Starting /dee2/code/volunteer_pipeline.sh SRR7168989 current disk space = 3058969288704 free memory = 1204055624 SRR7168989 SRAfilesize 627f2ff382c90c88915979ec526aec26 SRR7168989.sra SRR7168989.sra file validated SRR7168989 is paired end SRR7168989 is conventional basespace SRR7168989 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168989_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6455 34.0 33.0 34.0 25.0 34.0 2 32.7125 34.0 33.0 34.0 28.0 34.0 3 32.9085 34.0 33.0 34.0 32.0 34.0 4 33.14025 34.0 33.0 34.0 32.0 34.0 5 33.11025 34.0 33.0 34.0 32.0 34.0 6 36.7435 38.0 37.0 38.0 35.0 38.0 7 37.20725 38.0 38.0 38.0 36.0 38.0 8 37.3205 38.0 38.0 38.0 37.0 38.0 9 37.3815 38.0 38.0 38.0 37.0 38.0 10-14 37.3499 38.0 38.0 38.0 37.0 38.0 15-19 37.37005 38.0 38.0 38.0 37.0 38.0 20-24 37.340050000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.310249999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.312599999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.267700000000005 38.0 38.0 38.0 36.8 38.0 40-44 37.10435 38.0 38.0 38.0 36.0 38.0 45-49 36.93124999999999 38.0 38.0 38.0 35.8 38.0 50-54 36.91185 38.0 38.0 38.0 35.2 38.0 55-59 36.8346 38.0 38.0 38.0 35.0 38.0 60-64 36.7379 38.0 38.0 38.0 34.8 38.0 65-69 36.7204 38.0 38.0 38.0 34.8 38.0 70-74 36.6442 38.0 38.0 38.0 34.2 38.0 75-79 36.55055 38.0 38.0 38.0 34.0 38.0 80-84 36.35455 38.0 38.0 38.0 33.6 38.0 85-89 36.3319 38.0 38.0 38.0 33.8 38.0 90-94 36.246950000000005 38.0 37.8 38.0 33.6 38.0 95-99 36.015899999999995 38.0 37.0 38.0 32.4 38.0 100-104 35.68135 38.0 37.0 38.0 30.6 38.0 105-109 35.55245 38.0 36.4 38.0 29.4 38.0 110-114 35.3981 38.0 36.0 38.0 29.2 38.0 115-119 35.262699999999995 38.0 36.0 38.0 28.4 38.0 120-124 34.55095 38.0 34.6 38.0 25.4 38.0 125-129 34.27045 38.0 34.4 38.0 23.6 38.0 130-134 34.3036 38.0 34.8 38.0 24.0 38.0 135-139 33.9125 38.0 34.2 38.0 23.0 38.0 140-144 33.2137 38.0 33.8 38.0 17.2 38.0 145-149 31.9055 37.8 32.6 38.0 11.4 38.0 150-151 28.478375 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 0.0 14 3.0 15 0.0 16 3.0 17 1.0 18 2.0 19 4.0 20 4.0 21 7.0 22 9.0 23 13.0 24 12.0 25 24.0 26 23.0 27 34.0 28 43.0 29 66.0 30 53.0 31 97.0 32 108.0 33 128.0 34 204.0 35 340.0 36 754.0 37 2065.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.00951862931738 13.353277128093556 7.560511286374762 34.0766929562143 2 22.575 15.8 34.2 27.425 3 19.400000000000002 21.7 27.375 31.525 4 22.7 29.549999999999997 22.55 25.2 5 22.005501375343837 34.03350837709427 22.780695173793447 21.180295073768445 6 19.2 36.175000000000004 24.375 20.25 7 15.024999999999999 25.75 40.5 18.725 8 17.599999999999998 27.150000000000002 30.65 24.6 9 17.25 23.95 34.825 23.974999999999998 10-14 20.68 30.365 25.915 23.04 15-19 19.895 28.499999999999996 27.315 24.29 20-24 20.330000000000002 29.095 27.13 23.445 25-29 20.215 29.69 27.41 22.685 30-34 19.845 28.945 27.48 23.73 35-39 19.935 28.754999999999995 27.29 24.02 40-44 20.044999999999998 29.04 27.47 23.445 45-49 20.369999999999997 28.26 27.775 23.595 50-54 20.64 28.925 26.69 23.745 55-59 20.53 28.78 26.674999999999997 24.015 60-64 20.44 28.794999999999998 27.05 23.715 65-69 20.235 28.68 27.284999999999997 23.799999999999997 70-74 20.5 28.754999999999995 26.845000000000002 23.9 75-79 20.150000000000002 28.395 26.950000000000003 24.505 80-84 20.415 28.115000000000002 27.060000000000002 24.41 85-89 21.4 28.294999999999998 26.900000000000002 23.405 90-94 20.86 28.485 27.18 23.474999999999998 95-99 20.48 28.43 27.189999999999998 23.9 100-104 20.555 28.82 26.85 23.775 105-109 20.765 28.395 27.38 23.46 110-114 20.5 27.495000000000005 27.96 24.044999999999998 115-119 20.685000000000002 28.110000000000003 27.395000000000003 23.810000000000002 120-124 20.96 28.12 27.224999999999998 23.695 125-129 20.815 28.09 27.029999999999998 24.065 130-134 20.82 27.975 27.62 23.585 135-139 20.74 28.015 27.515 23.73 140-144 21.295 27.845 27.235 23.625 145-149 21.349999999999998 28.59 26.895000000000003 23.165 150-151 20.150000000000002 27.825 27.437499999999996 24.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.0 25 3.0 26 2.5 27 7.0 28 14.0 29 18.0 30 19.0 31 28.5 32 36.0 33 41.5 34 57.5 35 70.0 36 82.0 37 108.0 38 132.5 39 151.0 40 175.0 41 193.5 42 214.0 43 255.0 44 270.5 45 258.5 46 266.0 47 263.0 48 235.5 49 205.5 50 185.5 51 158.5 52 117.5 53 99.0 54 92.5 55 61.0 56 38.0 57 31.5 58 23.0 59 21.5 60 14.5 61 7.0 62 6.5 63 4.5 64 2.5 65 5.0 66 7.0 67 5.5 68 2.5 69 1.5 70 1.5 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.075000000000001 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.2625000000000002 0.0 0.0 0.0 0.0 120-121 1.425 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.1 0.0 0.0 0.0 0.0 128-129 2.3499999999999996 0.0 0.0 0.0 0.0 130-131 2.525 0.0 0.0 0.0 0.0 132-133 2.7750000000000004 0.0 0.0 0.0 0.0 134-135 3.175 0.0 0.0 0.0 0.0 136-137 3.5875 0.0 0.0 0.0 0.0 138-139 4.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGATAA 10 0.0068396386 144.9375 9 >>END_MODULE SRR7168989 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168989_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.51925 33.0 33.0 34.0 32.0 34.0 2 32.58325 33.0 33.0 34.0 32.0 34.0 3 32.54825 34.0 33.0 34.0 32.0 34.0 4 32.508 34.0 33.0 34.0 32.0 34.0 5 32.5685 34.0 33.0 34.0 32.0 34.0 6 36.737 38.0 38.0 38.0 36.0 38.0 7 36.77575 38.0 38.0 38.0 36.0 38.0 8 36.76675 38.0 38.0 38.0 36.0 38.0 9 36.76175 38.0 38.0 38.0 36.0 38.0 10-14 36.82455 38.0 38.0 38.0 36.0 38.0 15-19 36.80185 38.0 38.0 38.0 36.0 38.0 20-24 36.7274 38.0 38.0 38.0 36.0 38.0 25-29 36.6574 38.0 38.0 38.0 35.4 38.0 30-34 36.5915 38.0 38.0 38.0 34.8 38.0 35-39 36.63484999999999 38.0 38.0 38.0 35.4 38.0 40-44 36.612849999999995 38.0 38.0 38.0 35.2 38.0 45-49 36.5751 38.0 38.0 38.0 35.2 38.0 50-54 36.499399999999994 38.0 38.0 38.0 34.8 38.0 55-59 36.41105 38.0 38.0 38.0 34.4 38.0 60-64 36.42145 38.0 38.0 38.0 34.2 38.0 65-69 36.27204999999999 38.0 38.0 38.0 34.0 38.0 70-74 36.19530000000001 38.0 38.0 38.0 33.8 38.0 75-79 36.174 38.0 38.0 38.0 33.8 38.0 80-84 36.0165 38.0 38.0 38.0 33.0 38.0 85-89 35.8572 38.0 38.0 38.0 32.2 38.0 90-94 35.81995 38.0 38.0 38.0 31.8 38.0 95-99 35.6272 38.0 37.4 38.0 31.0 38.0 100-104 35.51545 38.0 37.0 38.0 30.2 38.0 105-109 35.443650000000005 38.0 37.0 38.0 30.2 38.0 110-114 35.216649999999994 38.0 36.8 38.0 28.6 38.0 115-119 34.8352 38.0 36.0 38.0 26.4 38.0 120-124 34.8746 38.0 36.0 38.0 27.4 38.0 125-129 34.439 38.0 35.8 38.0 24.4 38.0 130-134 33.89614999999999 38.0 35.0 38.0 21.8 38.0 135-139 33.55785 38.0 35.0 38.0 17.4 38.0 140-144 33.238299999999995 38.0 34.6 38.0 14.8 38.0 145-149 32.461 38.0 33.6 38.0 11.0 38.0 150-151 27.8575 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 2.0 5 1.0 6 2.0 7 1.0 8 3.0 9 3.0 10 2.0 11 2.0 12 2.0 13 3.0 14 5.0 15 5.0 16 4.0 17 6.0 18 10.0 19 13.0 20 17.0 21 17.0 22 14.0 23 23.0 24 23.0 25 23.0 26 40.0 27 34.0 28 38.0 29 38.0 30 66.0 31 68.0 32 67.0 33 113.0 34 177.0 35 232.0 36 503.0 37 2425.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.777917189460474 22.33375156838143 11.64366373902133 25.244667503136764 2 27.54641244355243 26.216758655293525 30.20572002007025 16.031108881083796 3 19.523212045169387 28.48180677540778 31.468005018820577 20.52697616060226 4 23.68883312421581 33.425345043914675 23.613550815558344 19.27227101631117 5 24.26599749058971 36.4366373902133 20.95357590966123 18.34378920953576 6 21.30696044066099 37.85678517776665 21.98297446169254 18.85327991987982 7 20.555833750625936 22.43365047571357 37.931897846770156 19.078617926890335 8 22.483725588382576 25.037556334501755 27.86680020030045 24.611917876815223 9 20.355533299949926 25.38808212318478 29.41912869303956 24.837255883825737 10-14 23.204807210816224 28.918377566349523 26.14421632448673 21.732598898347522 15-19 22.8592889334001 28.01702553830746 27.566349524286434 21.557336004006007 20-24 23.08193108974359 28.02483974358974 27.734375 21.158854166666664 25-29 23.43014521782674 27.971957936905355 27.240861291937907 21.357035553329993 30-34 23.204807210816224 28.02704056084126 27.56134201301953 21.206810215322985 35-39 23.356202113275575 27.963343181931993 27.82312584505984 20.857328859732586 40-44 23.523814293584415 28.04627635598738 27.615565683377575 20.814343667050633 45-49 23.651389932381665 27.963936889556724 27.247683446030553 21.136989732031054 50-54 23.785678517776667 27.200801201802705 27.856785177766653 21.156735102653982 55-59 23.665498247371055 28.03204807210816 27.481221832749124 20.821231847771656 60-64 23.322315705128204 26.94811698717949 28.600761217948715 21.12880608974359 65-69 23.69646882043576 27.493112947658403 27.653393438517405 21.15702479338843 70-74 23.60130227898823 27.342849987478086 28.00901577761082 21.046831955922865 75-79 23.60012020434739 27.201242111589703 28.508464389462084 20.69017329460082 80-84 23.56506060302514 27.556846639286785 28.03766402884904 20.840428728839026 85-89 24.522915101427497 26.937139994991234 27.9839719509141 20.55597295266717 90-94 23.44603055346857 27.227648384673174 28.850488354620584 20.475832707237664 95-99 23.81787216990583 27.64976958525346 27.960328591464634 20.572029653376077 100-104 24.272476834460306 27.803656398697722 27.638367142499376 20.2854996243426 105-109 24.05709992486852 27.918858001502628 27.167543200601052 20.8564988730278 110-114 23.179404988480417 27.511770009015322 27.917459681458478 21.39136532104578 115-119 24.019435956519562 27.29048740169313 28.117016480488903 20.5730601612984 120-124 23.851740545955423 27.44803405960431 27.46306035562234 21.23716503881793 125-129 23.667601683029453 28.16068924063314 27.239030254458026 20.93267882187938 130-134 24.160905720869653 27.872958621380622 27.412082957619475 20.55405270013025 135-139 24.386334034665865 27.492235246969244 27.582406572487727 20.539024145877168 140-144 24.509018036072145 27.489979959919843 28.0561122244489 19.94488977955912 145-149 24.938642624593037 27.663410969196097 27.147508139243676 20.250438266967194 150-151 25.56334501752629 27.478718077115673 27.203304957436153 19.754631947921883 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 1.0 28 2.0 29 3.5 30 8.5 31 17.0 32 20.0 33 25.0 34 39.0 35 51.0 36 72.5 37 105.5 38 137.5 39 160.0 40 184.5 41 232.0 42 274.5 43 271.0 44 261.5 45 284.0 46 294.0 47 270.5 48 243.0 49 210.5 50 169.0 51 139.0 52 120.0 53 99.5 54 71.0 55 51.5 56 40.5 57 34.0 58 22.5 59 14.0 60 14.0 61 9.5 62 8.5 63 8.0 64 5.0 65 2.5 66 2.0 67 1.5 68 1.0 69 2.5 70 2.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.35000000000000003 3 0.375 4 0.375 5 0.375 6 0.15 7 0.15 8 0.15 9 0.15 10-14 0.15 15-19 0.15 20-24 0.16 25-29 0.15 30-34 0.15 35-39 0.155 40-44 0.165 45-49 0.17500000000000002 50-54 0.15 55-59 0.15 60-64 0.16 65-69 0.17500000000000002 70-74 0.17500000000000002 75-79 0.16999999999999998 80-84 0.16999999999999998 85-89 0.17500000000000002 90-94 0.17500000000000002 95-99 0.18 100-104 0.17500000000000002 105-109 0.17500000000000002 110-114 0.16999999999999998 115-119 0.185 120-124 0.17500000000000002 125-129 0.18 130-134 0.19 135-139 0.19 140-144 0.2 145-149 0.17500000000000002 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64824120603015 99.15 2 0.2763819095477387 0.5499999999999999 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.02512562814070352 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.2625000000000002 0.0 0.0 0.0 0.0 120-121 1.425 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.1 0.0 0.0 0.0 0.0 128-129 2.3499999999999996 0.0 0.0 0.0 0.0 130-131 2.525 0.0 0.0 0.0 0.0 132-133 2.7875 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.575 0.0 0.0 0.0 0.0 138-139 4.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCACA 10 0.0065840036 146.77216 2 >>END_MODULE Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006077 spots for SRR7168989.sra Written 1006077 spots for SRR7168989.sra Read 1006081 spots for SRR7168989.sra Written 1006081 spots for SRR7168989.sra SRR ids: ['SRR7168989.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_epxfdalo SRR7168989.sra spots: 20121544 blocks: [[1, 1006077], [1006078, 2012154], [2012155, 3018231], [3018232, 4024308], [4024309, 5030385], [5030386, 6036462], [6036463, 7042539], [7042540, 8048616], [8048617, 9054693], [9054694, 10060770], [10060771, 11066847], [11066848, 12072924], [12072925, 13079001], [13079002, 14085078], [14085079, 15091155], [15091156, 16097232], [16097233, 17103309], [17103310, 18109386], [18109387, 19115463], [19115464, 20121544]] SRR7168989 file size 6796830 SRR7168989 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168989 SRR7168989_1.fastq SRR7168989_2.fastq Input file: SRR7168989_1.fastq Paired file: SRR7168989_2.fastq trimmed: SRR7168989-trimmed-pair1.fastq, SRR7168989-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:14:36 2025 >> started Mon Feb 10 14:14:58 2025 >> done (22.396s) 20121544 read pairs processed; of these: 35173 ( 0.17%) short read pairs filtered out after trimming by size control 92471 ( 0.46%) empty read pairs filtered out after trimming by size control 19993900 (99.37%) read pairs available; of these: 9312497 (46.58%) trimmed read pairs available after processing 10681403 (53.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 9 0.00% 21 9 0.00% 22 9 0.00% 23 6 0.00% 24 8 0.00% 25 7 0.00% 26 9 0.00% 27 5 0.00% 28 5 0.00% 29 10 0.00% 30 12 0.00% 31 11 0.00% 32 7 0.00% 33 8 0.00% 34 13 0.00% 35 13 0.00% 36 10 0.00% 37 20 0.00% 38 16 0.00% 39 12 0.00% 40 15 0.00% 41 17 0.00% 42 27 0.00% 43 20 0.00% 44 29 0.00% 45 34 0.00% 46 30 0.00% 47 38 0.00% 48 22 0.00% 49 34 0.00% 50 40 0.00% 51 52 0.00% 52 70 0.00% 53 63 0.00% 54 67 0.00% 55 69 0.00% 56 92 0.00% 57 79 0.00% 58 115 0.00% 59 124 0.00% 60 121 0.00% 61 174 0.00% 62 186 0.00% 63 183 0.00% 64 208 0.00% 65 248 0.00% 66 270 0.00% 67 311 0.00% 68 342 0.00% 69 401 0.00% 70 442 0.00% 71 487 0.00% 72 593 0.00% 73 643 0.00% 74 748 0.00% 75 807 0.00% 76 979 0.00% 77 1117 0.01% 78 1185 0.01% 79 1422 0.01% 80 1507 0.01% 81 1878 0.01% 82 2068 0.01% 83 2348 0.01% 84 3771 0.02% 85 4597 0.02% 86 4752 0.02% 87 4740 0.02% 88 5205 0.03% 89 5174 0.03% 90 5546 0.03% 91 5760 0.03% 92 6462 0.03% 93 6781 0.03% 94 7471 0.04% 95 7701 0.04% 96 8121 0.04% 97 8400 0.04% 98 9107 0.05% 99 9481 0.05% 100 10288 0.05% 101 10815 0.05% 102 11539 0.06% 103 12477 0.06% 104 13437 0.07% 105 14656 0.07% 106 14962 0.07% 107 15836 0.08% 108 16397 0.08% 109 17200 0.09% 110 18034 0.09% 111 19473 0.10% 112 20642 0.10% 113 21908 0.11% 114 23622 0.12% 115 25058 0.13% 116 26074 0.13% 117 27456 0.14% 118 28725 0.14% 119 30086 0.15% 120 31113 0.16% 121 32933 0.16% 122 34954 0.17% 123 37420 0.19% 124 40606 0.20% 125 43157 0.22% 126 44899 0.22% 127 47523 0.24% 128 50051 0.25% 129 52978 0.26% 130 56149 0.28% 131 58747 0.29% 132 62973 0.31% 133 67569 0.34% 134 71446 0.36% 135 76924 0.38% 136 82450 0.41% 137 87433 0.44% 138 94229 0.47% 139 101529 0.51% 140 110750 0.55% 141 122358 0.61% 142 135784 0.68% 143 153746 0.77% 144 176097 0.88% 145 210249 1.05% 146 259527 1.30% 147 345046 1.73% 148 515546 2.58% 149 984976 4.93% 150 4621671 23.12% 151 10681403 53.42% 19993900 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=43 prefix-density=0.22 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=35.20 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=11.1 sequence=CCATCACCAACAGGAAGCATGCAAATTTCAATCCTGGGGTCAGC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=42 prefix-density=0.21 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=49.22 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=12.0 sequence=TGTTGGTGGTGG SRR7168989 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:16:06 Started mapping on | Feb 10 14:16:06 Finished on | Feb 10 14:18:02 Mapping speed, Million of reads per hour | 620.50 Number of input reads | 19993900 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17788487 Uniquely mapped reads % | 88.97% Average mapped length | 291.03 Number of splices: Total | 16147841 Number of splices: Annotated (sjdb) | 15871698 Number of splices: GT/AG | 15922734 Number of splices: GC/AG | 177049 Number of splices: AT/AC | 12705 Number of splices: Non-canonical | 35353 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352608 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 321539 % of reads mapped to too many loci | 1.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.39% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1880362 1880362 1880362 N_multimapping 352608 352608 352608 N_noFeature 416539 17560357 499572 N_ambiguous 236311 1827 89888 UnstrandedReadsAssigned:17135637 PositiveStrandReadsAssigned:226303 NegativeStrandReadsAssigned:17199027 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168989 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168989-trimmed-pair1.fastq SRR7168989-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,993,900 reads, 18,097,377 reads pseudoaligned [quant] estimated average fragment length: 240.993 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR7168989.ke.tsv 34699 SRR7168989.se.tsv 87100 total ==> SRR7168989.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.01 253 7.11532 Potri.005G024800.1.v4.1 1035 795.007 33 2.07563 Potri.004G059700.1.v4.1 961 721.039 1 0.0693503 Potri.007G009000.2.v4.1 1416 1176.01 0 0 Potri.003G141000.2.v4.1 2943 2703.01 296.032 5.47645 Potri.016G087400.1.v4.1 270 75.2747 1582.04 1050.94 Potri.015G069301.1.v4.1 564 327.94 0 0 Potri.010G195200.1.v4.1 1773 1533.01 12 0.391421 Potri.012G127500.1.v4.1 977 737.023 5383 365.217 ==> SRR7168989.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1688 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 395 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7168989 completed mapping pipeline successfully