Starting /dee2/code/volunteer_pipeline.sh SRR7168992 current disk space = 3059011878912 free memory = 1018383340 SRR7168992 SRAfilesize 991329d49bb981fc2ca63e1c1ba95ad8 SRR7168992.sra SRR7168992.sra file validated SRR7168992 is paired end SRR7168992 is conventional basespace SRR7168992 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168992_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.842 34.0 33.0 34.0 32.0 34.0 2 32.95825 34.0 33.0 34.0 32.0 34.0 3 32.962 34.0 33.0 34.0 32.0 34.0 4 32.814 34.0 33.0 34.0 32.0 34.0 5 32.65175 34.0 33.0 34.0 32.0 34.0 6 36.5525 38.0 37.0 38.0 34.0 38.0 7 36.92975 38.0 38.0 38.0 35.0 38.0 8 37.2125 38.0 38.0 38.0 36.0 38.0 9 37.2075 38.0 38.0 38.0 36.0 38.0 10-14 37.28415 38.0 38.0 38.0 37.0 38.0 15-19 37.1658 38.0 38.0 38.0 36.2 38.0 20-24 37.032450000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.8523 38.0 38.0 38.0 35.0 38.0 30-34 36.7573 38.0 38.0 38.0 35.0 38.0 35-39 36.727 38.0 38.0 38.0 34.6 38.0 40-44 36.350350000000006 38.0 38.0 38.0 33.4 38.0 45-49 36.5794 38.0 38.0 38.0 34.0 38.0 50-54 36.5548 38.0 38.0 38.0 34.0 38.0 55-59 36.196799999999996 38.0 37.2 38.0 32.8 38.0 60-64 36.398900000000005 38.0 37.6 38.0 33.8 38.0 65-69 36.3256 38.0 37.2 38.0 33.4 38.0 70-74 36.2333 38.0 37.0 38.0 33.0 38.0 75-79 36.05235 38.0 37.0 38.0 32.2 38.0 80-84 35.926050000000004 38.0 37.0 38.0 31.4 38.0 85-89 35.449 38.0 36.0 38.0 29.0 38.0 90-94 35.26175 38.0 36.0 38.0 29.0 38.0 95-99 35.369699999999995 38.0 36.0 38.0 28.8 38.0 100-104 34.8821 38.0 35.4 38.0 26.8 38.0 105-109 35.1697 38.0 36.0 38.0 28.4 38.0 110-114 34.7673 38.0 35.0 38.0 26.6 38.0 115-119 34.47145 38.0 34.8 38.0 24.8 38.0 120-124 34.3708 38.0 34.4 38.0 24.2 38.0 125-129 33.30305 37.8 33.4 38.0 17.8 38.0 130-134 33.144499999999994 37.8 33.4 38.0 18.6 38.0 135-139 32.51605 37.2 31.2 38.0 16.0 38.0 140-144 32.6314 38.0 32.2 38.0 15.4 38.0 145-149 30.865299999999998 36.0 31.0 38.0 8.6 38.0 150-151 25.86425 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 6.0 18 2.0 19 6.0 20 5.0 21 7.0 22 16.0 23 11.0 24 21.0 25 22.0 26 45.0 27 40.0 28 55.0 29 74.0 30 93.0 31 141.0 32 123.0 33 185.0 34 286.0 35 478.0 36 878.0 37 1498.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.5 11.725 9.950000000000001 41.825 2 22.125 15.4 35.15 27.325 3 19.85 18.375 25.825 35.949999999999996 4 22.675 28.449999999999996 22.400000000000002 26.474999999999998 5 22.773024660291895 33.090085556114744 24.484146955208857 19.652742828384497 6 19.45 35.425000000000004 24.0 21.125 7 14.899999999999999 26.05 40.375 18.675 8 17.575 25.724999999999998 31.275 25.424999999999997 9 17.625 24.725 32.574999999999996 25.074999999999996 10-14 20.27 29.830000000000002 26.840000000000003 23.06 15-19 20.025000000000002 28.51 27.794999999999998 23.669999999999998 20-24 20.575 28.615000000000002 27.54 23.27 25-29 19.939999999999998 28.544999999999998 27.529999999999998 23.985 30-34 19.744999999999997 29.34 27.725 23.189999999999998 35-39 20.315 28.665000000000003 27.255000000000003 23.765 40-44 20.53 28.88 27.165 23.425 45-49 20.349999999999998 28.93 27.29 23.43 50-54 19.925 28.235 27.325 24.515 55-59 20.227079477817238 28.715050267593657 27.579652878507478 23.478217376081627 60-64 19.939999999999998 29.225 26.939999999999998 23.895 65-69 19.895 28.634999999999998 27.815 23.655 70-74 20.965 28.17 27.48 23.385 75-79 20.23213928357014 28.65719431658995 27.846708024814887 23.263958375025016 80-84 20.060030015007506 28.864432216108053 27.25862931465733 23.816908454227114 85-89 20.01402032947774 29.18231435581593 27.30959891843173 23.494066396274597 90-94 20.279051025034 27.935324636075155 27.617992242985945 24.1676320959049 95-99 20.335 28.660000000000004 27.875 23.13 100-104 20.925 28.98 26.76 23.335 105-109 20.518217811857866 28.988122086904223 27.404400340800883 23.089259760437027 110-114 20.71 29.020000000000003 26.650000000000002 23.62 115-119 20.665 28.07 27.79 23.474999999999998 120-124 20.895 27.785 27.415 23.905 125-129 21.145 28.355000000000004 26.815 23.685000000000002 130-134 20.67913582716543 28.300660132026405 27.500500100020002 23.51970394078816 135-139 20.71 28.65 27.37 23.27 140-144 20.59 28.455000000000002 26.99 23.965 145-149 21.132721959084954 28.88743323591656 26.69555577950217 23.28428902549632 150-151 21.117779444861213 27.431857964491122 27.70692673168292 23.74343585896474 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 1.5 24 2.5 25 2.5 26 3.0 27 5.0 28 9.0 29 14.5 30 24.0 31 26.0 32 23.0 33 34.5 34 48.5 35 67.0 36 82.0 37 94.5 38 123.0 39 165.5 40 194.0 41 209.0 42 227.0 43 252.5 44 285.0 45 302.0 46 289.5 47 264.5 48 242.0 49 211.5 50 177.0 51 145.0 52 113.5 53 87.5 54 73.5 55 52.0 56 33.5 57 28.5 58 23.5 59 16.5 60 10.0 61 10.0 62 8.0 63 4.0 64 3.0 65 2.5 66 1.5 67 0.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.65 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.034999999999999996 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.06 80-84 0.05 85-89 0.145 90-94 0.735 95-99 0.0 100-104 0.0 105-109 0.23500000000000001 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.02 135-139 0.0 140-144 0.0 145-149 0.77 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.675 0.0 0.0 0.0 0.0 128-129 1.875 0.0 0.0 0.0 0.0 130-131 2.1624999999999996 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.6125 0.0 0.0 0.0 0.0 136-137 2.9375 0.0 0.0 0.0 0.0 138-139 3.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACAAA 10 0.0066990857 145.92406 5 GAGCCTC 10 0.006959184 144.1 9 AAATAAC 10 0.006959184 144.1 6 ATAACAG 10 0.006959184 144.1 8 >>END_MODULE SRR7168992 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168992_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4425 33.0 33.0 34.0 32.0 34.0 2 32.69725 34.0 33.0 34.0 32.0 34.0 3 32.62975 34.0 33.0 34.0 32.0 34.0 4 32.3975 34.0 33.0 34.0 32.0 34.0 5 32.5415 34.0 33.0 34.0 32.0 34.0 6 36.49525 38.0 38.0 38.0 35.0 38.0 7 36.60325 38.0 38.0 38.0 35.0 38.0 8 36.12375 38.0 38.0 38.0 34.0 38.0 9 36.404 38.0 38.0 38.0 34.0 38.0 10-14 36.3219 38.0 38.0 38.0 34.0 38.0 15-19 36.2367 38.0 38.0 38.0 34.0 38.0 20-24 36.545049999999996 38.0 38.0 38.0 35.4 38.0 25-29 36.46825 38.0 38.0 38.0 34.6 38.0 30-34 36.41115 38.0 38.0 38.0 34.4 38.0 35-39 36.4381 38.0 38.0 38.0 34.8 38.0 40-44 36.54075 38.0 38.0 38.0 34.8 38.0 45-49 36.46485 38.0 38.0 38.0 34.4 38.0 50-54 36.28245 38.0 38.0 38.0 34.4 38.0 55-59 35.59605 38.0 38.0 38.0 30.0 38.0 60-64 35.583850000000005 38.0 37.8 38.0 29.8 38.0 65-69 35.64405000000001 38.0 38.0 38.0 31.2 38.0 70-74 36.01795 38.0 38.0 38.0 33.0 38.0 75-79 35.78855 38.0 38.0 38.0 31.0 38.0 80-84 35.8296 38.0 38.0 38.0 31.6 38.0 85-89 35.77425 38.0 37.4 38.0 31.2 38.0 90-94 35.94725 38.0 38.0 38.0 33.0 38.0 95-99 35.650400000000005 38.0 37.4 38.0 30.6 38.0 100-104 35.49225 38.0 37.0 38.0 30.6 38.0 105-109 35.10485 38.0 37.0 38.0 28.2 38.0 110-114 34.74895 38.0 36.8 38.0 25.8 38.0 115-119 34.77715 38.0 36.4 38.0 26.2 38.0 120-124 34.77425 38.0 36.0 38.0 26.4 38.0 125-129 34.494749999999996 38.0 35.6 38.0 24.0 38.0 130-134 34.392250000000004 38.0 35.0 38.0 23.6 38.0 135-139 33.9125 38.0 34.8 38.0 21.0 38.0 140-144 33.00095 38.0 34.0 38.0 16.6 38.0 145-149 31.6031 38.0 31.8 38.0 8.6 38.0 150-151 27.7555 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 5.0 9 4.0 10 0.0 11 3.0 12 0.0 13 1.0 14 4.0 15 7.0 16 5.0 17 8.0 18 9.0 19 15.0 20 13.0 21 18.0 22 17.0 23 15.0 24 23.0 25 34.0 26 32.0 27 45.0 28 58.0 29 50.0 30 63.0 31 81.0 32 93.0 33 129.0 34 174.0 35 267.0 36 525.0 37 2273.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.34190620272315 20.146243066061523 15.758951084215836 29.7528996469995 2 26.80851063829787 26.758448060075096 30.36295369211515 16.07008760951189 3 20.151133501259448 27.657430730478588 31.284634760705288 20.906801007556673 4 23.24283176858665 32.656686120274045 24.460796752093376 19.639685359045927 5 24.143107330497873 35.37653239929948 22.066549912434326 18.413810357768327 6 20.035017508754375 38.519259629814904 23.411705852926463 18.034017008504254 7 18.99974868057301 20.65845689871827 40.613219401859766 19.728575018848957 8 22.19400711020823 24.073133570340275 27.78059928897918 25.952260030472317 9 22.057344064386317 24.647887323943664 30.181086519114686 23.113682092555333 10-14 23.595562279374686 28.825012607160865 26.303580433686335 21.275844679778114 15-19 22.477992512395023 28.103814631184864 28.18476171203076 21.233431144389357 20-24 23.04518466337929 27.463017007145012 28.283184059575323 21.208614269900373 25-29 23.123153202784593 27.725747483347522 27.936094556017427 21.21500475785045 30-34 22.784364951768488 28.16519292604502 28.391278135048232 20.659163987138264 35-39 22.786530427341823 27.553228972668244 28.49448834751095 21.16575225247899 40-44 23.159901660729517 28.162159450102852 27.891224725302294 20.786714163865337 45-49 23.44118384750439 27.48934035615751 28.542763982944567 20.52671181339353 50-54 23.46938775510204 27.64149994973359 28.310043229114306 20.579069066050064 55-59 23.476620264137473 27.555963489878128 27.93330273825914 21.034113507725255 60-64 23.197428177782314 27.371536459662195 28.565596775016584 20.86543858753891 65-69 23.266390720016354 27.90127242066534 28.248760795135162 20.583576064183145 70-74 23.493247329167506 26.894779278371296 28.678693811731502 20.933279580729693 75-79 23.452735815692417 27.807810842216945 27.979588743495178 20.759864598595463 80-84 23.03991085899514 27.46150729335494 28.40356564019449 21.09501620745543 85-89 24.025616650823032 27.758042727773052 27.84309801370891 20.373242607695 90-94 23.20892535521313 28.041825095057032 28.116870122073244 20.632379427656595 95-99 23.535023851368315 28.119507908611602 27.938739643484812 20.406728596535277 100-104 23.55074288592294 27.69579451019894 28.26995718962478 20.483505414253337 105-109 23.19133866234949 27.780026307801275 28.220176059900844 20.808458969948397 110-114 23.744199092253556 27.645468917333876 28.11974093528482 20.490591055127748 115-119 24.07115628970775 27.720457433290978 27.872935196950444 20.335451080050827 120-124 23.5906678682287 27.946330229298088 27.841193551617106 20.621808350856114 125-129 24.15175662807598 28.396732320954243 27.06359945872801 20.387911592241768 130-134 24.203821656050955 27.844927027433673 28.100707156828324 19.850544159687043 135-139 23.908253205128204 27.87459935897436 27.87459935897436 20.342548076923077 140-144 24.59369983948636 28.42596308186196 26.98134028892456 19.998996789727126 145-149 24.220321931589535 27.96780684104628 27.761569416498993 20.05030181086519 150-151 24.746145167356147 27.316033596590195 27.441394007772345 20.49642722828131 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.5 15 1.5 16 1.5 17 4.0 18 3.5 19 1.5 20 4.0 21 4.5 22 2.5 23 3.0 24 3.5 25 5.0 26 6.0 27 6.0 28 10.5 29 12.0 30 12.5 31 16.5 32 23.0 33 39.0 34 52.5 35 66.0 36 86.0 37 101.0 38 127.5 39 174.0 40 211.0 41 233.0 42 248.0 43 256.0 44 279.0 45 285.5 46 271.5 47 271.0 48 236.0 49 203.0 50 171.0 51 125.0 52 114.0 53 96.0 54 64.5 55 40.0 56 26.5 57 23.0 58 23.5 59 18.5 60 10.5 61 7.0 62 4.5 63 3.0 64 1.5 65 1.5 66 2.5 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.125 3 0.75 4 1.4749999999999999 5 0.075 6 0.05 7 0.525 8 1.55 9 0.6 10-14 0.8500000000000001 15-19 1.17 20-24 0.63 25-29 0.165 30-34 0.48 35-39 0.6649999999999999 40-44 0.345 45-49 0.325 50-54 0.53 55-59 1.9449999999999998 60-64 2.015 65-69 2.155 70-74 0.7799999999999999 75-79 1.035 80-84 1.28 85-89 0.065 90-94 0.06 95-99 0.42500000000000004 100-104 0.7250000000000001 105-109 1.17 110-114 1.955 115-119 1.625 120-124 0.13 125-129 0.23500000000000001 130-134 0.305 135-139 0.16 140-144 0.32 145-149 0.6 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.8374999999999999 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.3625 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.725 0.0 0.0 0.0 0.0 128-129 1.925 0.0 0.0 0.0 0.0 130-131 2.2125000000000004 0.0 0.0 0.0 0.0 132-133 2.475 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 2.9625 0.0 0.0 0.0 0.0 138-139 3.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCTC 10 0.0070571178 143.40506 2 CACACTG 10 0.0070571178 143.40506 2 >>END_MODULE Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900671 spots for SRR7168992.sra Written 900671 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra Read 900667 spots for SRR7168992.sra Written 900667 spots for SRR7168992.sra SRR ids: ['SRR7168992.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i26g_53p SRR7168992.sra spots: 18013344 blocks: [[1, 900667], [900668, 1801334], [1801335, 2702001], [2702002, 3602668], [3602669, 4503335], [4503336, 5404002], [5404003, 6304669], [6304670, 7205336], [7205337, 8106003], [8106004, 9006670], [9006671, 9907337], [9907338, 10808004], [10808005, 11708671], [11708672, 12609338], [12609339, 13510005], [13510006, 14410672], [14410673, 15311339], [15311340, 16212006], [16212007, 17112673], [17112674, 18013344]] SRR7168992 file size 6082430 SRR7168992 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168992 SRR7168992_1.fastq SRR7168992_2.fastq Input file: SRR7168992_1.fastq Paired file: SRR7168992_2.fastq trimmed: SRR7168992-trimmed-pair1.fastq, SRR7168992-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:34:23 2025 >> started Mon Feb 10 14:34:42 2025 >> done (18.987s) 18013344 read pairs processed; of these: 16539 ( 0.09%) short read pairs filtered out after trimming by size control 25407 ( 0.14%) empty read pairs filtered out after trimming by size control 17971398 (99.77%) read pairs available; of these: 8491364 (47.25%) trimmed read pairs available after processing 9480034 (52.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 3 0.00% 20 1 0.00% 21 4 0.00% 22 2 0.00% 23 4 0.00% 24 5 0.00% 25 8 0.00% 26 8 0.00% 27 3 0.00% 28 7 0.00% 29 7 0.00% 30 10 0.00% 31 4 0.00% 32 4 0.00% 33 6 0.00% 34 5 0.00% 35 4 0.00% 36 5 0.00% 37 15 0.00% 38 7 0.00% 39 12 0.00% 40 10 0.00% 41 16 0.00% 42 14 0.00% 43 13 0.00% 44 8 0.00% 45 13 0.00% 46 14 0.00% 47 26 0.00% 48 25 0.00% 49 32 0.00% 50 34 0.00% 51 25 0.00% 52 36 0.00% 53 44 0.00% 54 46 0.00% 55 44 0.00% 56 54 0.00% 57 51 0.00% 58 60 0.00% 59 75 0.00% 60 95 0.00% 61 85 0.00% 62 117 0.00% 63 132 0.00% 64 150 0.00% 65 159 0.00% 66 155 0.00% 67 204 0.00% 68 241 0.00% 69 272 0.00% 70 327 0.00% 71 336 0.00% 72 398 0.00% 73 475 0.00% 74 490 0.00% 75 574 0.00% 76 631 0.00% 77 770 0.00% 78 878 0.00% 79 962 0.01% 80 1004 0.01% 81 1252 0.01% 82 1494 0.01% 83 1670 0.01% 84 2420 0.01% 85 2730 0.02% 86 2991 0.02% 87 3372 0.02% 88 3472 0.02% 89 3689 0.02% 90 4109 0.02% 91 4301 0.02% 92 4750 0.03% 93 4963 0.03% 94 5212 0.03% 95 5804 0.03% 96 6451 0.04% 97 6807 0.04% 98 7128 0.04% 99 7487 0.04% 100 8147 0.05% 101 8653 0.05% 102 9210 0.05% 103 9715 0.05% 104 10572 0.06% 105 11339 0.06% 106 12241 0.07% 107 12583 0.07% 108 13465 0.07% 109 14448 0.08% 110 15279 0.09% 111 15814 0.09% 112 16886 0.09% 113 17682 0.10% 114 18600 0.10% 115 19939 0.11% 116 21183 0.12% 117 22459 0.12% 118 23457 0.13% 119 24363 0.14% 120 25538 0.14% 121 27138 0.15% 122 28532 0.16% 123 30063 0.17% 124 31560 0.18% 125 33291 0.19% 126 35919 0.20% 127 38100 0.21% 128 40078 0.22% 129 42394 0.24% 130 45144 0.25% 131 48045 0.27% 132 50605 0.28% 133 54778 0.30% 134 58747 0.33% 135 63264 0.35% 136 67917 0.38% 137 73291 0.41% 138 79544 0.44% 139 87452 0.49% 140 95715 0.53% 141 106190 0.59% 142 119463 0.66% 143 135740 0.76% 144 159892 0.89% 145 195508 1.09% 146 245836 1.37% 147 333562 1.86% 148 499592 2.78% 149 941129 5.24% 150 4301973 23.94% 151 9480034 52.75% 17971398 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=140.67 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=11.4 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=35 prefix-density=0.30 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=136.40 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=14.3 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCTCGG SRR7168992 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:35:25 Started mapping on | Feb 10 14:35:25 Finished on | Feb 10 14:37:18 Mapping speed, Million of reads per hour | 572.54 Number of input reads | 17971398 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17228322 Uniquely mapped reads % | 95.87% Average mapped length | 295.63 Number of splices: Total | 16175955 Number of splices: Annotated (sjdb) | 15921236 Number of splices: GT/AG | 15952676 Number of splices: GC/AG | 178982 Number of splices: AT/AC | 12615 Number of splices: Non-canonical | 31682 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324773 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 30011 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 435511 435511 435511 N_multimapping 324773 324773 324773 N_noFeature 387709 17008278 500018 N_ambiguous 179933 1314 71146 UnstrandedReadsAssigned:16660680 PositiveStrandReadsAssigned:218730 NegativeStrandReadsAssigned:16657158 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168992 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168992-trimmed-pair1.fastq SRR7168992-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,971,398 reads, 16,551,805 reads pseudoaligned [quant] estimated average fragment length: 252.484 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7168992.ke.tsv 34699 SRR7168992.se.tsv 87100 total ==> SRR7168992.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.52 287 10.0079 Potri.005G024800.1.v4.1 1035 783.516 34 2.67307 Potri.004G059700.1.v4.1 961 709.58 5 0.434058 Potri.007G009000.2.v4.1 1416 1164.52 0 0 Potri.003G141000.2.v4.1 2943 2691.52 276.08 6.31853 Potri.016G087400.1.v4.1 270 73.9521 1434.65 1195.02 Potri.015G069301.1.v4.1 564 318.652 0 0 Potri.010G195200.1.v4.1 1773 1521.52 9 0.364372 Potri.012G127500.1.v4.1 977 725.554 3855 327.291 ==> SRR7168992.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1539 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 241 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7168992 completed mapping pipeline successfully