Starting /dee2/code/volunteer_pipeline.sh SRR7168995 current disk space = 3059033608192 free memory = 1218946604 SRR7168995 SRAfilesize 9e92781353f807e0210f7a26383c315a SRR7168995.sra SRR7168995.sra file validated SRR7168995 is paired end SRR7168995 is conventional basespace SRR7168995 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168995_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97125 34.0 34.0 34.0 33.0 34.0 2 33.35875 34.0 34.0 34.0 33.0 34.0 3 33.516 34.0 34.0 34.0 33.0 34.0 4 33.52775 34.0 34.0 34.0 33.0 34.0 5 33.5125 34.0 34.0 34.0 33.0 34.0 6 37.27675 38.0 38.0 38.0 36.0 38.0 7 37.49325 38.0 38.0 38.0 37.0 38.0 8 37.601 38.0 38.0 38.0 38.0 38.0 9 37.6245 38.0 38.0 38.0 38.0 38.0 10-14 37.634 38.0 38.0 38.0 38.0 38.0 15-19 37.64155 38.0 38.0 38.0 38.0 38.0 20-24 37.6012 38.0 38.0 38.0 38.0 38.0 25-29 37.554449999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.53905 38.0 38.0 38.0 38.0 38.0 35-39 37.462 38.0 38.0 38.0 37.4 38.0 40-44 37.3489 38.0 38.0 38.0 37.0 38.0 45-49 37.3037 38.0 38.0 38.0 37.0 38.0 50-54 37.2604 38.0 38.0 38.0 36.4 38.0 55-59 37.281 38.0 38.0 38.0 36.8 38.0 60-64 37.15115 38.0 38.0 38.0 36.0 38.0 65-69 37.15155 38.0 38.0 38.0 36.0 38.0 70-74 37.161249999999995 38.0 38.0 38.0 36.2 38.0 75-79 37.02845 38.0 38.0 38.0 36.0 38.0 80-84 37.004149999999996 38.0 38.0 38.0 36.0 38.0 85-89 37.0045 38.0 38.0 38.0 35.6 38.0 90-94 36.89659999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.77895 38.0 38.0 38.0 35.2 38.0 100-104 36.6942 38.0 38.0 38.0 34.6 38.0 105-109 36.5681 38.0 38.0 38.0 34.4 38.0 110-114 36.344049999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.20315 38.0 37.4 38.0 33.8 38.0 120-124 36.017250000000004 38.0 37.0 38.0 33.0 38.0 125-129 35.907 38.0 37.0 38.0 32.8 38.0 130-134 35.58565 38.0 36.2 38.0 31.4 38.0 135-139 35.4088 38.0 36.0 38.0 31.0 38.0 140-144 35.0214 38.0 35.8 38.0 29.2 38.0 145-149 34.3967 38.0 35.0 38.0 27.2 38.0 150-151 31.556375000000003 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 0.0 16 2.0 17 1.0 18 0.0 19 4.0 20 2.0 21 2.0 22 4.0 23 7.0 24 12.0 25 5.0 26 9.0 27 24.0 28 15.0 29 26.0 30 37.0 31 56.0 32 63.0 33 77.0 34 137.0 35 220.0 36 562.0 37 2733.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.802494273351996 12.878595062356835 8.882667345380504 34.43624331891066 2 23.05 16.725 33.6 26.625 3 19.400000000000002 21.65 27.025 31.924999999999997 4 22.775000000000002 30.725 22.825 23.674999999999997 5 22.55 36.25 21.825 19.375 6 19.175 36.425000000000004 24.125 20.275000000000002 7 15.049999999999999 25.724999999999998 40.075 19.15 8 18.25 26.325 29.275000000000002 26.150000000000002 9 18.075 23.9 34.35 23.674999999999997 10-14 20.025000000000002 29.475 26.58 23.919999999999998 15-19 19.84 28.875 27.55 23.735 20-24 20.16 28.88 27.41 23.549999999999997 25-29 19.77 28.865000000000002 27.52 23.845 30-34 19.829957489372344 28.86721680420105 27.556889222305575 23.74593648412103 35-39 20.004001800810364 28.993046871091995 27.337301785803614 23.66564954229403 40-44 20.161008050402522 28.751437571878597 27.321366068303416 23.76618830941547 45-49 20.115 28.84 27.12 23.925 50-54 20.395 28.860000000000003 27.255000000000003 23.49 55-59 20.7970797079708 28.722872287228725 26.977697769776977 23.502350235023503 60-64 20.135 28.43 27.275 24.16 65-69 20.95 28.655 26.840000000000003 23.555 70-74 20.825 28.634999999999998 26.815 23.724999999999998 75-79 20.555 28.485 27.175 23.785 80-84 19.985 28.22 27.639999999999997 24.154999999999998 85-89 20.595 28.7 27.235 23.47 90-94 20.28 28.665000000000003 27.265 23.79 95-99 20.1 29.049999999999997 27.55 23.3 100-104 20.225 28.720000000000002 26.935 24.12 105-109 20.974999999999998 27.944999999999997 26.900000000000002 24.18 110-114 20.52 28.63 27.195000000000004 23.655 115-119 21.349999999999998 27.71 27.150000000000002 23.79 120-124 20.76 27.939999999999998 27.485 23.815 125-129 20.895 27.88 27.715 23.51 130-134 21.055 28.555000000000003 27.1 23.29 135-139 21.34713471347135 28.08780878087809 26.687668766876687 23.877387738773876 140-144 21.224999999999998 28.025 27.43 23.32 145-149 21.08 28.449999999999996 26.735 23.735 150-151 20.125 28.1125 27.85 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 4.0 26 7.0 27 6.5 28 5.5 29 11.5 30 21.5 31 25.0 32 33.0 33 41.5 34 53.0 35 71.5 36 88.5 37 108.0 38 132.5 39 155.5 40 193.0 41 220.0 42 224.5 43 253.0 44 261.0 45 255.5 46 260.5 47 254.0 48 242.5 49 213.5 50 179.0 51 139.5 52 118.0 53 109.0 54 80.0 55 53.5 56 38.0 57 30.0 58 24.0 59 15.5 60 12.5 61 11.5 62 10.0 63 7.5 64 3.5 65 5.0 66 3.5 67 2.5 68 4.0 69 2.5 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.025 35-39 0.045 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.32499999999999996 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 0.9874999999999999 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.4875 0.0 0.0 0.0 0.0 138-139 1.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTAGTA 10 0.006830828 145.0 145 GCCATCA 10 0.006830828 145.0 9 >>END_MODULE SRR7168995 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168995_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9425 33.0 33.0 34.0 32.0 34.0 2 33.11875 34.0 33.0 34.0 32.0 34.0 3 33.1135 34.0 33.0 34.0 32.0 34.0 4 33.177 34.0 33.0 34.0 33.0 34.0 5 33.09925 34.0 33.0 34.0 33.0 34.0 6 37.3325 38.0 38.0 38.0 37.0 38.0 7 37.32075 38.0 38.0 38.0 37.0 38.0 8 37.3865 38.0 38.0 38.0 37.0 38.0 9 37.28625 38.0 38.0 38.0 37.0 38.0 10-14 37.290000000000006 38.0 38.0 38.0 37.2 38.0 15-19 37.2448 38.0 38.0 38.0 37.0 38.0 20-24 37.19715 38.0 38.0 38.0 37.0 38.0 25-29 37.2102 38.0 38.0 38.0 37.0 38.0 30-34 37.2037 38.0 38.0 38.0 37.0 38.0 35-39 37.1597 38.0 38.0 38.0 37.0 38.0 40-44 37.165350000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.1172 38.0 38.0 38.0 37.0 38.0 50-54 37.0767 38.0 38.0 38.0 36.4 38.0 55-59 37.004599999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.93775 38.0 38.0 38.0 36.0 38.0 65-69 36.893150000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.82055 38.0 38.0 38.0 35.8 38.0 75-79 36.78115 38.0 38.0 38.0 35.8 38.0 80-84 36.6914 38.0 38.0 38.0 35.0 38.0 85-89 36.59515 38.0 38.0 38.0 35.0 38.0 90-94 36.47405 38.0 38.0 38.0 34.0 38.0 95-99 36.314350000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.238899999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.1155 38.0 38.0 38.0 33.4 38.0 110-114 35.840700000000005 38.0 37.2 38.0 33.0 38.0 115-119 35.656299999999995 38.0 37.2 38.0 31.6 38.0 120-124 35.37245 38.0 36.8 38.0 29.4 38.0 125-129 35.158849999999994 38.0 36.0 38.0 28.8 38.0 130-134 34.83345 38.0 35.6 38.0 27.6 38.0 135-139 34.454049999999995 38.0 35.2 38.0 25.4 38.0 140-144 34.1012 38.0 35.0 38.0 23.2 38.0 145-149 33.522 38.0 34.6 38.0 19.2 38.0 150-151 29.2305 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 2.0 5 0.0 6 0.0 7 2.0 8 2.0 9 1.0 10 1.0 11 1.0 12 3.0 13 0.0 14 5.0 15 4.0 16 3.0 17 1.0 18 6.0 19 8.0 20 7.0 21 8.0 22 8.0 23 9.0 24 16.0 25 19.0 26 20.0 27 27.0 28 22.0 29 34.0 30 38.0 31 54.0 32 72.0 33 95.0 34 139.0 35 242.0 36 572.0 37 2575.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.225 22.25 12.625 25.900000000000002 2 27.400000000000002 25.874999999999996 29.349999999999998 17.375 3 20.25 28.95 30.625000000000004 20.175 4 22.575 33.975 23.9 19.55 5 23.875 37.175000000000004 21.349999999999998 17.599999999999998 6 20.375 38.375 22.85 18.4 7 20.5 21.6 38.475 19.425 8 23.025000000000002 24.7 27.175 25.1 9 21.95 24.55 30.175 23.325000000000003 10-14 23.185 28.884999999999998 25.865 22.065 15-19 23.365 27.715 27.425 21.495 20-24 23.09 28.575 26.795 21.54 25-29 23.765 28.02 27.245 20.97 30-34 23.080000000000002 28.23 27.939999999999998 20.75 35-39 22.605 28.410000000000004 27.47 21.515 40-44 23.43 27.694999999999997 28.305000000000003 20.57 45-49 23.474999999999998 26.979999999999997 28.105000000000004 21.44 50-54 23.575 27.655 27.575 21.195 55-59 23.294999999999998 27.875 27.68 21.15 60-64 23.185 27.525 27.96 21.33 65-69 23.044999999999998 27.915 27.665 21.375 70-74 23.41 27.310000000000002 27.815 21.465 75-79 23.445 27.265 28.34 20.95 80-84 23.485 27.935 27.639999999999997 20.94 85-89 23.025000000000002 27.405 28.444999999999997 21.125 90-94 23.865 27.21 28.060000000000002 20.865000000000002 95-99 23.54 27.134999999999998 28.285 21.04 100-104 23.755000000000003 27.58 27.805000000000003 20.86 105-109 23.375 27.279999999999998 28.425 20.919999999999998 110-114 23.435 27.825 27.62 21.12 115-119 24.279999999999998 27.195000000000004 28.134999999999998 20.39 120-124 23.665 27.839999999999996 27.334999999999997 21.16 125-129 23.97 27.855 27.245 20.93 130-134 23.685000000000002 27.97 27.735 20.61 135-139 23.635 27.565 27.91 20.89 140-144 23.395 27.62 27.915 21.07 145-149 23.98 27.61 27.825 20.585 150-151 23.7875 28.5625 27.3625 20.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.5 23 2.5 24 2.0 25 1.0 26 2.0 27 2.5 28 3.0 29 5.5 30 10.5 31 13.0 32 20.0 33 30.0 34 40.0 35 57.5 36 74.5 37 91.5 38 131.5 39 164.5 40 188.5 41 221.5 42 251.5 43 287.5 44 287.0 45 287.0 46 276.0 47 253.5 48 241.0 49 199.5 50 163.0 51 148.0 52 136.0 53 101.0 54 69.5 55 54.0 56 41.0 57 28.5 58 20.0 59 20.0 60 18.5 61 14.0 62 12.0 63 8.5 64 4.0 65 3.5 66 3.0 67 1.0 68 1.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.30000000000000004 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.5375 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 0.9625 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.2625000000000002 0.0 0.0 0.0 0.0 136-137 1.475 0.0 0.0 0.0 0.0 138-139 1.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740124 spots for SRR7168995.sra Written 740124 spots for SRR7168995.sra Read 740131 spots for SRR7168995.sra Written 740131 spots for SRR7168995.sra SRR ids: ['SRR7168995.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b5x6h2tl SRR7168995.sra spots: 14802487 blocks: [[1, 740124], [740125, 1480248], [1480249, 2220372], [2220373, 2960496], [2960497, 3700620], [3700621, 4440744], [4440745, 5180868], [5180869, 5920992], [5920993, 6661116], [6661117, 7401240], [7401241, 8141364], [8141365, 8881488], [8881489, 9621612], [9621613, 10361736], [10361737, 11101860], [11101861, 11841984], [11841985, 12582108], [12582109, 13322232], [13322233, 14062356], [14062357, 14802487]] SRR7168995 file size 4994376 SRR7168995 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168995 SRR7168995_1.fastq SRR7168995_2.fastq Input file: SRR7168995_1.fastq Paired file: SRR7168995_2.fastq trimmed: SRR7168995-trimmed-pair1.fastq, SRR7168995-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:45:54 2025 >> started Mon Feb 10 14:46:12 2025 >> done (17.627s) 14802487 read pairs processed; of these: 12204 ( 0.08%) short read pairs filtered out after trimming by size control 8424 ( 0.06%) empty read pairs filtered out after trimming by size control 14781859 (99.86%) read pairs available; of these: 5664255 (38.32%) trimmed read pairs available after processing 9117604 (61.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 2 0.00% 24 4 0.00% 25 1 0.00% 26 5 0.00% 27 4 0.00% 28 4 0.00% 29 2 0.00% 30 3 0.00% 31 3 0.00% 32 2 0.00% 33 3 0.00% 34 2 0.00% 35 2 0.00% 36 6 0.00% 37 4 0.00% 38 7 0.00% 39 5 0.00% 40 1 0.00% 41 8 0.00% 42 9 0.00% 43 8 0.00% 44 12 0.00% 45 15 0.00% 46 9 0.00% 47 12 0.00% 48 12 0.00% 49 14 0.00% 50 12 0.00% 51 20 0.00% 52 20 0.00% 53 14 0.00% 54 22 0.00% 55 26 0.00% 56 26 0.00% 57 37 0.00% 58 40 0.00% 59 39 0.00% 60 53 0.00% 61 57 0.00% 62 48 0.00% 63 66 0.00% 64 87 0.00% 65 84 0.00% 66 87 0.00% 67 107 0.00% 68 107 0.00% 69 117 0.00% 70 137 0.00% 71 154 0.00% 72 176 0.00% 73 171 0.00% 74 230 0.00% 75 254 0.00% 76 271 0.00% 77 327 0.00% 78 372 0.00% 79 355 0.00% 80 423 0.00% 81 477 0.00% 82 573 0.00% 83 669 0.00% 84 1249 0.01% 85 1606 0.01% 86 1711 0.01% 87 1857 0.01% 88 2108 0.01% 89 2004 0.01% 90 2140 0.01% 91 2288 0.02% 92 2330 0.02% 93 2479 0.02% 94 2708 0.02% 95 2857 0.02% 96 3097 0.02% 97 3188 0.02% 98 3475 0.02% 99 3537 0.02% 100 3847 0.03% 101 3999 0.03% 102 4365 0.03% 103 4600 0.03% 104 5027 0.03% 105 5357 0.04% 106 5731 0.04% 107 6059 0.04% 108 6328 0.04% 109 6819 0.05% 110 7231 0.05% 111 7674 0.05% 112 8420 0.06% 113 8898 0.06% 114 9745 0.07% 115 10342 0.07% 116 10867 0.07% 117 11582 0.08% 118 12407 0.08% 119 12956 0.09% 120 13398 0.09% 121 14430 0.10% 122 15537 0.11% 123 16707 0.11% 124 17847 0.12% 125 18805 0.13% 126 20303 0.14% 127 21450 0.15% 128 22795 0.15% 129 24061 0.16% 130 26052 0.18% 131 27482 0.19% 132 29962 0.20% 133 32644 0.22% 134 35199 0.24% 135 38218 0.26% 136 41297 0.28% 137 44513 0.30% 138 48534 0.33% 139 52822 0.36% 140 58131 0.39% 141 64726 0.44% 142 72887 0.49% 143 83114 0.56% 144 98020 0.66% 145 116644 0.79% 146 145839 0.99% 147 197281 1.33% 148 301835 2.04% 149 595989 4.03% 150 3171010 21.45% 151 9117604 61.68% 14781859 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=295.04 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.08 fanout-score-rank=19 prefix-density=0.33 prefix-fanout=4.2 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=60.11 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.7 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7168995 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:46:58 Started mapping on | Feb 10 14:46:58 Finished on | Feb 10 14:48:27 Mapping speed, Million of reads per hour | 597.92 Number of input reads | 14781859 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13943567 Uniquely mapped reads % | 94.33% Average mapped length | 297.34 Number of splices: Total | 13136965 Number of splices: Annotated (sjdb) | 12928756 Number of splices: GT/AG | 12947374 Number of splices: GC/AG | 152187 Number of splices: AT/AC | 10376 Number of splices: Non-canonical | 27028 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 274396 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 35889 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 576616 576616 576616 N_multimapping 274396 274396 274396 N_noFeature 295915 13801152 353981 N_ambiguous 141463 1034 56414 UnstrandedReadsAssigned:13506189 PositiveStrandReadsAssigned:141381 NegativeStrandReadsAssigned:13533172 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168995 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168995-trimmed-pair1.fastq SRR7168995-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,781,859 reads, 13,476,159 reads pseudoaligned [quant] estimated average fragment length: 271.552 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52401 SRR7168995.ke.tsv 34699 SRR7168995.se.tsv 87100 total ==> SRR7168995.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.45 266 10.0958 Potri.005G024800.1.v4.1 1035 764.448 43 3.73066 Potri.004G059700.1.v4.1 961 690.576 1 0.0960404 Potri.007G009000.2.v4.1 1416 1145.45 0 0 Potri.003G141000.2.v4.1 2943 2672.45 243.033 6.03144 Potri.016G087400.1.v4.1 270 64.0528 1054.53 1091.9 Potri.015G069301.1.v4.1 564 301.08 0 0 Potri.010G195200.1.v4.1 1773 1502.45 2 0.0882868 Potri.012G127500.1.v4.1 977 706.513 5332 500.536 ==> SRR7168995.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1026 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 180 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168995 completed mapping pipeline successfully