Starting /dee2/code/volunteer_pipeline.sh SRR7168996 current disk space = 3059029762048 free memory = 1421908892 SRR7168996 SRAfilesize 6147f2fb0ced95812629d019a9f98162 SRR7168996.sra SRR7168996.sra file validated SRR7168996 is paired end SRR7168996 is conventional basespace SRR7168996 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168996_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0705 34.0 34.0 34.0 33.0 34.0 2 33.47175 34.0 34.0 34.0 33.0 34.0 3 33.50675 34.0 34.0 34.0 33.0 34.0 4 33.5365 34.0 34.0 34.0 33.0 34.0 5 33.518 34.0 34.0 34.0 33.0 34.0 6 37.2085 38.0 38.0 38.0 36.0 38.0 7 37.4455 38.0 38.0 38.0 37.0 38.0 8 37.4645 38.0 38.0 38.0 37.0 38.0 9 37.6385 38.0 38.0 38.0 38.0 38.0 10-14 37.5678 38.0 38.0 38.0 38.0 38.0 15-19 37.5736 38.0 38.0 38.0 38.0 38.0 20-24 37.542950000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.527049999999996 38.0 38.0 38.0 37.8 38.0 30-34 37.503 38.0 38.0 38.0 37.8 38.0 35-39 37.392700000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.306799999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.3035 38.0 38.0 38.0 37.0 38.0 50-54 37.24085 38.0 38.0 38.0 36.6 38.0 55-59 37.2445 38.0 38.0 38.0 36.8 38.0 60-64 37.2017 38.0 38.0 38.0 36.0 38.0 65-69 37.131 38.0 38.0 38.0 36.0 38.0 70-74 37.1596 38.0 38.0 38.0 36.0 38.0 75-79 37.0371 38.0 38.0 38.0 36.0 38.0 80-84 36.9716 38.0 38.0 38.0 36.0 38.0 85-89 36.97439999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.85555000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.768 38.0 38.0 38.0 34.8 38.0 100-104 36.605650000000004 38.0 38.0 38.0 34.4 38.0 105-109 36.464000000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.3892 38.0 38.0 38.0 34.0 38.0 115-119 36.27845 38.0 37.8 38.0 34.0 38.0 120-124 35.99705 38.0 37.2 38.0 32.8 38.0 125-129 35.9 38.0 37.0 38.0 32.4 38.0 130-134 35.6302 38.0 36.2 38.0 31.0 38.0 135-139 35.48025 38.0 36.0 38.0 31.2 38.0 140-144 34.88995 38.0 35.6 38.0 27.8 38.0 145-149 34.3822 38.0 35.0 38.0 27.2 38.0 150-151 31.598875 36.5 31.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 2.0 17 2.0 18 2.0 19 1.0 20 2.0 21 2.0 22 9.0 23 9.0 24 7.0 25 19.0 26 14.0 27 19.0 28 17.0 29 27.0 30 39.0 31 42.0 32 52.0 33 103.0 34 123.0 35 231.0 36 509.0 37 2768.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.883697308278315 12.950736414423567 10.1066531234129 36.05891315388522 2 21.825 16.275000000000002 35.125 26.775 3 19.025 23.225 27.725 30.025000000000002 4 22.075 30.2 23.5 24.224999999999998 5 22.116587440580435 34.52589442081561 23.567675756817614 19.78984238178634 6 19.950000000000003 36.0 24.05 20.0 7 14.000000000000002 26.075 41.075 18.85 8 17.724999999999998 25.15 31.900000000000002 25.224999999999998 9 17.599999999999998 25.124999999999996 33.650000000000006 23.625 10-14 20.11 29.69 26.25 23.95 15-19 19.56 28.96 27.515 23.965 20-24 20.035 28.78 27.405 23.78 25-29 19.8 28.560000000000002 27.625 24.015 30-34 19.580000000000002 29.18 27.505000000000003 23.735 35-39 19.689999999999998 29.095 27.32 23.895 40-44 19.925 28.694999999999997 27.889999999999997 23.49 45-49 20.25 28.785 26.815 24.15 50-54 19.73 28.884999999999998 27.92 23.465 55-59 20.305 28.410000000000004 27.365000000000002 23.919999999999998 60-64 20.380000000000003 29.01 27.055 23.555 65-69 19.33 28.645 27.860000000000003 24.165 70-74 20.255000000000003 28.389999999999997 27.544999999999998 23.810000000000002 75-79 20.205000000000002 29.34 26.695 23.76 80-84 20.605 29.2 26.915 23.28 85-89 20.705000000000002 28.610000000000003 26.985 23.7 90-94 20.105 28.98 27.365000000000002 23.549999999999997 95-99 20.335 28.64 27.534999999999997 23.49 100-104 20.455000000000002 29.054999999999996 27.245 23.244999999999997 105-109 20.21 28.485 27.785 23.52 110-114 20.22 28.71 27.529999999999998 23.54 115-119 20.335 28.4 27.87 23.395 120-124 20.665 27.884999999999998 27.605 23.845 125-129 20.31 28.235 27.47 23.985 130-134 20.84 28.875 26.590000000000003 23.695 135-139 20.71 28.575 27.33 23.385 140-144 20.505000000000003 27.87 27.49 24.135 145-149 20.674999999999997 28.599999999999998 26.935 23.79 150-151 21.1125 29.062500000000004 26.7625 23.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 3.0 24 4.0 25 4.0 26 4.0 27 6.0 28 7.0 29 12.0 30 20.5 31 24.5 32 27.5 33 36.5 34 56.0 35 75.0 36 82.5 37 115.0 38 134.5 39 158.5 40 206.5 41 216.5 42 239.5 43 255.0 44 271.0 45 290.0 46 252.5 47 227.0 48 234.0 49 218.0 50 184.0 51 150.0 52 127.5 53 106.0 54 70.5 55 46.5 56 35.5 57 24.5 58 16.5 59 12.0 60 9.5 61 6.5 62 5.0 63 5.5 64 6.5 65 4.0 66 0.5 67 1.0 68 1.5 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.9625 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.2 0.0 0.0 0.0 0.0 136-137 1.3625 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCATTA 10 0.0068343505 144.975 3 CAAGCTA 10 0.0068343505 144.975 2 >>END_MODULE SRR7168996 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168996_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94875 33.0 33.0 34.0 32.0 34.0 2 33.0805 34.0 33.0 34.0 33.0 34.0 3 33.137 34.0 33.0 34.0 33.0 34.0 4 33.13975 34.0 33.0 34.0 33.0 34.0 5 33.08225 34.0 33.0 34.0 33.0 34.0 6 37.27275 38.0 38.0 38.0 37.0 38.0 7 37.3165 38.0 38.0 38.0 37.0 38.0 8 37.3515 38.0 38.0 38.0 37.0 38.0 9 37.2935 38.0 38.0 38.0 37.0 38.0 10-14 37.282849999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.24015000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.16845 38.0 38.0 38.0 37.0 38.0 25-29 37.19995 38.0 38.0 38.0 37.0 38.0 30-34 37.16545 38.0 38.0 38.0 37.0 38.0 35-39 37.17719999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.100300000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.11465 38.0 38.0 38.0 37.0 38.0 50-54 37.06095 38.0 38.0 38.0 36.8 38.0 55-59 36.9827 38.0 38.0 38.0 36.2 38.0 60-64 36.9516 38.0 38.0 38.0 36.0 38.0 65-69 36.8953 38.0 38.0 38.0 36.0 38.0 70-74 36.829049999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.771100000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.75715 38.0 38.0 38.0 35.2 38.0 85-89 36.58995 38.0 38.0 38.0 34.6 38.0 90-94 36.510949999999994 38.0 38.0 38.0 34.4 38.0 95-99 36.42555 38.0 38.0 38.0 34.0 38.0 100-104 36.26915 38.0 38.0 38.0 34.0 38.0 105-109 36.11495000000001 38.0 38.0 38.0 33.6 38.0 110-114 36.008799999999994 38.0 37.2 38.0 33.0 38.0 115-119 35.74675 38.0 37.0 38.0 31.6 38.0 120-124 35.58175 38.0 37.0 38.0 31.0 38.0 125-129 35.3463 38.0 36.4 38.0 30.6 38.0 130-134 34.8781 38.0 35.8 38.0 27.8 38.0 135-139 34.3696 38.0 35.0 38.0 24.4 38.0 140-144 34.037800000000004 38.0 35.0 38.0 23.2 38.0 145-149 33.3484 38.0 34.2 38.0 17.8 38.0 150-151 29.07675 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 1.0 5 1.0 6 0.0 7 2.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 0.0 16 2.0 17 0.0 18 6.0 19 3.0 20 12.0 21 6.0 22 7.0 23 11.0 24 14.0 25 14.0 26 23.0 27 21.0 28 37.0 29 28.0 30 50.0 31 49.0 32 80.0 33 88.0 34 139.0 35 227.0 36 576.0 37 2586.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.95 22.25 13.4 26.400000000000002 2 26.127254509018037 26.50300601202405 31.187374749498996 16.182364729458918 3 20.345778000501127 27.787521924329745 32.64845903282385 19.218241042345277 4 24.824649298597194 33.842685370741485 22.79559118236473 18.537074148296593 5 24.273547094188377 35.94689378757515 22.82064128256513 16.958917835671343 6 21.04078058543908 37.02777082812109 23.367525644233176 18.563922942206652 7 19.829957489372344 21.355338834708675 40.28507126781695 18.529632408102024 8 22.141606204653492 25.64423317488116 27.995996997748314 24.218163622717036 9 21.205301325331334 23.55588897224306 29.75743935983996 25.481370342585645 10-14 23.422566925193898 28.75656742556918 26.339754816112084 21.481110833124845 15-19 23.137804939137403 27.851525321845415 27.515904423182892 21.494765315834293 20-24 23.50290406569197 27.87903064290006 27.773883436811538 20.844181854596435 25-29 23.306124492964095 28.604336721918976 27.542691171315536 20.546847613801393 30-34 22.997196074504306 28.124374123773283 27.66372922090927 21.21470058081314 35-39 23.11467200801202 28.12719078617927 27.541311967951927 21.216825237856785 40-44 23.196315025284132 27.59224953687478 28.53352025234066 20.677915185500424 45-49 22.853137048720644 27.820339492263784 28.3661308897902 20.960392569225377 50-54 22.624230596006605 27.803633088124908 28.0288245008257 21.543311815042788 55-59 23.15894868585732 27.709637046307883 28.225281602002504 20.906132665832292 60-64 23.15973960941412 28.212318477716575 28.49774661992989 20.13019529293941 65-69 23.70173769342481 27.302318593820424 28.158645901146777 20.837297811607993 70-74 23.359711509566264 27.516778523489933 27.9324852248823 21.191024742061504 75-79 23.47255608974359 27.879607371794872 27.979767628205128 20.66806891025641 80-84 23.063441990886783 27.444794952681388 28.32106554504031 21.170697511391516 85-89 23.317981577893473 27.563075690829 28.098718462154586 21.02022426912295 90-94 23.251389375657137 27.056526310519203 28.5986081209633 21.09347619286036 95-99 23.567102167492617 27.601742003303798 28.4777494118236 20.353406417379986 100-104 23.58858858858859 27.557557557557555 27.60760760760761 21.246246246246248 105-109 23.4740844506704 27.826696017610566 28.131879127476484 20.567340404242547 110-114 23.636272645380842 27.995195676108498 27.569812831548397 20.798718846962267 115-119 23.096955128205128 27.864583333333332 28.921274038461537 20.1171875 120-124 23.313129289184992 27.95671993187397 28.056905274758304 20.673245504182738 125-129 23.705039575192867 27.892996693718064 28.04829175433323 20.353671976755834 130-134 23.623072301221708 27.81894652513519 27.909072701782495 20.648908471860604 135-139 24.21648142585361 27.23540602783619 27.93131070391509 20.616801842395112 140-144 23.973357371794872 27.849559294871796 27.819511217948715 20.357572115384613 145-149 24.22375801282051 27.749399038461537 28.185096153846157 19.841746794871796 150-151 23.929376408715253 26.947157525669923 28.737791134485352 20.385674931129476 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.5 24 2.5 25 1.0 26 1.5 27 3.5 28 5.0 29 6.5 30 7.5 31 14.0 32 21.0 33 28.0 34 40.5 35 54.0 36 75.0 37 104.0 38 128.5 39 164.0 40 203.5 41 228.0 42 273.0 43 300.5 44 285.5 45 275.5 46 276.5 47 265.0 48 236.0 49 201.5 50 174.5 51 154.5 52 117.5 53 92.5 54 74.5 55 50.0 56 35.0 57 26.5 58 21.0 59 14.5 60 8.5 61 3.0 62 2.0 63 2.0 64 2.5 65 2.0 66 1.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.22499999999999998 4 0.2 5 0.2 6 0.075 7 0.025 8 0.075 9 0.025 10-14 0.075 15-19 0.185 20-24 0.13999999999999999 25-29 0.155 30-34 0.13999999999999999 35-39 0.15 40-44 0.135 45-49 0.145 50-54 0.08499999999999999 55-59 0.125 60-64 0.15 65-69 0.155 70-74 0.16999999999999998 75-79 0.16 80-84 0.145 85-89 0.12 90-94 0.135 95-99 0.11499999999999999 100-104 0.1 105-109 0.06 110-114 0.09 115-119 0.16 120-124 0.185 125-129 0.19 130-134 0.13999999999999999 135-139 0.13 140-144 0.16 145-149 0.16 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7125 0.0 0.0 0.0 0.0 130-131 0.9125 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.15 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138-139 1.4874999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra Read 783489 spots for SRR7168996.sra Written 783489 spots for SRR7168996.sra Read 783470 spots for SRR7168996.sra Written 783470 spots for SRR7168996.sra SRR ids: ['SRR7168996.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_79w2uuhs SRR7168996.sra spots: 15669419 blocks: [[1, 783470], [783471, 1566940], [1566941, 2350410], [2350411, 3133880], [3133881, 3917350], [3917351, 4700820], [4700821, 5484290], [5484291, 6267760], [6267761, 7051230], [7051231, 7834700], [7834701, 8618170], [8618171, 9401640], [9401641, 10185110], [10185111, 10968580], [10968581, 11752050], [11752051, 12535520], [12535521, 13318990], [13318991, 14102460], [14102461, 14885930], [14885931, 15669419]] SRR7168996 file size 5288151 SRR7168996 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168996 SRR7168996_1.fastq SRR7168996_2.fastq Input file: SRR7168996_1.fastq Paired file: SRR7168996_2.fastq trimmed: SRR7168996-trimmed-pair1.fastq, SRR7168996-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:40:51 2025 >> started Mon Feb 10 14:41:09 2025 >> done (18.327s) 15669419 read pairs processed; of these: 14692 ( 0.09%) short read pairs filtered out after trimming by size control 9921 ( 0.06%) empty read pairs filtered out after trimming by size control 15644806 (99.84%) read pairs available; of these: 6203526 (39.65%) trimmed read pairs available after processing 9441280 (60.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 5 0.00% 21 5 0.00% 22 3 0.00% 23 6 0.00% 24 7 0.00% 25 1 0.00% 26 1 0.00% 27 4 0.00% 28 4 0.00% 29 8 0.00% 30 7 0.00% 31 6 0.00% 32 6 0.00% 33 3 0.00% 34 2 0.00% 35 7 0.00% 36 4 0.00% 37 6 0.00% 38 4 0.00% 39 8 0.00% 40 10 0.00% 41 11 0.00% 42 12 0.00% 43 9 0.00% 44 11 0.00% 45 13 0.00% 46 14 0.00% 47 14 0.00% 48 16 0.00% 49 16 0.00% 50 12 0.00% 51 17 0.00% 52 14 0.00% 53 12 0.00% 54 19 0.00% 55 26 0.00% 56 20 0.00% 57 39 0.00% 58 31 0.00% 59 40 0.00% 60 48 0.00% 61 41 0.00% 62 58 0.00% 63 45 0.00% 64 67 0.00% 65 77 0.00% 66 86 0.00% 67 94 0.00% 68 121 0.00% 69 124 0.00% 70 137 0.00% 71 139 0.00% 72 169 0.00% 73 197 0.00% 74 220 0.00% 75 228 0.00% 76 273 0.00% 77 269 0.00% 78 331 0.00% 79 389 0.00% 80 435 0.00% 81 509 0.00% 82 559 0.00% 83 680 0.00% 84 1322 0.01% 85 1732 0.01% 86 1797 0.01% 87 1905 0.01% 88 1951 0.01% 89 2063 0.01% 90 2060 0.01% 91 2254 0.01% 92 2426 0.02% 93 2643 0.02% 94 2723 0.02% 95 2957 0.02% 96 3092 0.02% 97 3354 0.02% 98 3570 0.02% 99 3582 0.02% 100 3979 0.03% 101 4311 0.03% 102 4604 0.03% 103 4960 0.03% 104 5248 0.03% 105 5637 0.04% 106 6136 0.04% 107 6337 0.04% 108 6658 0.04% 109 7217 0.05% 110 7556 0.05% 111 8400 0.05% 112 8969 0.06% 113 9583 0.06% 114 10391 0.07% 115 10809 0.07% 116 11726 0.07% 117 12593 0.08% 118 13063 0.08% 119 13799 0.09% 120 14881 0.10% 121 15510 0.10% 122 16670 0.11% 123 17825 0.11% 124 19149 0.12% 125 20303 0.13% 126 22105 0.14% 127 23339 0.15% 128 24851 0.16% 129 26601 0.17% 130 27907 0.18% 131 30174 0.19% 132 32435 0.21% 133 35407 0.23% 134 37962 0.24% 135 41587 0.27% 136 45047 0.29% 137 49116 0.31% 138 53361 0.34% 139 58036 0.37% 140 63924 0.41% 141 71304 0.46% 142 80744 0.52% 143 92530 0.59% 144 109999 0.70% 145 132233 0.85% 146 164540 1.05% 147 224393 1.43% 148 338340 2.16% 149 672156 4.30% 150 3433927 21.95% 151 9441280 60.35% 15644806 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=45 prefix-density=0.24 prefix-fanout=1.9 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=100.50 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=11.2 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=11.15 fanout-score-rank=7 prefix-density=0.33 prefix-fanout=7.0 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=48.98 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=6.3 sequence=CTCTTCTTTTCTCCCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTGGATGAAGTGAG SRR7168996 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:41:57 Started mapping on | Feb 10 14:41:57 Finished on | Feb 10 14:43:17 Mapping speed, Million of reads per hour | 704.02 Number of input reads | 15644806 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14921088 Uniquely mapped reads % | 95.37% Average mapped length | 297.24 Number of splices: Total | 13517894 Number of splices: Annotated (sjdb) | 13293417 Number of splices: GT/AG | 13330694 Number of splices: GC/AG | 148203 Number of splices: AT/AC | 9881 Number of splices: Non-canonical | 29116 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 238009 % of reads mapped to multiple loci | 1.52% Number of reads mapped to too many loci | 28865 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.88% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 499494 499494 499494 N_multimapping 238009 238009 238009 N_noFeature 382021 14728299 452570 N_ambiguous 189678 782 66947 UnstrandedReadsAssigned:14349389 PositiveStrandReadsAssigned:192007 NegativeStrandReadsAssigned:14401571 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168996 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168996-trimmed-pair1.fastq SRR7168996-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,644,806 reads, 14,287,581 reads pseudoaligned [quant] estimated average fragment length: 270.605 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,043 rounds 52401 SRR7168996.ke.tsv 34699 SRR7168996.se.tsv 87100 total ==> SRR7168996.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.4 266 10.497 Potri.005G024800.1.v4.1 1035 765.395 22 1.98317 Potri.004G059700.1.v4.1 961 691.445 0 0 Potri.007G009000.2.v4.1 1416 1146.4 0 0 Potri.003G141000.2.v4.1 2943 2673.4 248.069 6.40227 Potri.016G087400.1.v4.1 270 64.2011 997 1071.46 Potri.015G069301.1.v4.1 564 301.567 0 0 Potri.010G195200.1.v4.1 1773 1503.4 17 0.780189 Potri.012G127500.1.v4.1 977 707.423 4068 396.758 ==> SRR7168996.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1601 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 245 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 45 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168996 completed mapping pipeline successfully