Starting /dee2/code/volunteer_pipeline.sh SRR7168990 current disk space = 3059029651456 free memory = 1468958352 SRR7168990 SRAfilesize ff9a28e78fb5769a2182c1f8e8d2f451 SRR7168990.sra SRR7168990.sra file validated SRR7168990 is paired end SRR7168990 is conventional basespace SRR7168990 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168990_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.27075 34.0 34.0 34.0 33.0 34.0 2 33.48925 34.0 34.0 34.0 33.0 34.0 3 33.52275 34.0 34.0 34.0 33.0 34.0 4 33.55775 34.0 34.0 34.0 33.0 34.0 5 33.56075 34.0 34.0 34.0 33.0 34.0 6 37.34775 38.0 38.0 38.0 36.0 38.0 7 37.492 38.0 38.0 38.0 37.0 38.0 8 37.55675 38.0 38.0 38.0 38.0 38.0 9 37.54425 38.0 38.0 38.0 38.0 38.0 10-14 37.58325 38.0 38.0 38.0 38.0 38.0 15-19 37.59439999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.5789 38.0 38.0 38.0 38.0 38.0 25-29 37.580799999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.5299 38.0 38.0 38.0 38.0 38.0 35-39 37.42999999999999 38.0 38.0 38.0 37.4 38.0 40-44 37.3729 38.0 38.0 38.0 37.0 38.0 45-49 37.36194999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.29715 38.0 38.0 38.0 37.0 38.0 55-59 37.231899999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.225100000000005 38.0 38.0 38.0 36.6 38.0 65-69 37.13175 38.0 38.0 38.0 36.0 38.0 70-74 37.1016 38.0 38.0 38.0 36.0 38.0 75-79 36.9969 38.0 38.0 38.0 36.0 38.0 80-84 36.82305 38.0 38.0 38.0 35.0 38.0 85-89 36.679950000000005 38.0 38.0 38.0 34.8 38.0 90-94 36.52305 38.0 38.0 38.0 33.8 38.0 95-99 36.4038 38.0 38.0 38.0 33.8 38.0 100-104 36.071850000000005 38.0 37.2 38.0 32.2 38.0 105-109 35.7453 38.0 37.0 38.0 31.2 38.0 110-114 35.2886 38.0 36.6 38.0 29.0 38.0 115-119 35.01855 38.0 36.2 38.0 28.2 38.0 120-124 34.5171 38.0 35.2 38.0 25.6 38.0 125-129 34.236900000000006 38.0 34.0 38.0 24.6 38.0 130-134 33.6277 38.0 33.4 38.0 21.4 38.0 135-139 32.8726 38.0 32.6 38.0 18.2 38.0 140-144 31.64135 37.4 30.2 38.0 13.2 38.0 145-149 29.8322 36.0 28.0 38.0 5.8 38.0 150-151 21.878375 27.0 10.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 2.0 17 7.0 18 6.0 19 7.0 20 9.0 21 5.0 22 9.0 23 10.0 24 11.0 25 17.0 26 19.0 27 15.0 28 31.0 29 36.0 30 55.0 31 69.0 32 89.0 33 147.0 34 252.0 35 448.0 36 1030.0 37 1720.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.509200907486765 13.864381144441642 8.041341063776153 37.58507688429544 2 22.05 14.7 33.95 29.299999999999997 3 19.55 18.2 26.85 35.4 4 23.474999999999998 24.75 22.225 29.549999999999997 5 22.39179384538404 31.123342506880157 23.642732049036777 22.842131598699027 6 21.5 34.050000000000004 24.099999999999998 20.349999999999998 7 16.025 26.924999999999997 37.9 19.15 8 17.075000000000003 27.500000000000004 30.775000000000002 24.65 9 17.25 25.474999999999998 32.324999999999996 24.95 10-14 20.69 28.9 25.96 24.45 15-19 20.46 27.93 26.44 25.169999999999998 20-24 20.45 28.185 26.924999999999997 24.44 25-29 20.549999999999997 28.335 26.5 24.615000000000002 30-34 20.4 27.845 26.66 25.095 35-39 20.565 27.994999999999997 26.46 24.98 40-44 20.86 28.305000000000003 26.484999999999996 24.349999999999998 45-49 20.74 27.52 26.56 25.180000000000003 50-54 20.27 28.01 26.784999999999997 24.935 55-59 20.69 27.965 26.974999999999998 24.37 60-64 20.885 27.115000000000002 27.26 24.740000000000002 65-69 20.525 27.48 26.555 25.44 70-74 20.62 28.205000000000002 26.634999999999998 24.54 75-79 20.86 27.16 26.700000000000003 25.28 80-84 20.125 27.92 26.57 25.385 85-89 21.16 27.529999999999998 26.505000000000003 24.805 90-94 20.72 27.58 26.645000000000003 25.055 95-99 20.599999999999998 27.650000000000002 26.705000000000002 25.045 100-104 21.025 27.445000000000004 26.68 24.85 105-109 21.36 27.250000000000004 26.455000000000002 24.935 110-114 20.835 27.41 26.825 24.93 115-119 21.035 27.11 26.905 24.95 120-124 21.25 27.48 26.3 24.97 125-129 21.575 27.305 26.08 25.040000000000003 130-134 20.93 27.24 26.85 24.98 135-139 21.14 27.52 26.135 25.205 140-144 21.915000000000003 26.96 25.955000000000002 25.169999999999998 145-149 21.875 27.450000000000003 26.185000000000002 24.490000000000002 150-151 21.099999999999998 27.5875 26.25 25.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 2.5 24 3.0 25 3.0 26 5.0 27 7.5 28 9.0 29 10.5 30 14.5 31 21.5 32 26.5 33 34.0 34 45.0 35 51.0 36 67.5 37 87.0 38 103.0 39 126.5 40 142.0 41 176.5 42 209.0 43 217.5 44 233.5 45 239.5 46 245.5 47 247.5 48 232.5 49 214.5 50 199.0 51 179.5 52 155.0 53 131.5 54 108.5 55 85.0 56 66.0 57 57.0 58 49.0 59 40.0 60 29.5 61 20.5 62 14.5 63 11.5 64 9.0 65 8.0 66 10.0 67 10.0 68 10.0 69 8.0 70 5.5 71 2.5 72 1.0 73 4.5 74 4.0 75 1.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44902110348335 96.8 2 1.4238494787693874 2.8000000000000003 3 0.10170353419781336 0.3 4 0.02542588354945334 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.8374999999999999 0.0 0.0 0.0 0.0 116-117 1.0125000000000002 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.2625 0.0 0.0 0.0 0.0 122-123 1.3624999999999998 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.875 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.5125 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 3.1625 0.0 0.0 0.0 0.0 138-139 3.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168990 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168990_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.831 33.0 33.0 34.0 32.0 34.0 2 32.8365 33.0 33.0 34.0 32.0 34.0 3 32.82975 34.0 33.0 34.0 31.0 34.0 4 32.822 34.0 33.0 34.0 32.0 34.0 5 32.72825 34.0 33.0 34.0 31.0 34.0 6 36.889 38.0 38.0 38.0 36.0 38.0 7 36.9625 38.0 38.0 38.0 36.0 38.0 8 36.97575 38.0 38.0 38.0 36.0 38.0 9 37.0655 38.0 38.0 38.0 36.0 38.0 10-14 36.901 38.0 38.0 38.0 36.0 38.0 15-19 36.9208 38.0 38.0 38.0 36.0 38.0 20-24 36.8135 38.0 38.0 38.0 36.0 38.0 25-29 36.72580000000001 38.0 38.0 38.0 35.8 38.0 30-34 36.656400000000005 38.0 38.0 38.0 35.8 38.0 35-39 36.55219999999999 38.0 38.0 38.0 35.0 38.0 40-44 36.4862 38.0 38.0 38.0 34.4 38.0 45-49 36.408500000000004 38.0 38.0 38.0 34.2 38.0 50-54 36.16485 38.0 38.0 38.0 33.6 38.0 55-59 36.06485 38.0 37.6 38.0 33.2 38.0 60-64 35.883300000000006 38.0 37.0 38.0 32.8 38.0 65-69 35.722699999999996 38.0 37.0 38.0 31.4 38.0 70-74 35.6051 38.0 37.0 38.0 30.8 38.0 75-79 35.331849999999996 38.0 36.6 38.0 29.4 38.0 80-84 35.09115 38.0 36.0 38.0 28.6 38.0 85-89 34.927949999999996 38.0 36.0 38.0 28.0 38.0 90-94 34.41295 38.0 35.0 38.0 25.0 38.0 95-99 33.97089999999999 38.0 34.2 38.0 23.0 38.0 100-104 33.3303 38.0 33.4 38.0 16.2 38.0 105-109 32.60665 37.6 31.2 38.0 15.0 38.0 110-114 32.18345 37.0 31.0 38.0 14.8 38.0 115-119 30.98535 37.0 28.6 38.0 12.6 38.0 120-124 29.781799999999997 36.0 25.8 38.0 11.2 38.0 125-129 28.6685 34.4 22.4 38.0 3.8 38.0 130-134 27.405899999999995 33.0 19.4 38.0 2.0 38.0 135-139 26.342899999999997 33.0 14.2 38.0 2.0 38.0 140-144 24.67455 31.8 12.2 38.0 2.0 38.0 145-149 21.7421 28.4 2.0 36.2 2.0 38.0 150-151 15.179124999999999 7.5 2.0 32.0 2.0 36.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 5.0 4 6.0 5 5.0 6 3.0 7 2.0 8 1.0 9 5.0 10 2.0 11 6.0 12 7.0 13 4.0 14 7.0 15 5.0 16 11.0 17 15.0 18 16.0 19 22.0 20 18.0 21 44.0 22 38.0 23 30.0 24 37.0 25 46.0 26 58.0 27 62.0 28 81.0 29 98.0 30 110.0 31 168.0 32 235.0 33 337.0 34 473.0 35 730.0 36 852.0 37 447.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.575 22.275 11.275 29.875 2 25.66925193895422 28.021015761821367 29.54716037027771 16.76257192894671 3 20.836463811670423 27.748559979964938 28.174305033809166 23.240671174555473 4 23.89181066867017 33.183070373153015 22.61457550713749 20.31054345103932 5 25.29426496368645 34.660656148259456 21.537690959178562 18.50738792887553 6 22.566925193895422 35.90192644483363 22.291718789091817 19.239429572179134 7 19.389542156617463 22.491868901676256 37.3029772329247 20.815611708781585 8 21.31598699024268 24.943707780835627 26.419814861145856 27.32049036777583 9 22.892169126845133 24.59344508381286 29.74731048286215 22.76707530647986 10-14 24.653698054708208 27.76916537480622 25.908886332949944 21.66825023753563 15-19 24.222422242224223 27.247724772477248 26.732673267326735 21.797179717971797 20-24 23.562068620586178 27.9183755126538 26.637991397419224 21.881564469340802 25-29 24.185000000000002 27.200000000000003 26.38 22.235 30-34 24.225901655745087 27.132209494272423 26.591966384873196 22.049922465109297 35-39 23.973596039405912 27.329099364904735 26.689003350502578 22.00830124518678 40-44 24.441110277569393 26.826706676669165 26.736684171042764 21.99549887471868 45-49 24.440998449302185 26.997148716922613 26.206793056875593 22.355059776899605 50-54 23.883582537380608 27.45411811771766 27.14407161074161 21.518227734160124 55-59 24.62738821646494 27.01810543162949 26.818045413624088 21.536460938281486 60-64 24.663699554933242 27.544131619742963 26.383957593639046 21.408211231684753 65-69 25.080000000000002 27.21 26.5 21.21 70-74 24.336084021005252 26.76669167291823 26.74168542135534 22.155538884721178 75-79 24.626156539134783 26.441610402600652 27.391847961990496 21.54038509627407 80-84 24.588688303245487 27.444116617492625 26.273941091163678 21.693253988098217 85-89 24.794917967186876 26.795718287314923 26.58063225290116 21.82873149259704 90-94 25.047504750475046 26.672667266726673 26.717671767176714 21.56215621562156 95-99 25.09 26.685 26.41 21.815 100-104 24.645 26.950000000000003 26.755000000000003 21.65 105-109 24.521226061303064 26.581329066453325 27.006350317515874 21.891094554727736 110-114 24.65 27.229999999999997 26.855 21.265 115-119 24.812443733119935 26.758027408222468 26.492947884365307 21.936580974292287 120-124 24.811165024260916 26.712020409184134 26.707018158171174 21.769796408383773 125-129 24.95871903927946 27.005253940455344 26.830122591943955 21.20590442832124 130-134 24.84618078135161 26.9421239557801 26.421889850432695 21.789805412435594 135-139 24.743608984941716 26.539596778228024 26.339486717694733 22.377307519135524 140-144 25.292587776332898 27.18815644693408 26.04281284385316 21.476442932879863 145-149 25.522552255225524 26.717671767176714 26.072607260726073 21.68716871687169 150-151 26.5125 26.337500000000002 25.4375 21.712500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 2.0 28 3.0 29 2.5 30 4.5 31 7.5 32 9.5 33 21.0 34 31.0 35 41.0 36 64.5 37 86.5 38 112.5 39 129.0 40 155.5 41 188.5 42 207.5 43 237.5 44 254.0 45 257.0 46 269.0 47 271.5 48 254.5 49 223.0 50 189.5 51 164.5 52 142.5 53 115.5 54 97.0 55 89.0 56 63.0 57 44.0 58 37.5 59 32.5 60 29.0 61 23.0 62 27.0 63 28.5 64 17.5 65 7.0 66 3.5 67 4.5 68 6.0 69 6.0 70 5.0 71 5.5 72 4.0 73 1.0 74 1.5 75 1.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 1.5 93 1.5 94 0.0 95 0.0 96 1.5 97 2.0 98 1.0 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.015 15-19 0.01 20-24 0.03 25-29 0.0 30-34 0.045 35-39 0.015 40-44 0.025 45-49 0.045 50-54 0.015 55-59 0.03 60-64 0.015 65-69 0.0 70-74 0.025 75-79 0.025 80-84 0.015 85-89 0.04 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.03 120-124 0.045 125-129 0.075 130-134 0.045 135-139 0.055 140-144 0.03 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2361963190184 96.075 2 1.4826175869120655 2.9000000000000004 3 0.1278118609406953 0.375 4 0.10224948875255625 0.4 5 0.051124744376278126 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAA 5 0.125 No Hit CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9750000000000001 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.1125 0.0 0.0 0.0 0.0 134-135 2.3875 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138-139 3.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACTCA 10 0.006830828 145.0 4 >>END_MODULE Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763730 spots for SRR7168990.sra Written 763730 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra Read 763723 spots for SRR7168990.sra Written 763723 spots for SRR7168990.sra SRR ids: ['SRR7168990.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o52jml93 SRR7168990.sra spots: 15274467 blocks: [[1, 763723], [763724, 1527446], [1527447, 2291169], [2291170, 3054892], [3054893, 3818615], [3818616, 4582338], [4582339, 5346061], [5346062, 6109784], [6109785, 6873507], [6873508, 7637230], [7637231, 8400953], [8400954, 9164676], [9164677, 9928399], [9928400, 10692122], [10692123, 11455845], [11455846, 12219568], [12219569, 12983291], [12983292, 13747014], [13747015, 14510737], [14510738, 15274467]] SRR7168990 file size 5154315 SRR7168990 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168990 SRR7168990_1.fastq SRR7168990_2.fastq Input file: SRR7168990_1.fastq Paired file: SRR7168990_2.fastq trimmed: SRR7168990-trimmed-pair1.fastq, SRR7168990-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:32:20 2025 >> started Mon Feb 10 14:32:38 2025 >> done (17.943s) 15274467 read pairs processed; of these: 19770 ( 0.13%) short read pairs filtered out after trimming by size control 52041 ( 0.34%) empty read pairs filtered out after trimming by size control 15202656 (99.53%) read pairs available; of these: 6652421 (43.76%) trimmed read pairs available after processing 8550235 (56.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 13 0.00% 21 11 0.00% 22 5 0.00% 23 8 0.00% 24 4 0.00% 25 7 0.00% 26 10 0.00% 27 18 0.00% 28 8 0.00% 29 9 0.00% 30 4 0.00% 31 11 0.00% 32 11 0.00% 33 9 0.00% 34 10 0.00% 35 12 0.00% 36 16 0.00% 37 7 0.00% 38 8 0.00% 39 17 0.00% 40 22 0.00% 41 13 0.00% 42 13 0.00% 43 27 0.00% 44 30 0.00% 45 18 0.00% 46 49 0.00% 47 31 0.00% 48 25 0.00% 49 34 0.00% 50 28 0.00% 51 30 0.00% 52 37 0.00% 53 51 0.00% 54 51 0.00% 55 39 0.00% 56 55 0.00% 57 81 0.00% 58 75 0.00% 59 104 0.00% 60 112 0.00% 61 113 0.00% 62 124 0.00% 63 171 0.00% 64 199 0.00% 65 264 0.00% 66 221 0.00% 67 262 0.00% 68 326 0.00% 69 428 0.00% 70 426 0.00% 71 430 0.00% 72 503 0.00% 73 563 0.00% 74 639 0.00% 75 683 0.00% 76 749 0.00% 77 824 0.01% 78 945 0.01% 79 975 0.01% 80 1209 0.01% 81 1380 0.01% 82 1593 0.01% 83 1821 0.01% 84 2685 0.02% 85 3314 0.02% 86 3599 0.02% 87 3736 0.02% 88 4116 0.03% 89 4158 0.03% 90 4310 0.03% 91 4504 0.03% 92 4756 0.03% 93 5005 0.03% 94 5364 0.04% 95 5975 0.04% 96 6034 0.04% 97 6466 0.04% 98 6874 0.05% 99 7014 0.05% 100 7642 0.05% 101 8064 0.05% 102 8708 0.06% 103 9251 0.06% 104 9692 0.06% 105 10547 0.07% 106 10761 0.07% 107 11405 0.08% 108 12115 0.08% 109 12840 0.08% 110 13587 0.09% 111 14121 0.09% 112 15187 0.10% 113 16542 0.11% 114 17110 0.11% 115 18505 0.12% 116 19444 0.13% 117 20561 0.14% 118 21800 0.14% 119 22977 0.15% 120 24099 0.16% 121 25026 0.16% 122 26591 0.17% 123 28402 0.19% 124 30226 0.20% 125 31680 0.21% 126 33715 0.22% 127 35715 0.23% 128 37526 0.25% 129 39446 0.26% 130 41681 0.27% 131 44134 0.29% 132 46758 0.31% 133 50410 0.33% 134 53277 0.35% 135 57334 0.38% 136 61280 0.40% 137 64775 0.43% 138 70040 0.46% 139 75519 0.50% 140 81290 0.53% 141 89862 0.59% 142 99713 0.66% 143 112314 0.74% 144 129262 0.85% 145 153503 1.01% 146 189990 1.25% 147 251450 1.65% 148 369968 2.43% 149 691038 4.55% 150 3231642 21.26% 151 8550235 56.24% 15202656 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=30 prefix-density=0.37 prefix-fanout=2.7 sequence=CCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGACAATGTCTTCCGCCCGGATCGGCCGCCGAAGCGGCCTTGGGTCCAAAAAGAGGGGCAGCGCCCCGCCTCCGATTCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACCTTCGCCGAAGCTCCCACTTATCCTACACCTCTCAAGTCAT criterion=fanout-score sequence-density=0.13 sequence-density-rank=22 fanout-score=83.10 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=15.9 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=27 prefix-density=0.30 prefix-fanout=2.7 sequence=GTTGACTGGTGCCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=87.09 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.8 sequence=CACCACCACTGGTAACAAGGACATCATCATGGTTGATCACATGAGGAAGATGAAGAACAATGCCATTGTCTGCAACATCGGTCACTTCGATAATGAAATCGACATGCTTGGACTTGAGACCTTCCCTGGCGTGAAGCGCATCACCATCAAGCCCCAAACTGACAGGTGGGTCTTCCCTGACACCAACTCCGGCATCATTGTCCTGGCTGAGGGACGTCTCATGAACCTGGGATGTGCCACCGGTCACCCC SRR7168990 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:33:24 Started mapping on | Feb 10 14:33:25 Finished on | Feb 10 14:36:06 Mapping speed, Million of reads per hour | 339.94 Number of input reads | 15202656 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12683829 Uniquely mapped reads % | 83.43% Average mapped length | 295.46 Number of splices: Total | 11754122 Number of splices: Annotated (sjdb) | 11574763 Number of splices: GT/AG | 11591908 Number of splices: GC/AG | 130650 Number of splices: AT/AC | 9223 Number of splices: Non-canonical | 22341 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287941 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 1376521 % of reads mapped to too many loci | 9.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.37% % of reads unmapped: other | 1.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2244126 2244126 2244126 N_multimapping 287941 287941 287941 N_noFeature 244545 12530316 310624 N_ambiguous 136578 1207 48306 UnstrandedReadsAssigned:12302706 PositiveStrandReadsAssigned:152306 NegativeStrandReadsAssigned:12324899 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168990 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168990-trimmed-pair1.fastq SRR7168990-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,202,656 reads, 13,289,332 reads pseudoaligned [quant] estimated average fragment length: 239.176 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR7168990.ke.tsv 34699 SRR7168990.se.tsv 87100 total ==> SRR7168990.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.82 173 5.9443 Potri.005G024800.1.v4.1 1035 796.824 42 3.22343 Potri.004G059700.1.v4.1 961 722.861 3 0.253804 Potri.007G009000.2.v4.1 1416 1177.82 0 0 Potri.003G141000.2.v4.1 2943 2704.82 182.029 4.11561 Potri.016G087400.1.v4.1 270 73.6883 1362 1130.34 Potri.015G069301.1.v4.1 564 328.956 0 0 Potri.010G195200.1.v4.1 1773 1534.82 26 1.03597 Potri.012G127500.1.v4.1 977 738.839 6742 558.047 ==> SRR7168990.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 848 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 220 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7168990 completed mapping pipeline successfully