Starting /dee2/code/volunteer_pipeline.sh SRR7168994 current disk space = 3059018031104 free memory = 1468480168 SRR7168994 SRAfilesize 5c725b550df5c6938795e1fb33ecaa4b SRR7168994.sra SRR7168994.sra file validated SRR7168994 is paired end SRR7168994 is conventional basespace SRR7168994 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168994_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67525 34.0 33.0 34.0 32.0 34.0 2 33.0895 34.0 33.0 34.0 32.0 34.0 3 33.124 34.0 33.0 34.0 32.0 34.0 4 33.102 34.0 33.0 34.0 32.0 34.0 5 33.13525 34.0 33.0 34.0 32.0 34.0 6 36.948 38.0 37.0 38.0 35.0 38.0 7 37.27925 38.0 38.0 38.0 36.0 38.0 8 37.3005 38.0 38.0 38.0 37.0 38.0 9 37.406 38.0 38.0 38.0 37.0 38.0 10-14 37.397949999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.3319 38.0 38.0 38.0 36.8 38.0 20-24 37.22375 38.0 38.0 38.0 36.2 38.0 25-29 37.12555 38.0 38.0 38.0 36.0 38.0 30-34 37.049299999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.953050000000005 38.0 38.0 38.0 35.4 38.0 40-44 36.79575 38.0 38.0 38.0 34.8 38.0 45-49 36.821549999999995 38.0 38.0 38.0 35.0 38.0 50-54 36.82599999999999 38.0 38.0 38.0 35.0 38.0 55-59 36.55694999999999 38.0 38.0 38.0 34.0 38.0 60-64 36.606049999999996 38.0 38.0 38.0 34.2 38.0 65-69 36.56465 38.0 38.0 38.0 34.0 38.0 70-74 36.5424 38.0 38.0 38.0 34.0 38.0 75-79 36.38675 38.0 37.4 38.0 33.8 38.0 80-84 35.7821 38.0 36.8 38.0 31.0 38.0 85-89 35.81915 38.0 37.0 38.0 31.6 38.0 90-94 35.4594 38.0 36.6 38.0 29.2 38.0 95-99 35.465500000000006 38.0 36.4 38.0 29.4 38.0 100-104 35.2838 38.0 36.0 38.0 29.0 38.0 105-109 35.34425 38.0 36.0 38.0 29.4 38.0 110-114 34.926249999999996 38.0 35.6 38.0 27.2 38.0 115-119 34.652100000000004 38.0 35.0 38.0 25.8 38.0 120-124 34.200149999999994 37.8 34.2 38.0 24.4 38.0 125-129 33.25955 37.6 33.4 38.0 19.0 38.0 130-134 32.754799999999996 37.4 32.4 38.0 16.2 38.0 135-139 33.341049999999996 38.0 33.8 38.0 19.8 38.0 140-144 32.982150000000004 38.0 33.6 38.0 17.2 38.0 145-149 32.00115 37.6 32.0 38.0 11.4 38.0 150-151 27.42675 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 2.0 14 3.0 15 1.0 16 3.0 17 4.0 18 6.0 19 11.0 20 6.0 21 5.0 22 6.0 23 8.0 24 19.0 25 25.0 26 19.0 27 38.0 28 45.0 29 63.0 30 85.0 31 99.0 32 125.0 33 176.0 34 223.0 35 456.0 36 897.0 37 1672.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.36068072136144 13.563627127254255 9.5250190500381 36.550673101346206 2 21.275 16.45 34.699999999999996 27.575 3 18.8 22.975 26.900000000000002 31.324999999999996 4 22.3 30.325000000000003 22.625 24.75 5 22.44744744744745 34.109109109109106 24.44944944944945 18.993993993993993 6 19.0 34.925 26.174999999999997 19.900000000000002 7 14.424999999999999 26.150000000000002 41.099999999999994 18.325 8 18.525 25.900000000000002 29.625 25.95 9 17.0 24.975 34.075 23.95 10-14 20.28 30.3 26.284999999999997 23.135 15-19 19.71 29.42 27.13 23.74 20-24 19.73 29.01 27.665 23.595 25-29 19.155 29.505 27.245 24.095 30-34 20.195 28.799999999999997 27.589999999999996 23.415 35-39 19.742961444216633 28.824323648547285 26.964044606691 24.46867030054508 40-44 20.105 29.285 27.265 23.345 45-49 20.633094964244634 28.819322898434763 27.159073861079165 23.38850827624144 50-54 20.044999999999998 28.735 27.38 23.84 55-59 19.91 29.4 27.155 23.535 60-64 20.265 29.26 26.805 23.669999999999998 65-69 20.225 28.84 27.015 23.919999999999998 70-74 20.196009800490025 28.901445072253612 27.28636431821591 23.61618080904045 75-79 19.96 28.63 27.045 24.365000000000002 80-84 20.348924650323358 28.686017947561037 27.066726826089138 23.89833057602647 85-89 20.57481065355871 28.580027085318754 27.787530721773585 23.05763153934895 90-94 20.842938759146033 29.262303297584445 26.626240352811465 23.268517590458053 95-99 20.19279044080731 28.71774274525555 27.367205542725177 23.72226127121197 100-104 20.47401914115348 28.24572831587914 27.589317031617977 23.6909355113494 105-109 21.036799358267324 28.456833450315855 27.569437481199238 22.936929710217587 110-114 20.37677238338594 28.38318553033719 27.145648579588155 24.09439350668871 115-119 20.31171694898266 28.640874010223516 27.95930640473088 23.088102636062946 120-124 20.66603330166508 28.39141957097855 27.316365818290915 23.62618130906545 125-129 20.641121963436014 27.833708990733786 27.793638868019034 23.73153017781117 130-134 20.62037363412055 28.04773654262551 27.42837000856035 23.90351981469359 135-139 20.738765034472348 28.659856071662222 26.812943485481355 23.788435408384075 140-144 20.058095858165974 28.146441628687334 27.24996243802274 24.545500075123954 145-149 20.551731068790513 28.45585648962364 27.345359529671875 23.647052911913974 150-151 21.038114343029086 28.36008024072217 27.043630892678035 23.558174523570713 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 1.5 23 3.0 24 2.5 25 1.0 26 3.5 27 7.5 28 9.0 29 12.0 30 16.0 31 19.0 32 29.5 33 45.5 34 53.0 35 63.0 36 82.0 37 108.0 38 132.5 39 161.5 40 205.0 41 242.0 42 251.0 43 260.5 44 272.5 45 260.0 46 255.0 47 263.0 48 238.0 49 211.0 50 184.0 51 147.0 52 128.0 53 103.0 54 70.5 55 43.5 56 28.5 57 23.0 58 17.0 59 8.5 60 6.5 61 6.5 62 4.5 63 3.5 64 3.0 65 3.0 66 3.5 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.265 85-89 0.315 90-94 0.22999999999999998 95-99 0.41000000000000003 100-104 0.215 105-109 0.27 110-114 0.20500000000000002 115-119 0.22999999999999998 120-124 0.005 125-129 0.17500000000000002 130-134 0.705 135-139 0.645 140-144 0.165 145-149 0.49500000000000005 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.125 0.0 0.0 0.0 0.0 132-133 1.2374999999999998 0.0 0.0 0.0 0.0 134-135 1.3625 0.0 0.0 0.0 0.0 136-137 1.55 0.0 0.0 0.0 0.0 138-139 1.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGGCT 10 0.006706042 145.87341 1 >>END_MODULE SRR7168994 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168994_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8555 33.0 33.0 34.0 32.0 34.0 2 32.9285 34.0 33.0 34.0 32.0 34.0 3 32.95625 34.0 33.0 34.0 32.0 34.0 4 32.9885 34.0 33.0 34.0 32.0 34.0 5 32.8615 34.0 33.0 34.0 32.0 34.0 6 36.79525 38.0 38.0 38.0 36.0 38.0 7 36.73475 38.0 38.0 38.0 36.0 38.0 8 36.46275 38.0 38.0 38.0 36.0 38.0 9 36.7135 38.0 38.0 38.0 36.0 38.0 10-14 36.08775 38.0 38.0 38.0 33.6 38.0 15-19 35.844800000000006 38.0 38.0 38.0 33.8 38.0 20-24 36.2322 38.0 38.0 38.0 34.2 38.0 25-29 36.4606 38.0 38.0 38.0 34.8 38.0 30-34 36.51369999999999 38.0 38.0 38.0 35.4 38.0 35-39 36.537850000000006 38.0 38.0 38.0 35.8 38.0 40-44 36.50965 38.0 38.0 38.0 35.2 38.0 45-49 36.482549999999996 38.0 38.0 38.0 35.6 38.0 50-54 35.89575 38.0 38.0 38.0 33.2 38.0 55-59 35.0909 38.0 38.0 38.0 28.6 38.0 60-64 35.2695 38.0 38.0 38.0 29.6 38.0 65-69 35.5986 38.0 38.0 38.0 31.8 38.0 70-74 35.351150000000004 38.0 37.8 38.0 30.0 38.0 75-79 35.26174999999999 38.0 38.0 38.0 29.4 38.0 80-84 35.4863 38.0 38.0 38.0 31.8 38.0 85-89 35.47465 38.0 38.0 38.0 31.4 38.0 90-94 35.274649999999994 38.0 38.0 38.0 30.2 38.0 95-99 35.16885 38.0 37.4 38.0 29.2 38.0 100-104 34.75665 38.0 37.0 38.0 26.6 38.0 105-109 34.706900000000005 38.0 37.0 38.0 25.8 38.0 110-114 34.427 38.0 36.8 38.0 24.6 38.0 115-119 34.4766 38.0 36.8 38.0 25.0 38.0 120-124 34.58345 38.0 36.4 38.0 26.0 38.0 125-129 34.262 38.0 36.0 38.0 23.2 38.0 130-134 33.87995 38.0 35.4 38.0 21.6 38.0 135-139 33.2598 38.0 34.4 38.0 16.0 38.0 140-144 33.095600000000005 38.0 34.8 38.0 14.4 38.0 145-149 32.204150000000006 38.0 33.6 38.0 11.0 38.0 150-151 28.591875 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 25.0 4 5.0 5 2.0 6 2.0 7 5.0 8 19.0 9 2.0 10 17.0 11 28.0 12 11.0 13 2.0 14 2.0 15 4.0 16 6.0 17 4.0 18 6.0 19 9.0 20 9.0 21 7.0 22 15.0 23 10.0 24 35.0 25 27.0 26 26.0 27 35.0 28 34.0 29 53.0 30 69.0 31 53.0 32 70.0 33 103.0 34 171.0 35 244.0 36 465.0 37 2416.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.275000000000006 23.275000000000002 13.4 26.05 2 27.6 25.45 30.65 16.3 3 20.474999999999998 28.275 30.975 20.275000000000002 4 23.15578894723681 34.45861465366342 23.980995248812203 18.404601150287572 5 23.055763940985248 37.184296074018505 22.18054513628407 17.57939484871218 6 20.14550928248871 37.07977922729553 24.28499749121927 18.48971399899649 7 20.874152223059532 20.27128862094951 38.83446370258729 20.020095453403666 8 23.425246648115355 23.652921831520366 27.422210979003285 25.49962054136099 9 21.07375815353738 25.03763171098846 29.60361264425489 24.28499749121927 10-14 23.20947491485793 28.16550602348396 26.808315966044834 21.816703095613278 15-19 22.847172328851485 27.31704813712409 28.13815046700195 21.69762906702248 20-24 23.22766862467085 27.93194247518736 27.369860239011544 21.470528661130242 25-29 23.315438262003912 28.55852691786664 27.610255381064675 20.515779439064772 30-34 23.267426611520225 27.71108645213356 28.038938767275294 20.982548169070917 35-39 22.99446401610468 27.533970810266734 28.072471061902366 21.39909411172622 40-44 22.99497487437186 27.964824120603016 28.30653266331658 20.73366834170854 45-49 23.271229849846833 27.901370963692063 28.403555466278313 20.423843720182795 50-54 23.37900473692253 28.008964498548362 27.698263128406253 20.913767636122856 55-59 23.842844555019955 27.932410718913598 27.47110350904473 20.753641217021716 60-64 22.887706061702236 27.93137305565604 27.838354606997058 21.34256627564467 65-69 23.615635179153095 27.066368078175895 28.618688925081432 20.699307817589577 70-74 23.963086388105616 27.54165598564471 27.75698538836196 20.73827223788772 75-79 23.40120740816535 27.96991711859204 28.118285071114297 20.51059040212831 80-84 23.165548671206924 27.994264939321013 28.449997439705054 20.390188949767012 85-89 23.849798746624547 27.706730524277777 27.90543638864829 20.538034340449382 90-94 23.480847136044307 27.24475667914466 28.542126044818218 20.73227013999282 95-99 23.554516817396607 27.680113809572198 27.334620465399855 21.43074890763134 100-104 23.967498188593314 27.85425939343753 27.435048131663386 20.743194286305766 105-109 23.298684008397768 27.866250192022118 28.337344462082033 20.497721337498078 110-114 23.60552634292195 27.78636972883802 28.40499020517579 20.203113723064234 115-119 23.601623093122402 27.823719759617855 27.736401458729258 20.838255688530484 120-124 23.778666531666076 27.47937022224472 27.980559914949627 20.761403331139576 125-129 23.42378899315242 27.162059345675882 29.064164341871674 20.349987319300027 130-134 23.759336948736316 27.499232579555922 28.2052593881101 20.53617108359767 135-139 23.961254142238083 27.494264593423402 28.7025235788937 19.841957685444815 140-144 23.941532258064516 27.99899193548387 27.842741935483872 20.216733870967744 145-149 23.81072618927381 27.971922028077973 27.446722553277446 20.770629229370773 150-151 25.162275677739594 26.956853760977474 27.720504009163804 20.16036655211913 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.5 7 1.0 8 1.0 9 2.0 10 2.5 11 2.5 12 4.5 13 5.0 14 4.0 15 5.5 16 6.0 17 3.5 18 4.0 19 6.0 20 6.0 21 4.5 22 1.5 23 3.0 24 5.0 25 8.0 26 9.5 27 8.0 28 10.5 29 14.0 30 18.0 31 21.5 32 23.5 33 32.0 34 44.0 35 57.5 36 79.5 37 104.5 38 126.0 39 144.0 40 187.0 41 230.5 42 250.5 43 272.0 44 276.0 45 266.5 46 270.0 47 276.0 48 242.0 49 192.0 50 157.0 51 131.0 52 122.5 53 105.5 54 71.0 55 49.0 56 37.0 57 26.0 58 18.5 59 12.0 60 8.5 61 7.0 62 6.5 63 4.5 64 2.5 65 3.0 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.35000000000000003 7 0.475 8 1.175 9 0.35000000000000003 10-14 1.635 15-19 2.5700000000000003 20-24 1.26 25-29 0.345 30-34 0.8699999999999999 35-39 0.65 40-44 0.5 45-49 0.43499999999999994 50-54 1.8350000000000002 55-59 3.535 60-64 3.245 65-69 1.76 70-74 2.475 75-79 2.27 80-84 2.355 85-89 1.865 90-94 2.495 95-99 1.59 100-104 3.39 105-109 2.355 110-114 3.01 115-119 2.6550000000000002 120-124 1.2349999999999999 125-129 1.425 130-134 2.27 135-139 1.925 140-144 0.8 145-149 0.9900000000000001 150-151 1.7874999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.175 0.0 0.0 0.0 0.0 132-133 1.2875 0.0 0.0 0.0 0.0 134-135 1.3875 0.0 0.0 0.0 0.0 136-137 1.55 0.0 0.0 0.0 0.0 138-139 1.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAGCGA 10 0.007036669 143.5443 5 AAGACTT 10 0.007036669 143.5443 2 >>END_MODULE Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861294 spots for SRR7168994.sra Written 861294 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra Read 861290 spots for SRR7168994.sra Written 861290 spots for SRR7168994.sra SRR ids: ['SRR7168994.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bompcyja SRR7168994.sra spots: 17225804 blocks: [[1, 861290], [861291, 1722580], [1722581, 2583870], [2583871, 3445160], [3445161, 4306450], [4306451, 5167740], [5167741, 6029030], [6029031, 6890320], [6890321, 7751610], [7751611, 8612900], [8612901, 9474190], [9474191, 10335480], [10335481, 11196770], [11196771, 12058060], [12058061, 12919350], [12919351, 13780640], [13780641, 14641930], [14641931, 15503220], [15503221, 16364510], [16364511, 17225804]] SRR7168994 file size 5815559 SRR7168994 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168994 SRR7168994_1.fastq SRR7168994_2.fastq Input file: SRR7168994_1.fastq Paired file: SRR7168994_2.fastq trimmed: SRR7168994-trimmed-pair1.fastq, SRR7168994-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:45:42 2025 >> started Mon Feb 10 14:46:01 2025 >> done (19.197s) 17225804 read pairs processed; of these: 34516 ( 0.20%) short read pairs filtered out after trimming by size control 23760 ( 0.14%) empty read pairs filtered out after trimming by size control 17167528 (99.66%) read pairs available; of these: 7408542 (43.15%) trimmed read pairs available after processing 9758986 (56.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 3 0.00% 21 3 0.00% 22 4 0.00% 23 5 0.00% 24 3 0.00% 25 8 0.00% 26 9 0.00% 27 3 0.00% 28 0 0.00% 29 5 0.00% 30 7 0.00% 31 7 0.00% 32 6 0.00% 33 8 0.00% 34 12 0.00% 35 5 0.00% 36 7 0.00% 37 9 0.00% 38 10 0.00% 39 10 0.00% 40 9 0.00% 41 16 0.00% 42 9 0.00% 43 10 0.00% 44 13 0.00% 45 16 0.00% 46 18 0.00% 47 14 0.00% 48 18 0.00% 49 22 0.00% 50 21 0.00% 51 21 0.00% 52 23 0.00% 53 42 0.00% 54 31 0.00% 55 42 0.00% 56 41 0.00% 57 44 0.00% 58 56 0.00% 59 47 0.00% 60 68 0.00% 61 65 0.00% 62 67 0.00% 63 76 0.00% 64 87 0.00% 65 122 0.00% 66 135 0.00% 67 162 0.00% 68 162 0.00% 69 184 0.00% 70 233 0.00% 71 249 0.00% 72 256 0.00% 73 290 0.00% 74 279 0.00% 75 375 0.00% 76 421 0.00% 77 489 0.00% 78 519 0.00% 79 591 0.00% 80 728 0.00% 81 836 0.00% 82 933 0.01% 83 1173 0.01% 84 2075 0.01% 85 2500 0.01% 86 2650 0.02% 87 2607 0.02% 88 2941 0.02% 89 2792 0.02% 90 3021 0.02% 91 3062 0.02% 92 3702 0.02% 93 3418 0.02% 94 3694 0.02% 95 3890 0.02% 96 4091 0.02% 97 4418 0.03% 98 4860 0.03% 99 4857 0.03% 100 5862 0.03% 101 5924 0.03% 102 6297 0.04% 103 6407 0.04% 104 6766 0.04% 105 7228 0.04% 106 7763 0.05% 107 8013 0.05% 108 8837 0.05% 109 8984 0.05% 110 9375 0.05% 111 10238 0.06% 112 10653 0.06% 113 11225 0.07% 114 12372 0.07% 115 12838 0.07% 116 13779 0.08% 117 14603 0.09% 118 15414 0.09% 119 16182 0.09% 120 16740 0.10% 121 17947 0.10% 122 18990 0.11% 123 20510 0.12% 124 22015 0.13% 125 23650 0.14% 126 24932 0.15% 127 25903 0.15% 128 27785 0.16% 129 29691 0.17% 130 31545 0.18% 131 34140 0.20% 132 36938 0.22% 133 39650 0.23% 134 43124 0.25% 135 46312 0.27% 136 50293 0.29% 137 54603 0.32% 138 59725 0.35% 139 65953 0.38% 140 72650 0.42% 141 81432 0.47% 142 92403 0.54% 143 108500 0.63% 144 129106 0.75% 145 156901 0.91% 146 198853 1.16% 147 276567 1.61% 148 420486 2.45% 149 830544 4.84% 150 4088172 23.81% 151 9758986 56.85% 17167528 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=234.61 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=16.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=11.02 fanout-score-rank=11 prefix-density=0.35 prefix-fanout=6.7 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=66.81 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.7 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7168994 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:46:45 Started mapping on | Feb 10 14:46:46 Finished on | Feb 10 14:48:18 Mapping speed, Million of reads per hour | 671.77 Number of input reads | 17167528 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16280597 Uniquely mapped reads % | 94.83% Average mapped length | 296.86 Number of splices: Total | 14982756 Number of splices: Annotated (sjdb) | 14742990 Number of splices: GT/AG | 14777266 Number of splices: GC/AG | 162625 Number of splices: AT/AC | 12069 Number of splices: Non-canonical | 30796 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302563 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 15851 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 607458 607458 607458 N_multimapping 302563 302563 302563 N_noFeature 365492 16082835 434890 N_ambiguous 194488 853 65482 UnstrandedReadsAssigned:15720617 PositiveStrandReadsAssigned:196909 NegativeStrandReadsAssigned:15780225 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168994 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168994-trimmed-pair1.fastq SRR7168994-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,167,528 reads, 15,660,339 reads pseudoaligned [quant] estimated average fragment length: 268.452 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR7168994.ke.tsv 34699 SRR7168994.se.tsv 87100 total ==> SRR7168994.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.55 261 9.08067 Potri.005G024800.1.v4.1 1035 767.548 26 2.06309 Potri.004G059700.1.v4.1 961 693.623 4 0.351227 Potri.007G009000.2.v4.1 1416 1148.55 0 0 Potri.003G141000.2.v4.1 2943 2675.55 307 6.98838 Potri.016G087400.1.v4.1 270 64.8364 1212.32 1138.8 Potri.015G069301.1.v4.1 564 303.167 0 0 Potri.010G195200.1.v4.1 1773 1505.55 16 0.647257 Potri.012G127500.1.v4.1 977 709.598 4105 352.332 ==> SRR7168994.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1872 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 278 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168994 completed mapping pipeline successfully