Starting /dee2/code/volunteer_pipeline.sh SRR7168993 current disk space = 3058879270912 free memory = 1210482532 SRR7168993 SRAfilesize 70f6acf097365ccf5b60ff7a2cc8437d SRR7168993.sra SRR7168993.sra file validated SRR7168993 is paired end SRR7168993 is conventional basespace SRR7168993 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168993_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.902 34.0 33.0 34.0 32.0 34.0 2 33.01225 34.0 33.0 34.0 32.0 34.0 3 33.02675 34.0 33.0 34.0 32.0 34.0 4 32.8175 34.0 33.0 34.0 32.0 34.0 5 32.6505 34.0 33.0 34.0 32.0 34.0 6 36.54025 38.0 37.0 38.0 34.0 38.0 7 36.9285 38.0 38.0 38.0 35.0 38.0 8 37.211 38.0 38.0 38.0 36.0 38.0 9 37.342 38.0 38.0 38.0 37.0 38.0 10-14 37.3134 38.0 38.0 38.0 37.0 38.0 15-19 37.192049999999995 38.0 38.0 38.0 36.2 38.0 20-24 37.110699999999994 38.0 38.0 38.0 36.0 38.0 25-29 36.92015 38.0 38.0 38.0 36.0 38.0 30-34 36.87485 38.0 38.0 38.0 35.2 38.0 35-39 36.80315 38.0 38.0 38.0 35.2 38.0 40-44 36.4647 38.0 38.0 38.0 33.8 38.0 45-49 36.62245 38.0 38.0 38.0 34.2 38.0 50-54 36.6259 38.0 38.0 38.0 34.2 38.0 55-59 36.39365 38.0 37.8 38.0 33.6 38.0 60-64 36.4351 38.0 37.8 38.0 34.0 38.0 65-69 36.3638 38.0 37.6 38.0 33.6 38.0 70-74 36.3223 38.0 37.2 38.0 33.4 38.0 75-79 36.024249999999995 38.0 37.0 38.0 32.4 38.0 80-84 35.97945 38.0 37.0 38.0 32.6 38.0 85-89 35.507149999999996 38.0 36.6 38.0 29.6 38.0 90-94 35.23635 38.0 36.0 38.0 28.8 38.0 95-99 35.496050000000004 38.0 36.0 38.0 29.0 38.0 100-104 34.9884 38.0 35.8 38.0 27.2 38.0 105-109 35.24515 38.0 36.0 38.0 28.4 38.0 110-114 34.81185000000001 38.0 35.2 38.0 26.8 38.0 115-119 34.493199999999995 38.0 34.4 38.0 24.8 38.0 120-124 34.386 38.0 34.6 38.0 24.4 38.0 125-129 33.3524 37.8 33.2 38.0 18.2 38.0 130-134 33.285450000000004 37.6 33.6 38.0 18.6 38.0 135-139 32.7832 37.2 31.6 38.0 18.4 38.0 140-144 32.86945 38.0 32.6 38.0 17.0 38.0 145-149 31.1532 36.2 31.0 38.0 10.8 38.0 150-151 26.293625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 1.0 15 1.0 16 1.0 17 4.0 18 3.0 19 4.0 20 9.0 21 7.0 22 10.0 23 8.0 24 14.0 25 31.0 26 28.0 27 43.0 28 56.0 29 74.0 30 87.0 31 106.0 32 149.0 33 206.0 34 267.0 35 459.0 36 896.0 37 1530.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.675000000000004 13.525 7.95 34.849999999999994 2 22.25 16.0 34.675 27.075 3 18.7 23.200000000000003 26.724999999999998 31.374999999999996 4 21.4 29.9 23.400000000000002 25.3 5 22.47983870967742 33.694556451612904 23.4375 20.38810483870968 6 19.1 36.625 25.124999999999996 19.15 7 13.725000000000001 25.95 41.15 19.175 8 17.625 25.374999999999996 31.95 25.05 9 17.025000000000002 25.3 33.050000000000004 24.625 10-14 19.900000000000002 29.965000000000003 26.195 23.94 15-19 19.855 28.904999999999998 27.485 23.755000000000003 20-24 20.175 28.925 27.32 23.580000000000002 25-29 20.055 29.020000000000003 27.785 23.14 30-34 19.91 29.304999999999996 26.735 24.05 35-39 20.424999999999997 28.255000000000003 27.169999999999998 24.15 40-44 19.25 29.110000000000003 27.57 24.07 45-49 20.0 29.189999999999998 26.69 24.12 50-54 20.235 28.720000000000002 27.735 23.31 55-59 19.772909163665467 29.20168067226891 27.055822328931573 23.969587835134053 60-64 19.634999999999998 29.189999999999998 26.63 24.545 65-69 20.14 28.96 26.875 24.025 70-74 20.455000000000002 28.860000000000003 27.345000000000002 23.34 75-79 20.335251438578933 28.676507380535405 26.945208906680012 24.043032274205654 80-84 20.379170626782052 28.903006352858785 27.31729278175179 23.400530238607374 85-89 20.35766167409708 28.6229524620548 27.701247307518912 23.31813855632921 90-94 20.033246020552088 28.279266572637518 27.785613540197463 23.901873866612934 95-99 20.755000000000003 28.000000000000004 27.279999999999998 23.965 100-104 20.73 29.060000000000002 26.97 23.24 105-109 20.640890627350682 28.88521137355198 26.44300687026729 24.03089112883005 110-114 20.369999999999997 28.175 27.810000000000002 23.645 115-119 20.7 28.444999999999997 27.345000000000002 23.51 120-124 20.89 28.175 26.965 23.97 125-129 20.66 28.01 27.21 24.12 130-134 20.72725453908868 28.079827939778923 27.094483069074176 24.09843445205822 135-139 20.560000000000002 28.48 26.924999999999997 24.035 140-144 20.015 28.435 27.534999999999997 24.015 145-149 20.835432832812657 28.18200141086365 27.234707245792606 23.74785851053109 150-151 20.7577841690634 28.523196198574464 27.085156933850197 23.633862698511944 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 4.0 26 5.0 27 8.0 28 12.5 29 11.5 30 15.0 31 25.0 32 34.5 33 46.0 34 54.0 35 60.0 36 86.0 37 113.0 38 119.0 39 138.5 40 171.5 41 219.5 42 246.0 43 251.0 44 261.5 45 282.0 46 293.5 47 266.0 48 245.0 49 225.5 50 189.0 51 149.5 52 125.0 53 104.5 54 70.0 55 41.5 56 30.5 57 23.0 58 16.5 59 14.0 60 10.0 61 8.0 62 6.0 63 3.0 64 2.0 65 1.0 66 1.0 67 1.0 68 2.5 69 2.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.8 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.04 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.075 80-84 0.045 85-89 0.185 90-94 0.74 95-99 0.0 100-104 0.0 105-109 0.295 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.034999999999999996 135-139 0.0 140-144 0.0 145-149 0.77 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.7875 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.15 0.0 0.0 0.0 0.0 132-133 1.2125 0.0 0.0 0.0 0.0 134-135 1.3250000000000002 0.0 0.0 0.0 0.0 136-137 1.4875 0.0 0.0 0.0 0.0 138-139 1.7625000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGTGT 10 0.006841402 144.925 7 >>END_MODULE SRR7168993 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168993_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42125 33.0 33.0 34.0 32.0 34.0 2 32.50975 34.0 33.0 34.0 32.0 34.0 3 32.54275 34.0 33.0 34.0 32.0 34.0 4 32.3795 34.0 33.0 34.0 32.0 34.0 5 32.481 34.0 33.0 34.0 32.0 34.0 6 36.3925 38.0 38.0 38.0 34.0 38.0 7 36.4935 38.0 38.0 38.0 35.0 38.0 8 36.0585 38.0 38.0 38.0 34.0 38.0 9 36.221 38.0 38.0 38.0 34.0 38.0 10-14 36.27115 38.0 38.0 38.0 34.0 38.0 15-19 36.13965 38.0 38.0 38.0 33.6 38.0 20-24 36.3269 38.0 38.0 38.0 34.4 38.0 25-29 36.3425 38.0 38.0 38.0 34.6 38.0 30-34 36.054700000000004 38.0 38.0 38.0 33.8 38.0 35-39 36.21185 38.0 38.0 38.0 34.4 38.0 40-44 36.27725 38.0 38.0 38.0 34.2 38.0 45-49 36.15675 38.0 38.0 38.0 33.8 38.0 50-54 36.0144 38.0 38.0 38.0 33.2 38.0 55-59 35.45925 38.0 38.0 38.0 29.8 38.0 60-64 35.4726 38.0 38.0 38.0 29.8 38.0 65-69 35.4872 38.0 38.0 38.0 30.2 38.0 70-74 35.79430000000001 38.0 38.0 38.0 32.2 38.0 75-79 35.66485 38.0 38.0 38.0 31.0 38.0 80-84 35.63600000000001 38.0 38.0 38.0 31.4 38.0 85-89 35.5878 38.0 37.6 38.0 30.0 38.0 90-94 35.706300000000006 38.0 38.0 38.0 32.6 38.0 95-99 35.46835 38.0 37.4 38.0 30.6 38.0 100-104 35.21225 38.0 37.0 38.0 28.6 38.0 105-109 34.801899999999996 38.0 36.8 38.0 26.6 38.0 110-114 34.694750000000006 38.0 36.6 38.0 26.6 38.0 115-119 34.60235 38.0 36.4 38.0 25.4 38.0 120-124 34.60170000000001 38.0 36.0 38.0 26.4 38.0 125-129 34.2634 38.0 35.4 38.0 23.4 38.0 130-134 34.19395 38.0 35.4 38.0 23.0 38.0 135-139 33.808299999999996 38.0 35.0 38.0 21.0 38.0 140-144 32.9829 38.0 34.0 38.0 15.2 38.0 145-149 31.73365 38.0 32.4 38.0 8.6 38.0 150-151 28.23675 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 4.0 4 5.0 5 2.0 6 6.0 7 3.0 8 2.0 9 0.0 10 4.0 11 3.0 12 4.0 13 5.0 14 4.0 15 5.0 16 11.0 17 7.0 18 9.0 19 13.0 20 8.0 21 16.0 22 15.0 23 23.0 24 26.0 25 24.0 26 33.0 27 30.0 28 48.0 29 55.0 30 63.0 31 74.0 32 103.0 33 127.0 34 129.0 35 258.0 36 540.0 37 2303.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.88395560040363 23.133198789101918 11.579212916246217 25.403632694248234 2 27.574083375188348 25.715720743345056 29.984932194876947 16.725263686589653 3 19.55971659919028 28.795546558704455 32.11032388663968 19.534412955465587 4 24.143183549124142 33.815689261233814 23.71160192942371 18.32952526021833 5 24.354798296166376 35.379604109245804 21.77399148083187 18.49160611375595 6 20.96168294515402 37.7160030052592 22.789882294014525 18.53243175557225 7 19.102822580645164 22.555443548387096 39.238911290322584 19.102822580645164 8 21.559167089893347 23.539867953275774 28.390045708481466 26.510919248349417 9 20.852244074634392 24.079677256681794 30.408472012102873 24.659606656580937 10-14 23.11149262775197 28.867905473641684 26.166431024035546 21.854170874570794 15-19 22.90728845278438 27.712305902584593 28.14728642961914 21.233119215011886 20-24 22.752469260229795 27.428945777061074 28.537593227171943 21.280991735537192 25-29 22.64680808384735 27.877237851662407 28.238302993831805 21.23765107065844 30-34 23.440643863179076 28.65191146881288 27.816901408450708 20.090543259557343 35-39 22.800564345460042 28.398669757129902 27.476569585810743 21.324196311599312 40-44 23.343055415870463 27.69284924067183 28.422005430956453 20.542089912501257 45-49 22.92785782418796 28.49038606355741 28.10382047291531 20.47793563933932 50-54 23.183809092282132 28.30891607511453 27.694708754971554 20.81256607763178 55-59 23.329598696272154 27.464860460378897 28.671827256060293 20.533713587288656 60-64 22.83834107024435 28.204866602050704 27.84777840126511 21.109013926439832 65-69 23.133489939740578 27.83678888775406 28.194260034725772 20.835461137779593 70-74 23.477426522573477 27.56287243712756 28.33047166952833 20.62922937077063 75-79 23.41727346278317 26.997370550161815 28.63066343042071 20.954692556634306 80-84 23.323703816329633 27.368100957883534 28.381734326694037 20.926460899092795 85-89 23.857715430861724 27.039078156312623 28.336673346693388 20.766533066132265 90-94 23.438047998396712 27.60158324565359 28.73390450423368 20.226464251716017 95-99 23.786310181927835 27.042918886320233 28.671223238516436 20.499547693235503 100-104 23.74855068810808 27.55456974340878 27.87215808842063 20.82472148006251 105-109 23.9630869080215 27.45664739884393 28.11580975560288 20.46445593753169 110-114 24.09484956654768 27.414584395716474 28.04691483936767 20.44365119836818 115-119 23.990655629475395 27.728403839317455 28.043268498298712 20.237672032908435 120-124 24.32811873245086 26.815082230244684 28.123746490172486 20.73305254713197 125-129 24.26585010792631 27.624115255258268 27.679333366798854 20.430701270016566 130-134 23.823869056584826 27.986142491339056 28.036350856052618 20.153637596023497 135-139 23.750752558699578 28.155729480232793 27.950030102347984 20.14348785871965 140-144 23.42980604964325 28.15294945231635 27.419354838709676 20.99788965933072 145-149 24.026595476754142 28.28287916183952 27.34095602679696 20.34956933460938 150-151 24.579462716545315 27.240773286467483 28.52121516444891 19.65854883253829 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.5 10 2.0 11 1.0 12 1.0 13 1.0 14 2.5 15 3.0 16 2.0 17 1.0 18 1.0 19 3.0 20 4.5 21 5.5 22 6.5 23 4.5 24 2.5 25 3.0 26 5.0 27 7.0 28 8.5 29 10.0 30 9.0 31 17.0 32 29.5 33 37.0 34 49.5 35 68.5 36 87.0 37 117.0 38 147.5 39 155.5 40 174.0 41 213.0 42 250.5 43 270.0 44 289.5 45 292.0 46 283.0 47 261.0 48 230.5 49 207.5 50 159.5 51 130.0 52 110.5 53 87.0 54 71.0 55 50.5 56 34.5 57 28.5 58 21.5 59 14.5 60 9.0 61 3.0 62 3.5 63 3.5 64 1.0 65 1.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.44999999999999996 3 1.2 4 1.525 5 0.22499999999999998 6 0.17500000000000002 7 0.8 8 1.55 9 0.8500000000000001 10-14 0.98 15-19 1.145 20-24 0.7799999999999999 25-29 0.295 30-34 0.6 35-39 0.77 40-44 0.5700000000000001 45-49 0.40499999999999997 50-54 0.685 55-59 1.82 60-64 1.9849999999999999 65-69 2.09 70-74 0.9900000000000001 75-79 1.1199999999999999 80-84 1.345 85-89 0.2 90-94 0.20500000000000002 95-99 0.51 100-104 0.815 105-109 1.39 110-114 1.95 115-119 1.545 120-124 0.27999999999999997 125-129 0.395 130-134 0.415 135-139 0.33999999999999997 140-144 0.49 145-149 0.735 150-151 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.2761044176706827 0.5499999999999999 3 0.0251004016064257 0.075 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.7625 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.9125000000000001 0.0 0.0 0.0 0.0 128-129 1.0499999999999998 0.0 0.0 0.0 0.0 130-131 1.1749999999999998 0.0 0.0 0.0 0.0 132-133 1.2374999999999998 0.0 0.0 0.0 0.0 134-135 1.35 0.0 0.0 0.0 0.0 136-137 1.5125 0.0 0.0 0.0 0.0 138-139 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATCCT 10 0.0069700265 144.02501 6 >>END_MODULE Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921167 spots for SRR7168993.sra Written 921167 spots for SRR7168993.sra Read 921174 spots for SRR7168993.sra Written 921174 spots for SRR7168993.sra SRR ids: ['SRR7168993.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_trbsubvz SRR7168993.sra spots: 18423347 blocks: [[1, 921167], [921168, 1842334], [1842335, 2763501], [2763502, 3684668], [3684669, 4605835], [4605836, 5527002], [5527003, 6448169], [6448170, 7369336], [7369337, 8290503], [8290504, 9211670], [9211671, 10132837], [10132838, 11054004], [11054005, 11975171], [11975172, 12896338], [12896339, 13817505], [13817506, 14738672], [14738673, 15659839], [15659840, 16581006], [16581007, 17502173], [17502174, 18423347]] SRR7168993 file size 6221367 SRR7168993 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168993 SRR7168993_1.fastq SRR7168993_2.fastq Input file: SRR7168993_1.fastq Paired file: SRR7168993_2.fastq trimmed: SRR7168993-trimmed-pair1.fastq, SRR7168993-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:25:46 2025 >> started Mon Feb 10 14:26:08 2025 >> done (22.009s) 18423347 read pairs processed; of these: 29392 ( 0.16%) short read pairs filtered out after trimming by size control 35301 ( 0.19%) empty read pairs filtered out after trimming by size control 18358654 (99.65%) read pairs available; of these: 8381926 (45.66%) trimmed read pairs available after processing 9976728 (54.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 6 0.00% 21 4 0.00% 22 9 0.00% 23 7 0.00% 24 3 0.00% 25 7 0.00% 26 7 0.00% 27 6 0.00% 28 10 0.00% 29 7 0.00% 30 9 0.00% 31 6 0.00% 32 12 0.00% 33 9 0.00% 34 8 0.00% 35 10 0.00% 36 9 0.00% 37 14 0.00% 38 14 0.00% 39 11 0.00% 40 15 0.00% 41 10 0.00% 42 12 0.00% 43 10 0.00% 44 16 0.00% 45 20 0.00% 46 16 0.00% 47 26 0.00% 48 15 0.00% 49 24 0.00% 50 39 0.00% 51 48 0.00% 52 29 0.00% 53 42 0.00% 54 40 0.00% 55 44 0.00% 56 37 0.00% 57 45 0.00% 58 63 0.00% 59 68 0.00% 60 62 0.00% 61 91 0.00% 62 104 0.00% 63 122 0.00% 64 129 0.00% 65 154 0.00% 66 151 0.00% 67 156 0.00% 68 183 0.00% 69 235 0.00% 70 254 0.00% 71 272 0.00% 72 327 0.00% 73 375 0.00% 74 398 0.00% 75 533 0.00% 76 508 0.00% 77 585 0.00% 78 702 0.00% 79 774 0.00% 80 861 0.00% 81 1018 0.01% 82 1199 0.01% 83 1436 0.01% 84 2652 0.01% 85 3033 0.02% 86 3083 0.02% 87 3226 0.02% 88 3436 0.02% 89 3518 0.02% 90 3711 0.02% 91 3791 0.02% 92 4126 0.02% 93 4557 0.02% 94 4619 0.03% 95 4903 0.03% 96 5227 0.03% 97 5377 0.03% 98 5795 0.03% 99 5885 0.03% 100 6291 0.03% 101 6554 0.04% 102 6984 0.04% 103 7467 0.04% 104 8009 0.04% 105 8555 0.05% 106 9409 0.05% 107 9585 0.05% 108 10118 0.06% 109 11028 0.06% 110 11448 0.06% 111 11869 0.06% 112 12310 0.07% 113 13130 0.07% 114 14121 0.08% 115 15070 0.08% 116 16031 0.09% 117 16954 0.09% 118 17210 0.09% 119 17860 0.10% 120 19242 0.10% 121 20431 0.11% 122 21298 0.12% 123 22917 0.12% 124 24925 0.14% 125 26252 0.14% 126 28244 0.15% 127 30152 0.16% 128 31542 0.17% 129 34030 0.19% 130 36319 0.20% 131 38954 0.21% 132 42131 0.23% 133 45587 0.25% 134 49740 0.27% 135 54430 0.30% 136 58589 0.32% 137 63597 0.35% 138 70225 0.38% 139 77912 0.42% 140 85805 0.47% 141 96426 0.53% 142 110577 0.60% 143 128616 0.70% 144 154208 0.84% 145 190520 1.04% 146 243877 1.33% 147 335162 1.83% 148 509707 2.78% 149 965585 5.26% 150 4456555 24.27% 151 9976728 54.34% 18358654 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=39 prefix-density=0.17 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.15 sequence-density-rank=7 fanout-score=74.69 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=16.3 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=31 prefix-density=0.27 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=14 fanout-score=51.94 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=13.8 sequence=TGTTGGTGGTGG SRR7168993 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:26:54 Started mapping on | Feb 10 14:26:55 Finished on | Feb 10 14:28:56 Mapping speed, Million of reads per hour | 546.21 Number of input reads | 18358654 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17421445 Uniquely mapped reads % | 94.90% Average mapped length | 296.44 Number of splices: Total | 16895069 Number of splices: Annotated (sjdb) | 16646582 Number of splices: GT/AG | 16663302 Number of splices: GC/AG | 188470 Number of splices: AT/AC | 12735 Number of splices: Non-canonical | 30562 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314388 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 35025 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 650181 650181 650181 N_multimapping 314388 314388 314388 N_noFeature 387061 17221217 485189 N_ambiguous 173298 859 70570 UnstrandedReadsAssigned:16861086 PositiveStrandReadsAssigned:199369 NegativeStrandReadsAssigned:16865686 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168993 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168993-trimmed-pair1.fastq SRR7168993-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,358,654 reads, 16,782,270 reads pseudoaligned [quant] estimated average fragment length: 270.963 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7168993.ke.tsv 34699 SRR7168993.se.tsv 87100 total ==> SRR7168993.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.04 286 9.39469 Potri.005G024800.1.v4.1 1035 765.037 52 3.9029 Potri.004G059700.1.v4.1 961 691.105 2 0.16617 Potri.007G009000.2.v4.1 1416 1146.04 0 0 Potri.003G141000.2.v4.1 2943 2673.04 315.029 6.76725 Potri.016G087400.1.v4.1 270 64.4879 1434 1276.84 Potri.015G069301.1.v4.1 564 301.93 0 0 Potri.010G195200.1.v4.1 1773 1503.04 32 1.2225 Potri.012G127500.1.v4.1 977 707.068 5380 436.906 ==> SRR7168993.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1313 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168993 completed mapping pipeline successfully