Starting /dee2/code/volunteer_pipeline.sh SRR7168988 current disk space = 3059125485568 free memory = 1478429916 SRR7168988 SRAfilesize 17bb3ce08fc8e158990e6efaf2eea559 SRR7168988.sra SRR7168988.sra file validated SRR7168988 is paired end SRR7168988 is conventional basespace SRR7168988 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168988_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18375 34.0 34.0 34.0 33.0 34.0 2 33.50575 34.0 34.0 34.0 33.0 34.0 3 33.5405 34.0 34.0 34.0 33.0 34.0 4 33.51625 34.0 34.0 34.0 33.0 34.0 5 33.5035 34.0 34.0 34.0 33.0 34.0 6 37.2145 38.0 38.0 38.0 36.0 38.0 7 37.475 38.0 38.0 38.0 37.0 38.0 8 37.4865 38.0 38.0 38.0 37.0 38.0 9 37.569 38.0 38.0 38.0 38.0 38.0 10-14 37.52505 38.0 38.0 38.0 38.0 38.0 15-19 37.5477 38.0 38.0 38.0 38.0 38.0 20-24 37.595349999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.54065000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.54145 38.0 38.0 38.0 38.0 38.0 35-39 37.43805 38.0 38.0 38.0 37.0 38.0 40-44 37.342 38.0 38.0 38.0 37.0 38.0 45-49 37.2876 38.0 38.0 38.0 37.0 38.0 50-54 37.257000000000005 38.0 38.0 38.0 36.6 38.0 55-59 37.2022 38.0 38.0 38.0 36.4 38.0 60-64 37.1674 38.0 38.0 38.0 36.0 38.0 65-69 37.184349999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.07285 38.0 38.0 38.0 36.0 38.0 75-79 37.03505 38.0 38.0 38.0 36.0 38.0 80-84 36.99665 38.0 38.0 38.0 36.0 38.0 85-89 36.8919 38.0 38.0 38.0 35.4 38.0 90-94 36.8157 38.0 38.0 38.0 35.2 38.0 95-99 36.754000000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.61465 38.0 38.0 38.0 34.2 38.0 105-109 36.54325 38.0 38.0 38.0 34.2 38.0 110-114 36.35515 38.0 37.6 38.0 33.8 38.0 115-119 36.26055 38.0 37.4 38.0 33.8 38.0 120-124 36.15935 38.0 37.4 38.0 33.4 38.0 125-129 35.88335 38.0 36.8 38.0 32.2 38.0 130-134 35.78215 38.0 36.4 38.0 32.2 38.0 135-139 35.5663 38.0 36.0 38.0 31.2 38.0 140-144 35.03295 38.0 35.6 38.0 29.8 38.0 145-149 34.7008 38.0 35.4 38.0 29.2 38.0 150-151 31.837375 36.5 32.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 4.0 18 2.0 19 2.0 20 5.0 21 1.0 22 5.0 23 2.0 24 4.0 25 14.0 26 17.0 27 18.0 28 24.0 29 37.0 30 30.0 31 46.0 32 53.0 33 74.0 34 117.0 35 208.0 36 566.0 37 2770.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.908998988877656 11.147623862487361 9.35288169868554 44.590495449949444 2 20.925 16.375 36.85 25.85 3 18.85 19.725 25.7 35.725 4 23.225 28.95 21.825 26.0 5 22.425 33.025 24.925 19.625 6 18.3 36.05 26.05 19.6 7 14.549999999999999 25.724999999999998 41.099999999999994 18.625 8 18.25 25.05 31.0 25.7 9 17.349999999999998 23.925 33.775 24.95 10-14 19.835 29.865000000000002 26.915 23.385 15-19 19.77 29.095 27.35 23.785 20-24 20.23 28.985 27.57 23.215 25-29 19.855 28.76 27.51 23.875 30-34 19.856985698569858 28.95789578957896 27.007700770077008 24.17741774177418 35-39 20.455000000000002 28.565 27.865000000000002 23.115 40-44 19.67 28.749999999999996 27.889999999999997 23.69 45-49 20.285 28.565 27.055 24.095 50-54 20.044999999999998 28.82 27.195000000000004 23.94 55-59 20.595 29.054999999999996 27.089999999999996 23.26 60-64 20.28 28.32 27.534999999999997 23.865 65-69 20.235 28.794999999999998 27.425 23.544999999999998 70-74 20.07 29.065 27.744999999999997 23.119999999999997 75-79 20.155 28.275 27.66 23.91 80-84 19.93 28.34 27.33 24.4 85-89 20.05 28.444999999999997 27.639999999999997 23.865 90-94 20.11 28.48 27.72 23.69 95-99 20.595 27.93 27.62 23.855 100-104 20.244999999999997 28.405 27.939999999999998 23.41 105-109 20.65 28.46 27.32 23.57 110-114 20.105 28.544999999999998 27.339999999999996 24.01 115-119 20.02 28.4 27.735 23.845 120-124 20.294999999999998 28.685 27.685 23.335 125-129 20.485 28.4 27.589999999999996 23.525 130-134 20.985 27.905 27.445000000000004 23.665 135-139 20.72 28.95 26.765 23.565 140-144 21.060000000000002 28.01 26.72 24.21 145-149 20.595 27.944999999999997 27.994999999999997 23.465 150-151 19.900000000000002 28.5625 27.775 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 2.0 26 4.0 27 8.0 28 9.0 29 13.5 30 19.0 31 24.0 32 29.0 33 36.0 34 51.5 35 73.5 36 95.5 37 105.0 38 130.5 39 153.5 40 177.5 41 219.5 42 244.0 43 259.5 44 273.5 45 268.0 46 259.5 47 256.0 48 242.0 49 210.5 50 177.0 51 159.5 52 119.0 53 89.5 54 74.5 55 56.5 56 46.0 57 29.0 58 24.5 59 19.0 60 11.0 61 6.5 62 3.0 63 3.5 64 3.0 65 2.5 66 1.5 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.9625 0.0 0.0 0.0 0.0 126-127 1.1124999999999998 0.0 0.0 0.0 0.0 128-129 1.2000000000000002 0.0 0.0 0.0 0.0 130-131 1.4249999999999998 0.0 0.0 0.0 0.0 132-133 1.6124999999999998 0.0 0.0 0.0 0.0 134-135 1.7875 0.0 0.0 0.0 0.0 136-137 1.9875 0.0 0.0 0.0 0.0 138-139 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168988 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168988_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9925 33.0 33.0 34.0 32.0 34.0 2 33.12475 34.0 33.0 34.0 33.0 34.0 3 33.12175 34.0 33.0 34.0 33.0 34.0 4 33.12425 34.0 33.0 34.0 33.0 34.0 5 33.0885 34.0 33.0 34.0 33.0 34.0 6 37.30575 38.0 38.0 38.0 37.0 38.0 7 37.35 38.0 38.0 38.0 37.0 38.0 8 37.37775 38.0 38.0 38.0 37.0 38.0 9 37.39075 38.0 38.0 38.0 38.0 38.0 10-14 37.3284 38.0 38.0 38.0 37.0 38.0 15-19 37.28645 38.0 38.0 38.0 37.0 38.0 20-24 37.229 38.0 38.0 38.0 37.0 38.0 25-29 37.24185 38.0 38.0 38.0 37.0 38.0 30-34 37.2517 38.0 38.0 38.0 37.0 38.0 35-39 37.245400000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.2044 38.0 38.0 38.0 37.0 38.0 45-49 37.18855 38.0 38.0 38.0 37.0 38.0 50-54 37.150400000000005 38.0 38.0 38.0 36.8 38.0 55-59 37.10405 38.0 38.0 38.0 36.6 38.0 60-64 37.0567 38.0 38.0 38.0 36.0 38.0 65-69 36.9891 38.0 38.0 38.0 36.0 38.0 70-74 36.88779999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.871700000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.826350000000005 38.0 38.0 38.0 35.6 38.0 85-89 36.7534 38.0 38.0 38.0 35.2 38.0 90-94 36.64345 38.0 38.0 38.0 34.8 38.0 95-99 36.49985 38.0 38.0 38.0 34.2 38.0 100-104 36.36325 38.0 38.0 38.0 34.0 38.0 105-109 36.2362 38.0 38.0 38.0 33.8 38.0 110-114 36.080650000000006 38.0 38.0 38.0 33.4 38.0 115-119 35.9191 38.0 37.2 38.0 32.6 38.0 120-124 35.7407 38.0 37.0 38.0 32.0 38.0 125-129 35.400800000000004 38.0 36.2 38.0 30.6 38.0 130-134 35.09905 38.0 36.0 38.0 28.4 38.0 135-139 34.765100000000004 38.0 35.4 38.0 28.0 38.0 140-144 34.357350000000004 38.0 35.0 38.0 26.0 38.0 145-149 33.79225 38.0 35.0 38.0 22.6 38.0 150-151 30.447874999999996 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 2.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 3.0 13 0.0 14 3.0 15 4.0 16 4.0 17 3.0 18 0.0 19 3.0 20 5.0 21 5.0 22 12.0 23 11.0 24 9.0 25 12.0 26 20.0 27 26.0 28 26.0 29 39.0 30 23.0 31 63.0 32 52.0 33 103.0 34 136.0 35 207.0 36 599.0 37 2624.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.6 19.15 13.8 33.45 2 25.719289467100324 25.569176882662 33.600200150112585 15.111333500125093 3 20.31563126252505 27.630260521042082 29.684368737474948 22.369739478957914 4 23.1520922074668 34.502630919569036 22.049611626158857 20.29566524680531 5 24.07314629258517 37.24949899799599 21.693386773547093 16.983967935871743 6 19.575 38.65 23.9 17.875 7 19.25 20.775 39.550000000000004 20.424999999999997 8 22.175 24.075 29.275000000000002 24.474999999999998 9 21.25 23.75 30.775000000000002 24.224999999999998 10-14 22.977297729772978 28.872887288728872 26.62766276627663 21.52215221522152 15-19 22.95606924847393 28.039627739417593 27.919543680576403 21.084759331532073 20-24 22.37059264816204 28.71717929482371 27.796949237309327 21.115278819704926 25-29 23.001900570171053 28.178453536060815 27.533259977993396 21.286385915774733 30-34 22.894578915783157 27.850570114022805 28.000600120024004 21.254250850170035 35-39 22.676133806690334 28.066403320166007 27.78138906945347 21.476073803690184 40-44 22.66339950992649 27.679151872780917 28.8593288993349 20.798119717957693 45-49 23.36116805840292 27.31136556827841 28.41142057102855 20.916045802290114 50-54 23.412341234123414 28.06280628062806 27.82278227822782 20.7020702070207 55-59 23.474999999999998 27.825 28.044999999999998 20.655 60-64 22.856142807140355 27.76638831941597 28.471423571178562 20.906045302265113 65-69 23.342334233423344 27.25272527252725 28.64786478647865 20.757075707570756 70-74 23.064999999999998 28.51 27.565 20.86 75-79 23.37116855842792 27.521376068803438 28.0114005700285 21.096054802740134 80-84 23.24732473247325 28.292829282928295 28.002800280028 20.457045704570458 85-89 23.525 27.875 27.744999999999997 20.855 90-94 23.95 27.525 27.96 20.565 95-99 23.56 27.810000000000002 28.249999999999996 20.380000000000003 100-104 23.66 27.345000000000002 28.08 20.915 105-109 23.48 28.48 27.97 20.07 110-114 23.755000000000003 27.855 28.01 20.380000000000003 115-119 24.216210810540527 27.826391319565978 27.69638481924096 20.261013050652533 120-124 23.483522528379257 27.699154873230984 28.194229134370158 20.623093464019604 125-129 23.695 28.294999999999998 27.76 20.25 130-134 23.87 27.865000000000002 27.810000000000002 20.455000000000002 135-139 23.635 27.275 28.189999999999998 20.9 140-144 23.61 28.16 27.810000000000002 20.419999999999998 145-149 24.685000000000002 27.61 27.58 20.125 150-151 23.575 28.287499999999998 27.037499999999998 21.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 3.0 25 4.0 26 3.0 27 5.0 28 10.0 29 9.5 30 7.0 31 13.0 32 20.5 33 34.0 34 45.5 35 57.5 36 75.0 37 93.5 38 129.5 39 166.5 40 205.0 41 243.5 42 274.0 43 284.0 44 289.5 45 296.5 46 278.5 47 259.0 48 239.5 49 208.0 50 162.5 51 128.0 52 114.0 53 89.0 54 70.0 55 56.0 56 35.0 57 25.5 58 20.0 59 11.5 60 5.0 61 7.5 62 5.5 63 1.5 64 3.0 65 3.5 66 3.5 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.2 4 0.22499999999999998 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.06999999999999999 20-24 0.025 25-29 0.03 30-34 0.02 35-39 0.005 40-44 0.015 45-49 0.005 50-54 0.01 55-59 0.0 60-64 0.005 65-69 0.01 70-74 0.0 75-79 0.005 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.5625 0.0 0.0 0.0 0.0 134-135 1.7374999999999998 0.0 0.0 0.0 0.0 136-137 1.9375 0.0 0.0 0.0 0.0 138-139 2.1500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAGGT 10 0.006830828 145.0 6 >>END_MODULE Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871689 spots for SRR7168988.sra Written 871689 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra Read 871678 spots for SRR7168988.sra Written 871678 spots for SRR7168988.sra SRR ids: ['SRR7168988.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z_k_i8bd SRR7168988.sra spots: 17433571 blocks: [[1, 871678], [871679, 1743356], [1743357, 2615034], [2615035, 3486712], [3486713, 4358390], [4358391, 5230068], [5230069, 6101746], [6101747, 6973424], [6973425, 7845102], [7845103, 8716780], [8716781, 9588458], [9588459, 10460136], [10460137, 11331814], [11331815, 12203492], [12203493, 13075170], [13075171, 13946848], [13946849, 14818526], [14818527, 15690204], [15690205, 16561882], [16561883, 17433571]] SRR7168988 file size 5885964 SRR7168988 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168988 SRR7168988_1.fastq SRR7168988_2.fastq Input file: SRR7168988_1.fastq Paired file: SRR7168988_2.fastq trimmed: SRR7168988-trimmed-pair1.fastq, SRR7168988-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:00:55 2025 >> started Mon Feb 10 15:01:16 2025 >> done (21.352s) 17433571 read pairs processed; of these: 9096 ( 0.05%) short read pairs filtered out after trimming by size control 6088 ( 0.03%) empty read pairs filtered out after trimming by size control 17418387 (99.91%) read pairs available; of these: 6719453 (38.58%) trimmed read pairs available after processing 10698934 (61.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 2 0.00% 21 6 0.00% 22 2 0.00% 23 5 0.00% 24 7 0.00% 25 8 0.00% 26 4 0.00% 27 5 0.00% 28 3 0.00% 29 5 0.00% 30 5 0.00% 31 6 0.00% 32 6 0.00% 33 7 0.00% 34 6 0.00% 35 7 0.00% 36 10 0.00% 37 7 0.00% 38 4 0.00% 39 4 0.00% 40 6 0.00% 41 6 0.00% 42 2 0.00% 43 17 0.00% 44 5 0.00% 45 5 0.00% 46 15 0.00% 47 16 0.00% 48 14 0.00% 49 16 0.00% 50 24 0.00% 51 20 0.00% 52 22 0.00% 53 28 0.00% 54 31 0.00% 55 34 0.00% 56 40 0.00% 57 40 0.00% 58 53 0.00% 59 43 0.00% 60 54 0.00% 61 54 0.00% 62 64 0.00% 63 62 0.00% 64 78 0.00% 65 114 0.00% 66 102 0.00% 67 124 0.00% 68 130 0.00% 69 163 0.00% 70 203 0.00% 71 210 0.00% 72 229 0.00% 73 266 0.00% 74 298 0.00% 75 314 0.00% 76 378 0.00% 77 365 0.00% 78 427 0.00% 79 526 0.00% 80 566 0.00% 81 616 0.00% 82 726 0.00% 83 868 0.00% 84 1229 0.01% 85 1567 0.01% 86 1726 0.01% 87 1833 0.01% 88 2055 0.01% 89 2180 0.01% 90 2285 0.01% 91 2502 0.01% 92 2598 0.01% 93 2857 0.02% 94 3189 0.02% 95 3379 0.02% 96 3727 0.02% 97 3823 0.02% 98 4208 0.02% 99 4344 0.02% 100 4743 0.03% 101 5064 0.03% 102 5598 0.03% 103 5721 0.03% 104 6148 0.04% 105 6599 0.04% 106 7130 0.04% 107 7541 0.04% 108 7989 0.05% 109 8531 0.05% 110 8929 0.05% 111 9594 0.06% 112 10088 0.06% 113 10818 0.06% 114 11756 0.07% 115 12667 0.07% 116 13383 0.08% 117 14359 0.08% 118 15183 0.09% 119 15880 0.09% 120 17005 0.10% 121 17989 0.10% 122 19023 0.11% 123 20409 0.12% 124 21413 0.12% 125 23090 0.13% 126 24695 0.14% 127 26514 0.15% 128 27497 0.16% 129 29903 0.17% 130 31702 0.18% 131 34290 0.20% 132 36900 0.21% 133 39548 0.23% 134 42266 0.24% 135 45891 0.26% 136 49950 0.29% 137 54636 0.31% 138 60252 0.35% 139 65973 0.38% 140 72266 0.41% 141 79759 0.46% 142 89635 0.51% 143 102618 0.59% 144 119530 0.69% 145 144826 0.83% 146 179425 1.03% 147 244765 1.41% 148 367601 2.11% 149 725762 4.17% 150 3665606 21.04% 151 10698934 61.42% 17418387 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=43 prefix-density=0.13 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=248.58 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=27.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=35 prefix-density=0.37 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=29 fanout-score=288.81 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=29.5 sequence=AAGAAGAAGAAA SRR7168988 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:02:12 Started mapping on | Feb 10 15:02:12 Finished on | Feb 10 15:03:59 Mapping speed, Million of reads per hour | 586.04 Number of input reads | 17418387 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16803364 Uniquely mapped reads % | 96.47% Average mapped length | 297.27 Number of splices: Total | 16668733 Number of splices: Annotated (sjdb) | 16402716 Number of splices: GT/AG | 16425052 Number of splices: GC/AG | 196593 Number of splices: AT/AC | 13496 Number of splices: Non-canonical | 33592 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307260 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 27356 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 316278 316278 316278 N_multimapping 307260 307260 307260 N_noFeature 400331 16633749 490838 N_ambiguous 149086 1061 69159 UnstrandedReadsAssigned:16253947 PositiveStrandReadsAssigned:168554 NegativeStrandReadsAssigned:16243367 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7168988 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168988-trimmed-pair1.fastq SRR7168988-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,418,387 reads, 16,111,907 reads pseudoaligned [quant] estimated average fragment length: 265.922 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR7168988.ke.tsv 34699 SRR7168988.se.tsv 87100 total ==> SRR7168988.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.08 266 9.22356 Potri.005G024800.1.v4.1 1035 770.078 48 3.789 Potri.004G059700.1.v4.1 961 696.099 0 0 Potri.007G009000.2.v4.1 1416 1151.08 0 0 Potri.003G141000.2.v4.1 2943 2678.08 325.031 7.37768 Potri.016G087400.1.v4.1 270 64.172 1292 1223.87 Potri.015G069301.1.v4.1 564 305.047 0 0 Potri.010G195200.1.v4.1 1773 1508.08 50 2.01542 Potri.012G127500.1.v4.1 977 712.099 7824 667.893 ==> SRR7168988.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1156 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 245 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168988 completed mapping pipeline successfully