175 4574 389.302 ==> SRR7168987.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1273 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 220 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168987 completed mapping pipeline successfully