Starting /dee2/code/volunteer_pipeline.sh SRR7168991 current disk space = 3059030319104 free memory = 1298624772 SRR7168991 SRAfilesize 4600f356daea0e10d111691a6e32dfdc SRR7168991.sra SRR7168991.sra file validated SRR7168991 is paired end SRR7168991 is conventional basespace SRR7168991 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168991_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.32 34.0 34.0 34.0 33.0 34.0 2 33.4575 34.0 34.0 34.0 33.0 34.0 3 33.497 34.0 34.0 34.0 33.0 34.0 4 33.53975 34.0 34.0 34.0 33.0 34.0 5 33.568 34.0 34.0 34.0 33.0 34.0 6 37.2555 38.0 38.0 38.0 36.0 38.0 7 37.4595 38.0 38.0 38.0 37.0 38.0 8 37.545 38.0 38.0 38.0 37.0 38.0 9 37.56725 38.0 38.0 38.0 38.0 38.0 10-14 37.56545 38.0 38.0 38.0 38.0 38.0 15-19 37.60065 38.0 38.0 38.0 38.0 38.0 20-24 37.540499999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.5515 38.0 38.0 38.0 38.0 38.0 30-34 37.53495 38.0 38.0 38.0 38.0 38.0 35-39 37.38015 38.0 38.0 38.0 37.0 38.0 40-44 37.29845 38.0 38.0 38.0 37.0 38.0 45-49 37.3065 38.0 38.0 38.0 37.0 38.0 50-54 37.2381 38.0 38.0 38.0 37.0 38.0 55-59 37.19715 38.0 38.0 38.0 36.4 38.0 60-64 37.1415 38.0 38.0 38.0 36.4 38.0 65-69 37.0366 38.0 38.0 38.0 36.0 38.0 70-74 37.077 38.0 38.0 38.0 36.0 38.0 75-79 36.945 38.0 38.0 38.0 36.0 38.0 80-84 36.8281 38.0 38.0 38.0 35.0 38.0 85-89 36.691500000000005 38.0 38.0 38.0 34.6 38.0 90-94 36.4785 38.0 38.0 38.0 33.8 38.0 95-99 36.322500000000005 38.0 37.8 38.0 33.4 38.0 100-104 36.034 38.0 37.0 38.0 32.0 38.0 105-109 35.75465 38.0 37.0 38.0 30.8 38.0 110-114 35.23424999999999 38.0 36.6 38.0 29.0 38.0 115-119 34.98595 38.0 36.2 38.0 28.2 38.0 120-124 34.40225 38.0 34.8 38.0 25.6 38.0 125-129 34.0323 38.0 34.0 38.0 23.0 38.0 130-134 33.32695 38.0 33.0 38.0 20.0 38.0 135-139 32.44805 37.8 32.6 38.0 14.4 38.0 140-144 31.325049999999997 37.2 29.2 38.0 12.8 38.0 145-149 29.26385 36.0 26.8 38.0 3.8 38.0 150-151 21.540999999999997 19.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 2.0 16 3.0 17 0.0 18 6.0 19 0.0 20 3.0 21 4.0 22 22.0 23 17.0 24 10.0 25 16.0 26 29.0 27 24.0 28 32.0 29 36.0 30 68.0 31 73.0 32 109.0 33 159.0 34 236.0 35 440.0 36 1063.0 37 1642.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.691823899371066 10.440251572327044 5.484276729559748 33.38364779874214 2 21.475 10.65 39.275 28.599999999999998 3 18.025 22.7 29.625 29.65 4 23.75 26.5 25.25 24.5 5 24.012006003001503 31.615807903951975 25.387693846923458 18.98449224612306 6 20.075000000000003 32.05 24.925 22.95 7 14.075 27.474999999999998 43.125 15.325 8 15.925 22.5 35.25 26.325 9 16.05 20.4 37.325 26.224999999999998 10-14 20.26 29.455 28.18 22.105 15-19 20.605 27.900000000000002 28.365000000000002 23.13 20-24 20.549999999999997 28.025 27.29 24.135 25-29 20.14 28.29 27.79 23.78 30-34 20.044999999999998 28.499999999999996 27.05 24.404999999999998 35-39 20.119999999999997 28.565 27.339999999999996 23.974999999999998 40-44 20.915 28.645 27.465 22.975 45-49 20.365 28.32 27.41 23.905 50-54 20.46 28.22 27.400000000000002 23.919999999999998 55-59 20.830000000000002 28.405 27.115000000000002 23.65 60-64 20.674999999999997 28.449999999999996 26.8 24.075 65-69 20.665 28.185 27.38 23.77 70-74 20.43 28.389999999999997 27.82 23.36 75-79 20.435 27.905 27.215 24.445 80-84 20.54 28.255000000000003 27.85 23.355 85-89 21.165 27.58 27.839999999999996 23.415 90-94 20.560000000000002 27.525 27.544999999999998 24.37 95-99 20.919999999999998 27.815 27.76 23.505000000000003 100-104 20.78 28.415000000000003 27.07 23.735 105-109 20.605 27.855 27.985 23.555 110-114 20.68 27.83 27.46 24.03 115-119 20.97 27.605 27.76 23.665 120-124 21.695 27.87 28.095 22.34 125-129 21.529999999999998 28.28 27.095000000000002 23.095 130-134 21.44 27.900000000000002 27.575 23.085 135-139 20.87 27.83 27.694999999999997 23.605 140-144 21.27 27.435 27.525 23.77 145-149 21.224999999999998 27.725 27.49 23.56 150-151 21.3875 27.3875 28.8375 22.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 3.0 26 4.5 27 7.5 28 10.0 29 9.5 30 10.5 31 15.5 32 25.5 33 37.5 34 48.0 35 70.0 36 79.5 37 90.0 38 119.0 39 141.5 40 182.0 41 208.0 42 224.0 43 271.0 44 283.0 45 279.0 46 284.0 47 262.5 48 248.0 49 218.0 50 182.0 51 144.0 52 116.5 53 107.0 54 84.0 55 62.5 56 39.5 57 27.0 58 21.5 59 16.5 60 13.5 61 10.0 62 9.5 63 9.0 64 6.0 65 4.5 66 2.0 67 2.5 68 4.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.4500000000000002 0.0 0.0 0.0 0.0 134-135 1.6375000000000002 0.0 0.0 0.0 0.0 136-137 1.9875 0.0 0.0 0.0 0.0 138-139 2.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTGA 10 0.006830828 145.0 5 >>END_MODULE SRR7168991 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168991_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.973 33.0 33.0 34.0 32.0 34.0 2 33.0025 34.0 33.0 34.0 32.0 34.0 3 32.91975 34.0 33.0 34.0 33.0 34.0 4 32.91175 34.0 33.0 34.0 33.0 34.0 5 32.89625 34.0 33.0 34.0 33.0 34.0 6 37.1395 38.0 38.0 38.0 37.0 38.0 7 37.207 38.0 38.0 38.0 37.0 38.0 8 37.15775 38.0 38.0 38.0 37.0 38.0 9 37.22925 38.0 38.0 38.0 37.0 38.0 10-14 37.1513 38.0 38.0 38.0 37.0 38.0 15-19 37.120000000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.07254999999999 38.0 38.0 38.0 37.0 38.0 25-29 36.975649999999995 38.0 38.0 38.0 36.6 38.0 30-34 36.9259 38.0 38.0 38.0 36.0 38.0 35-39 36.87265 38.0 38.0 38.0 36.0 38.0 40-44 36.879949999999994 38.0 38.0 38.0 36.0 38.0 45-49 36.75795 38.0 38.0 38.0 35.6 38.0 50-54 36.62495 38.0 38.0 38.0 35.0 38.0 55-59 36.549400000000006 38.0 38.0 38.0 34.6 38.0 60-64 36.436099999999996 38.0 38.0 38.0 34.2 38.0 65-69 36.2672 38.0 38.0 38.0 34.0 38.0 70-74 36.1956 38.0 38.0 38.0 34.0 38.0 75-79 35.9339 38.0 37.2 38.0 32.8 38.0 80-84 35.743700000000004 38.0 37.0 38.0 31.4 38.0 85-89 35.5526 38.0 37.0 38.0 30.4 38.0 90-94 35.160000000000004 38.0 36.2 38.0 28.6 38.0 95-99 34.874199999999995 38.0 35.8 38.0 27.6 38.0 100-104 34.345099999999995 38.0 34.4 38.0 24.6 38.0 105-109 33.67535 38.0 33.4 38.0 20.2 38.0 110-114 33.1178 38.0 33.0 38.0 14.8 38.0 115-119 32.36595 38.0 31.8 38.0 14.0 38.0 120-124 31.176650000000002 37.0 28.4 38.0 13.0 38.0 125-129 29.9704 36.2 26.4 38.0 11.6 38.0 130-134 28.850299999999997 34.2 22.8 38.0 5.6 38.0 135-139 28.00605 33.4 20.6 38.0 2.0 38.0 140-144 26.27295 33.0 15.2 38.0 2.0 38.0 145-149 23.76005 31.8 6.0 38.0 2.0 38.0 150-151 16.98325 16.0 2.0 33.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 3.0 4 2.0 5 1.0 6 2.0 7 2.0 8 1.0 9 1.0 10 4.0 11 3.0 12 2.0 13 9.0 14 3.0 15 7.0 16 10.0 17 7.0 18 10.0 19 15.0 20 14.0 21 24.0 22 18.0 23 26.0 24 45.0 25 33.0 26 40.0 27 65.0 28 74.0 29 65.0 30 96.0 31 136.0 32 163.0 33 279.0 34 457.0 35 697.0 36 1029.0 37 645.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.975 16.75 11.625 25.650000000000002 2 29.997498123592692 17.663247435576682 33.19989992494371 19.139354515886914 3 18.234261349385502 23.350890393779782 40.0300978179082 18.38475043892651 4 23.764115432873275 33.199498117942284 22.1831869510665 20.85319949811794 5 24.466750313676286 36.938519447929735 20.15056461731493 18.444165621079048 6 18.90945472736368 39.21960980490245 22.686343171585793 19.18459229614807 7 20.01501125844383 21.165874405804352 39.30447835876908 19.514635976982735 8 20.715536652489366 24.093069802351764 28.67150362772079 26.51988991743808 9 20.76038019009505 25.18759379689845 29.139569784892444 24.912456228114056 10-14 23.109621924384875 29.265853170634127 26.585317063412685 21.039207841568313 15-19 22.984596919383876 27.945589117823566 27.270454090818163 21.799359871974396 20-24 22.866433216608304 28.874437218609305 27.048524262131064 21.210605302651324 25-29 22.807982793977892 28.064822687940776 27.229530335617465 21.897664182463863 30-34 23.057681724948722 28.22052128670769 27.52013607484116 21.201660913502426 35-39 22.476743022906874 28.95368610583175 27.158147444233272 21.411423427028108 40-44 23.131939581874562 27.868360508152445 27.393217965389617 21.606481944583376 45-49 22.807544149282105 27.760268147481113 27.69022962629446 21.741958076942318 50-54 22.832991547041466 27.699694893212623 28.229880458160356 21.237433101585555 55-59 23.050372667700465 28.412785753589116 27.587414336451406 20.949427242259016 60-64 22.791837551265377 28.08342502750825 27.588276482944885 21.536460938281486 65-69 23.25465093018604 27.650530106021204 27.780556111222243 21.314262852570515 70-74 22.839135654261707 28.416366546618647 27.71608643457383 21.028411364545818 75-79 22.96188856656997 27.513253976192857 28.11343403020906 21.411423427028108 80-84 22.904161664665867 28.371348539415763 27.270908363345335 21.453581432573028 85-89 23.398189366278196 27.674686140149053 28.09983494222978 20.82728955134297 90-94 22.940735183795947 27.56689172293073 27.651912978244564 21.840460115028755 95-99 23.382338233823383 27.752775277527753 27.382738273827385 21.482148214821482 100-104 23.502350235023503 27.872787278727873 27.35273527352735 21.272127212721273 105-109 23.42968593718744 27.845569113822766 27.19543908781756 21.529305861172237 110-114 23.148472270840625 27.69415412311847 27.964194629194377 21.19317897684653 115-119 23.319327731092436 27.861144457783116 27.140856342537017 21.678671468587435 120-124 23.63299814898194 26.909800390214617 28.005402971634396 21.451798489169043 125-129 23.816671670169118 27.994596217352147 26.703692584809367 21.485039527669368 130-134 24.204681872749102 27.40596238495398 27.010804321728692 21.37855142056823 135-139 24.00080036016207 27.627432344555046 26.827072182482116 21.54469511280076 140-144 24.117235170551165 27.143142942882864 27.673301990597178 21.066319895968793 145-149 23.754750950190036 28.270654130826166 26.295259051810362 21.679335867173435 150-151 24.08403151181693 26.885081905714642 27.01012879829936 22.020757784169064 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.5 25 4.0 26 3.5 27 2.5 28 5.5 29 8.5 30 11.5 31 15.5 32 21.0 33 34.0 34 42.5 35 49.0 36 69.0 37 97.0 38 127.0 39 169.5 40 211.5 41 248.0 42 266.5 43 279.0 44 280.0 45 276.0 46 286.5 47 266.0 48 232.5 49 196.5 50 159.0 51 134.0 52 111.0 53 85.5 54 65.5 55 49.5 56 40.5 57 33.5 58 26.5 59 18.5 60 12.0 61 9.5 62 5.0 63 5.0 64 4.5 65 2.5 66 2.5 67 2.0 68 2.5 69 3.0 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.5 84 1.0 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 1.5 97 2.0 98 1.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.325 4 0.375 5 0.375 6 0.05 7 0.075 8 0.075 9 0.05 10-14 0.02 15-19 0.02 20-24 0.05 25-29 0.034999999999999996 30-34 0.055 35-39 0.03 40-44 0.03 45-49 0.055 50-54 0.034999999999999996 55-59 0.045 60-64 0.03 65-69 0.02 70-74 0.04 75-79 0.03 80-84 0.04 85-89 0.034999999999999996 90-94 0.025 95-99 0.01 100-104 0.01 105-109 0.02 110-114 0.015 115-119 0.04 120-124 0.055 125-129 0.06999999999999999 130-134 0.04 135-139 0.045 140-144 0.03 145-149 0.02 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.4023133014835303 0.8 3 0.050289162685441285 0.15 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.5375 0.0 0.0 0.0 0.0 136-137 1.8125 0.0 0.0 0.0 0.0 138-139 2.0999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCATT 10 0.006830828 145.0 9 >>END_MODULE Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra Read 786341 spots for SRR7168991.sra Written 786341 spots for SRR7168991.sra SRR ids: ['SRR7168991.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qi03233p SRR7168991.sra spots: 15726820 blocks: [[1, 786341], [786342, 1572682], [1572683, 2359023], [2359024, 3145364], [3145365, 3931705], [3931706, 4718046], [4718047, 5504387], [5504388, 6290728], [6290729, 7077069], [7077070, 7863410], [7863411, 8649751], [8649752, 9436092], [9436093, 10222433], [10222434, 11008774], [11008775, 11795115], [11795116, 12581456], [12581457, 13367797], [13367798, 14154138], [14154139, 14940479], [14940480, 15726820]] SRR7168991 file size 5307602 SRR7168991 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168991 SRR7168991_1.fastq SRR7168991_2.fastq Input file: SRR7168991_1.fastq Paired file: SRR7168991_2.fastq trimmed: SRR7168991-trimmed-pair1.fastq, SRR7168991-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:51:17 2025 >> started Mon Feb 10 14:51:36 2025 >> done (18.411s) 15726820 read pairs processed; of these: 13726 ( 0.09%) short read pairs filtered out after trimming by size control 9953 ( 0.06%) empty read pairs filtered out after trimming by size control 15703141 (99.85%) read pairs available; of these: 6521508 (41.53%) trimmed read pairs available after processing 9181633 (58.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 2 0.00% 20 7 0.00% 21 2 0.00% 22 3 0.00% 23 5 0.00% 24 2 0.00% 25 3 0.00% 26 3 0.00% 27 3 0.00% 28 2 0.00% 29 4 0.00% 30 6 0.00% 31 3 0.00% 32 2 0.00% 33 1 0.00% 34 6 0.00% 35 4 0.00% 36 5 0.00% 37 6 0.00% 38 5 0.00% 39 8 0.00% 40 9 0.00% 41 8 0.00% 42 5 0.00% 43 12 0.00% 44 9 0.00% 45 9 0.00% 46 7 0.00% 47 10 0.00% 48 17 0.00% 49 11 0.00% 50 13 0.00% 51 13 0.00% 52 16 0.00% 53 18 0.00% 54 25 0.00% 55 25 0.00% 56 24 0.00% 57 32 0.00% 58 40 0.00% 59 39 0.00% 60 43 0.00% 61 56 0.00% 62 62 0.00% 63 70 0.00% 64 76 0.00% 65 81 0.00% 66 96 0.00% 67 89 0.00% 68 119 0.00% 69 168 0.00% 70 171 0.00% 71 188 0.00% 72 194 0.00% 73 263 0.00% 74 283 0.00% 75 284 0.00% 76 369 0.00% 77 343 0.00% 78 428 0.00% 79 488 0.00% 80 561 0.00% 81 603 0.00% 82 717 0.00% 83 873 0.01% 84 1544 0.01% 85 1897 0.01% 86 2020 0.01% 87 2126 0.01% 88 2248 0.01% 89 2290 0.01% 90 2363 0.02% 91 2619 0.02% 92 2831 0.02% 93 3120 0.02% 94 3116 0.02% 95 3378 0.02% 96 3754 0.02% 97 3814 0.02% 98 4072 0.03% 99 4405 0.03% 100 4624 0.03% 101 4921 0.03% 102 5379 0.03% 103 5784 0.04% 104 6141 0.04% 105 6848 0.04% 106 7123 0.05% 107 7367 0.05% 108 7933 0.05% 109 8458 0.05% 110 8616 0.05% 111 9660 0.06% 112 10229 0.07% 113 11155 0.07% 114 11942 0.08% 115 12934 0.08% 116 13627 0.09% 117 14806 0.09% 118 15639 0.10% 119 16115 0.10% 120 17219 0.11% 121 18826 0.12% 122 20021 0.13% 123 21457 0.14% 124 23127 0.15% 125 24656 0.16% 126 26679 0.17% 127 27857 0.18% 128 29654 0.19% 129 31481 0.20% 130 33693 0.21% 131 35596 0.23% 132 38119 0.24% 133 41550 0.26% 134 45012 0.29% 135 48749 0.31% 136 52919 0.34% 137 57168 0.36% 138 62145 0.40% 139 66412 0.42% 140 73134 0.47% 141 81122 0.52% 142 91329 0.58% 143 105082 0.67% 144 123184 0.78% 145 146996 0.94% 146 185064 1.18% 147 249051 1.59% 148 372527 2.37% 149 705693 4.49% 150 3424031 21.80% 151 9181633 58.47% 15703141 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=39 prefix-density=0.16 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.11 sequence-density-rank=9 fanout-score=196.81 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=26.6 sequence=TTCTTCTTCTTTGC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=38 prefix-density=0.33 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=256.52 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=26.9 sequence=AAGAAGAAGAAG SRR7168991 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:52:29 Started mapping on | Feb 10 14:52:29 Finished on | Feb 10 14:53:51 Mapping speed, Million of reads per hour | 689.41 Number of input reads | 15703141 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14989760 Uniquely mapped reads % | 95.46% Average mapped length | 296.53 Number of splices: Total | 14903544 Number of splices: Annotated (sjdb) | 14673054 Number of splices: GT/AG | 14673982 Number of splices: GC/AG | 184470 Number of splices: AT/AC | 12409 Number of splices: Non-canonical | 32683 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 258364 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 52929 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.52% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 467266 467266 467266 N_multimapping 258364 258364 258364 N_noFeature 367082 14875941 412375 N_ambiguous 131039 920 61798 UnstrandedReadsAssigned:14491639 PositiveStrandReadsAssigned:112899 NegativeStrandReadsAssigned:14515587 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168991 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168991-trimmed-pair1.fastq SRR7168991-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,703,141 reads, 14,373,171 reads pseudoaligned [quant] estimated average fragment length: 240.558 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,264 rounds 52401 SRR7168991.ke.tsv 34699 SRR7168991.se.tsv 87100 total ==> SRR7168991.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.44 317 13.0735 Potri.005G024800.1.v4.1 1035 795.442 41 3.78048 Potri.004G059700.1.v4.1 961 721.442 3 0.304994 Potri.007G009000.2.v4.1 1416 1176.44 0 0 Potri.003G141000.2.v4.1 2943 2703.44 289.065 7.84243 Potri.016G087400.1.v4.1 270 70.2933 747 779.433 Potri.015G069301.1.v4.1 564 325.81 0 0 Potri.010G195200.1.v4.1 1773 1533.44 21 1.00444 Potri.012G127500.1.v4.1 977 737.442 9583 953.115 ==> SRR7168991.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 931 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168991 completed mapping pipeline successfully