Starting /dee2/code/volunteer_pipeline.sh SRR7168997 current disk space = 3059119665152 free memory = 1099321184 SRR7168997 SRAfilesize 00bad7b81131db8cc49ed53eebcc4ab0 SRR7168997.sra SRR7168997.sra file validated SRR7168997 is paired end SRR7168997 is conventional basespace SRR7168997 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168997_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.869 34.0 33.0 34.0 32.0 34.0 2 33.0125 34.0 33.0 34.0 32.0 34.0 3 33.10525 34.0 33.0 34.0 32.0 34.0 4 32.91 34.0 33.0 34.0 32.0 34.0 5 32.77325 34.0 33.0 34.0 32.0 34.0 6 36.6115 38.0 37.0 38.0 34.0 38.0 7 37.07325 38.0 38.0 38.0 36.0 38.0 8 37.23 38.0 38.0 38.0 36.0 38.0 9 37.33825 38.0 38.0 38.0 37.0 38.0 10-14 37.3491 38.0 38.0 38.0 37.0 38.0 15-19 37.2973 38.0 38.0 38.0 36.8 38.0 20-24 37.1731 38.0 38.0 38.0 36.4 38.0 25-29 37.060900000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.98515 38.0 38.0 38.0 35.8 38.0 35-39 36.9423 38.0 38.0 38.0 35.4 38.0 40-44 36.60265 38.0 38.0 38.0 34.2 38.0 45-49 36.7701 38.0 38.0 38.0 35.0 38.0 50-54 36.7358 38.0 38.0 38.0 34.6 38.0 55-59 36.43575 38.0 38.0 38.0 33.8 38.0 60-64 36.56035 38.0 38.0 38.0 34.0 38.0 65-69 36.49485 38.0 37.8 38.0 34.0 38.0 70-74 36.46145 38.0 37.8 38.0 34.0 38.0 75-79 36.134499999999996 38.0 37.0 38.0 33.0 38.0 80-84 36.10315000000001 38.0 37.0 38.0 33.0 38.0 85-89 35.7279 38.0 36.8 38.0 30.6 38.0 90-94 35.4945 38.0 37.0 38.0 29.8 38.0 95-99 35.6656 38.0 36.8 38.0 30.0 38.0 100-104 35.1699 38.0 36.0 38.0 28.2 38.0 105-109 35.428749999999994 38.0 36.0 38.0 29.4 38.0 110-114 34.9579 38.0 35.4 38.0 27.4 38.0 115-119 34.6943 38.0 35.0 38.0 26.6 38.0 120-124 34.584950000000006 38.0 34.8 38.0 26.0 38.0 125-129 33.61655 38.0 33.8 38.0 19.4 38.0 130-134 33.52085 38.0 34.0 38.0 19.4 38.0 135-139 33.064750000000004 37.6 32.8 38.0 20.0 38.0 140-144 33.195949999999996 38.0 33.2 38.0 19.8 38.0 145-149 31.605349999999998 37.2 31.2 38.0 10.8 38.0 150-151 26.9545 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 4.0 14 0.0 15 0.0 16 2.0 17 5.0 18 7.0 19 5.0 20 9.0 21 15.0 22 13.0 23 14.0 24 6.0 25 16.0 26 25.0 27 33.0 28 53.0 29 64.0 30 86.0 31 109.0 32 117.0 33 166.0 34 241.0 35 410.0 36 850.0 37 1747.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.475 13.375 7.725 39.425 2 22.175 14.45 35.949999999999996 27.425 3 19.6 18.475 27.450000000000003 34.475 4 22.675 26.25 23.549999999999997 27.525 5 22.14393558127831 32.86361348766985 23.678912934071462 21.313537996980372 6 19.225 34.55 25.95 20.275000000000002 7 14.149999999999999 27.575 40.275 18.0 8 17.8 27.150000000000002 30.575000000000003 24.474999999999998 9 17.299999999999997 24.224999999999998 34.35 24.125 10-14 19.715 30.445 26.69 23.150000000000002 15-19 19.555 29.14 27.334999999999997 23.97 20-24 19.955000000000002 29.715000000000003 27.24 23.09 25-29 19.869999999999997 28.765 27.55 23.815 30-34 20.015 28.975 27.55 23.46 35-39 19.825 28.794999999999998 26.715 24.665 40-44 20.14 29.125 26.58 24.154999999999998 45-49 19.895 28.99 27.345000000000002 23.77 50-54 20.28 28.735 27.339999999999996 23.645 55-59 20.36712849497324 28.970139548842095 26.704346521282453 23.958385434902215 60-64 20.195 28.605000000000004 27.41 23.79 65-69 20.09 29.185 27.445000000000004 23.28 70-74 20.27 29.005 27.27 23.455000000000002 75-79 20.483193277310924 28.181272509003602 27.330932372949178 24.004601840736296 80-84 20.58220377131996 28.870104536587803 27.089481318461463 23.45821037363077 85-89 20.29029029029029 29.004004004004003 26.82182182182182 23.883883883883883 90-94 20.41863741571903 28.47438864848546 27.24162221998591 23.865351715809602 95-99 20.27 28.595 27.284999999999997 23.849999999999998 100-104 20.59 28.08 27.295 24.035 105-109 20.378909382518042 28.613672814755414 27.205292702485966 23.80212510024058 110-114 20.686034301715086 28.371418570928547 26.916345817290864 24.026201310065503 115-119 20.349999999999998 28.355000000000004 27.705000000000002 23.59 120-124 20.93 27.71 27.334999999999997 24.025 125-129 20.4 28.345 27.54 23.715 130-134 21.13028257064266 28.152038009502377 27.22180545136284 23.495873968492123 135-139 20.990000000000002 28.044999999999998 26.805 24.16 140-144 20.849999999999998 28.185 27.200000000000003 23.765 145-149 21.415626258558195 28.015505436971406 27.059001208215864 23.50986709625453 150-151 21.165874405804352 28.14610958218664 26.619964973730298 24.06805103827871 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.5 22 2.0 23 4.0 24 3.5 25 2.0 26 3.0 27 6.5 28 9.0 29 11.5 30 16.5 31 26.0 32 31.5 33 38.5 34 51.5 35 72.0 36 89.5 37 101.5 38 132.5 39 172.0 40 203.0 41 217.5 42 221.0 43 236.0 44 243.0 45 254.0 46 276.0 47 267.5 48 252.5 49 223.5 50 173.5 51 143.5 52 123.5 53 97.0 54 66.5 55 50.0 56 44.0 57 39.0 58 26.0 59 14.0 60 14.0 61 8.5 62 7.5 63 5.0 64 2.5 65 2.5 66 1.0 67 0.5 68 2.5 69 4.5 70 2.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.65 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.034999999999999996 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.04 80-84 0.034999999999999996 85-89 0.1 90-94 0.63 95-99 0.0 100-104 0.0 105-109 0.24 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.025 135-139 0.0 140-144 0.0 145-149 0.6799999999999999 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 0.9624999999999999 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.1749999999999998 0.0 0.0 0.0 0.0 128-129 1.4 0.0 0.0 0.0 0.0 130-131 1.6625 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 3.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168997 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168997_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50875 33.0 33.0 34.0 32.0 34.0 2 32.679 34.0 33.0 34.0 32.0 34.0 3 32.617 34.0 33.0 34.0 32.0 34.0 4 32.45975 34.0 33.0 34.0 32.0 34.0 5 32.63725 34.0 33.0 34.0 32.0 34.0 6 36.693 38.0 38.0 38.0 36.0 38.0 7 36.77 38.0 38.0 38.0 36.0 38.0 8 36.38 38.0 38.0 38.0 35.0 38.0 9 36.6125 38.0 38.0 38.0 35.0 38.0 10-14 36.514950000000006 38.0 38.0 38.0 35.2 38.0 15-19 36.36095 38.0 38.0 38.0 35.0 38.0 20-24 36.5938 38.0 38.0 38.0 36.0 38.0 25-29 36.58355 38.0 38.0 38.0 35.8 38.0 30-34 36.49995 38.0 38.0 38.0 35.2 38.0 35-39 36.50355 38.0 38.0 38.0 35.6 38.0 40-44 36.625299999999996 38.0 38.0 38.0 35.8 38.0 45-49 36.498450000000005 38.0 38.0 38.0 35.0 38.0 50-54 36.34755 38.0 38.0 38.0 34.4 38.0 55-59 35.80415 38.0 38.0 38.0 32.2 38.0 60-64 35.796850000000006 38.0 38.0 38.0 31.8 38.0 65-69 35.8331 38.0 38.0 38.0 33.2 38.0 70-74 36.08785 38.0 38.0 38.0 33.8 38.0 75-79 35.88695 38.0 38.0 38.0 32.8 38.0 80-84 35.94545 38.0 38.0 38.0 33.6 38.0 85-89 35.9397 38.0 38.0 38.0 32.8 38.0 90-94 36.066250000000004 38.0 38.0 38.0 33.8 38.0 95-99 35.73775 38.0 38.0 38.0 32.4 38.0 100-104 35.59425 38.0 37.8 38.0 31.4 38.0 105-109 35.1752 38.0 37.0 38.0 28.4 38.0 110-114 35.03035 38.0 37.0 38.0 28.2 38.0 115-119 34.886199999999995 38.0 37.0 38.0 27.2 38.0 120-124 34.98305 38.0 36.6 38.0 28.0 38.0 125-129 34.7187 38.0 36.0 38.0 26.6 38.0 130-134 34.61465 38.0 36.0 38.0 26.8 38.0 135-139 34.23395000000001 38.0 35.4 38.0 23.6 38.0 140-144 33.4248 38.0 34.4 38.0 18.8 38.0 145-149 32.2479 38.0 33.4 38.0 11.0 38.0 150-151 28.313125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 4.0 4 1.0 5 2.0 6 3.0 7 3.0 8 4.0 9 3.0 10 2.0 11 4.0 12 1.0 13 5.0 14 4.0 15 4.0 16 2.0 17 7.0 18 5.0 19 7.0 20 6.0 21 21.0 22 15.0 23 23.0 24 16.0 25 26.0 26 33.0 27 33.0 28 33.0 29 38.0 30 49.0 31 73.0 32 87.0 33 112.0 34 183.0 35 238.0 36 511.0 37 2411.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.907164480322905 22.073662966700304 11.907164480322905 29.112008072653882 2 26.76374592016068 26.16118503640472 31.20763243786091 15.867436605573687 3 19.666750820499875 27.947488008078768 32.289825801565264 20.095935369856097 4 22.475900558092338 32.97818366311517 24.302384576357177 20.24353120243531 5 24.642767610930058 35.39734269240411 22.211080471296064 17.748809225369765 6 20.110192837465565 39.34385174054596 21.813173052842476 18.732782369146005 7 21.020870002514457 20.517978375660046 38.923811918531555 19.53733970329394 8 22.008113590263694 24.290060851926977 28.98073022312373 24.721095334685597 9 22.70896273917422 24.57200402819738 30.639476334340383 22.079556898288015 10-14 23.48908715157014 29.144614143858057 25.560764151418923 21.80553455315288 15-19 23.651620077844616 28.099883738563413 26.826062781175757 21.422433402416218 20-24 22.916247231729415 28.618884638614855 27.53674250050332 20.928125629152404 25-29 23.35890878090367 28.012637279975927 26.989619377162633 21.638834561957776 30-34 23.398692810457515 27.511312217194572 27.732528908999498 21.357466063348415 35-39 22.831671199758237 28.261307545079077 27.586380578221014 21.320640676941675 40-44 23.326133909287257 28.01747953187001 27.7261540007032 20.930232558139537 45-49 23.07151819322459 27.854454203262236 27.909661229611043 21.164366373902133 50-54 23.491249245624623 27.76101388050694 27.831422249044458 20.91631462482398 55-59 24.196174196174198 27.233414733414733 27.355514855514855 21.214896214896214 60-64 24.00020378012125 27.459371338325944 27.902593102042893 20.63783177950991 65-69 23.58639677764748 27.915158313363587 27.90496099525825 20.59348391373069 70-74 23.056354371626053 28.16709550476767 27.748347712022603 21.028202411583674 75-79 23.184668284789645 27.94296116504854 28.195792880258903 20.676577669902912 80-84 23.89434267786661 27.461795364841617 27.628782511891508 21.015079445400264 85-89 23.36022448263767 27.769704865460742 27.945081926141203 20.924988725760386 90-94 23.7245665029568 27.628545655006516 28.069559987972337 20.577327854064347 95-99 23.213388280229168 27.259021007136397 28.445069856266965 21.082520856367474 100-104 23.692028803061586 27.42837000856035 28.505967067828188 20.373634120549877 105-109 23.707791221586593 27.848934339087734 28.071685313623245 20.371589125702425 110-114 23.730195119466096 27.051811095827606 27.94844362932396 21.26955015538234 115-119 23.84794965489241 27.39037758830694 28.1161185546082 20.645554202192447 120-124 23.559789420907496 28.45324642767611 26.944096264728003 21.042867886688395 125-129 23.362938431431584 28.004415675648552 28.185056952180236 20.447588940739625 130-134 24.22431971081434 27.372226127121195 27.949593332663923 20.45386082940054 135-139 24.414464115552434 27.41361151512112 27.885049400672052 20.286874968654395 140-144 24.747601587221858 27.550354111205987 27.22889145612537 20.473152845446783 145-149 24.3671682351165 27.24070253132706 28.443460319057923 19.948668914498516 150-151 24.824385348720522 26.6432513798294 28.135975915704968 20.39638735574511 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 1.0 11 1.0 12 0.5 13 1.0 14 2.0 15 1.0 16 0.0 17 2.0 18 2.0 19 1.5 20 3.0 21 2.0 22 2.0 23 2.5 24 3.5 25 4.5 26 4.5 27 8.0 28 9.5 29 6.5 30 6.5 31 11.0 32 17.0 33 27.0 34 38.5 35 52.0 36 73.0 37 96.5 38 125.0 39 160.5 40 192.0 41 224.0 42 259.0 43 287.5 44 301.0 45 303.0 46 283.5 47 265.0 48 231.0 49 194.5 50 185.5 51 154.0 52 119.0 53 88.5 54 61.5 55 54.5 56 37.5 57 20.5 58 20.0 59 14.0 60 9.5 61 9.0 62 6.0 63 3.5 64 3.0 65 1.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.42500000000000004 3 0.975 4 1.4500000000000002 5 0.27499999999999997 6 0.17500000000000002 7 0.575 8 1.4000000000000001 9 0.7000000000000001 10-14 0.8049999999999999 15-19 1.085 20-24 0.66 25-29 0.295 30-34 0.5499999999999999 35-39 0.73 40-44 0.455 45-49 0.375 50-54 0.58 55-59 1.72 60-64 1.855 65-69 1.9349999999999998 70-74 0.895 75-79 1.1199999999999999 80-84 1.1900000000000002 85-89 0.215 90-94 0.22999999999999998 95-99 0.51 100-104 0.705 105-109 1.2349999999999999 110-114 1.855 115-119 1.48 120-124 0.27499999999999997 125-129 0.35500000000000004 130-134 0.41000000000000003 135-139 0.305 140-144 0.455 145-149 0.645 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.2999999999999998 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 2.1375 0.0 0.0 0.0 0.0 134-135 2.375 0.0 0.0 0.0 0.0 136-137 2.975 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACAGC 10 0.007013616 143.725 4 TCACTCG 10 0.007013616 143.725 3 >>END_MODULE Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830210 spots for SRR7168997.sra Written 830210 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra Read 830197 spots for SRR7168997.sra Written 830197 spots for SRR7168997.sra SRR ids: ['SRR7168997.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xmzshhy2 SRR7168997.sra spots: 16603953 blocks: [[1, 830197], [830198, 1660394], [1660395, 2490591], [2490592, 3320788], [3320789, 4150985], [4150986, 4981182], [4981183, 5811379], [5811380, 6641576], [6641577, 7471773], [7471774, 8301970], [8301971, 9132167], [9132168, 9962364], [9962365, 10792561], [10792562, 11622758], [11622759, 12452955], [12452956, 13283152], [13283153, 14113349], [14113350, 14943546], [14943547, 15773743], [15773744, 16603953]] SRR7168997 file size 5604834 SRR7168997 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168997 SRR7168997_1.fastq SRR7168997_2.fastq Input file: SRR7168997_1.fastq Paired file: SRR7168997_2.fastq trimmed: SRR7168997-trimmed-pair1.fastq, SRR7168997-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:03:37 2025 >> started Mon Feb 10 15:03:55 2025 >> done (17.493s) 16603953 read pairs processed; of these: 15348 ( 0.09%) short read pairs filtered out after trimming by size control 24685 ( 0.15%) empty read pairs filtered out after trimming by size control 16563920 (99.76%) read pairs available; of these: 7558314 (45.63%) trimmed read pairs available after processing 9005606 (54.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 8 0.00% 24 1 0.00% 25 5 0.00% 26 8 0.00% 27 6 0.00% 28 4 0.00% 29 5 0.00% 30 4 0.00% 31 6 0.00% 32 5 0.00% 33 8 0.00% 34 4 0.00% 35 3 0.00% 36 7 0.00% 37 11 0.00% 38 5 0.00% 39 4 0.00% 40 5 0.00% 41 9 0.00% 42 12 0.00% 43 21 0.00% 44 10 0.00% 45 10 0.00% 46 11 0.00% 47 15 0.00% 48 17 0.00% 49 16 0.00% 50 13 0.00% 51 25 0.00% 52 24 0.00% 53 29 0.00% 54 31 0.00% 55 32 0.00% 56 38 0.00% 57 39 0.00% 58 58 0.00% 59 43 0.00% 60 43 0.00% 61 75 0.00% 62 82 0.00% 63 85 0.00% 64 119 0.00% 65 106 0.00% 66 136 0.00% 67 159 0.00% 68 136 0.00% 69 174 0.00% 70 202 0.00% 71 226 0.00% 72 294 0.00% 73 344 0.00% 74 376 0.00% 75 437 0.00% 76 468 0.00% 77 537 0.00% 78 592 0.00% 79 682 0.00% 80 814 0.00% 81 942 0.01% 82 1111 0.01% 83 1344 0.01% 84 2171 0.01% 85 2297 0.01% 86 2501 0.02% 87 2710 0.02% 88 3012 0.02% 89 3074 0.02% 90 3358 0.02% 91 3537 0.02% 92 3969 0.02% 93 4288 0.03% 94 4484 0.03% 95 4938 0.03% 96 5436 0.03% 97 5826 0.04% 98 6086 0.04% 99 6506 0.04% 100 7010 0.04% 101 7505 0.05% 102 7861 0.05% 103 8516 0.05% 104 9031 0.05% 105 9854 0.06% 106 10910 0.07% 107 11400 0.07% 108 11781 0.07% 109 12881 0.08% 110 13805 0.08% 111 13790 0.08% 112 15028 0.09% 113 16084 0.10% 114 16785 0.10% 115 18085 0.11% 116 19067 0.12% 117 20337 0.12% 118 21162 0.13% 119 21726 0.13% 120 23122 0.14% 121 24512 0.15% 122 25714 0.16% 123 26917 0.16% 124 28842 0.17% 125 30595 0.18% 126 32520 0.20% 127 34418 0.21% 128 36588 0.22% 129 38673 0.23% 130 40721 0.25% 131 43307 0.26% 132 45707 0.28% 133 49120 0.30% 134 52692 0.32% 135 56112 0.34% 136 60761 0.37% 137 64849 0.39% 138 70496 0.43% 139 77479 0.47% 140 84421 0.51% 141 92735 0.56% 142 104802 0.63% 143 118468 0.72% 144 138300 0.83% 145 168564 1.02% 146 212657 1.28% 147 286457 1.73% 148 427720 2.58% 149 808268 4.88% 150 3905912 23.58% 151 9005606 54.37% 16563920 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=94.81 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.8 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.57 fanout-score-rank=21 prefix-density=0.23 prefix-fanout=4.2 sequence=AGTGAGCAATTCACAGCTATGTTCAGGAGGAAGGCTTTCTTGCACTGGTACACCGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=31 fanout-score=49.28 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=11.6 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTT SRR7168997 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:04:46 Started mapping on | Feb 10 15:04:46 Finished on | Feb 10 15:06:32 Mapping speed, Million of reads per hour | 562.55 Number of input reads | 16563920 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15749331 Uniquely mapped reads % | 95.08% Average mapped length | 295.90 Number of splices: Total | 14217357 Number of splices: Annotated (sjdb) | 13978522 Number of splices: GT/AG | 14020598 Number of splices: GC/AG | 155095 Number of splices: AT/AC | 12347 Number of splices: Non-canonical | 29317 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298363 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 39627 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 530118 530118 530118 N_multimapping 298363 298363 298363 N_noFeature 336142 15533297 421323 N_ambiguous 193274 848 62008 UnstrandedReadsAssigned:15219915 PositiveStrandReadsAssigned:215186 NegativeStrandReadsAssigned:15266000 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168997 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168997-trimmed-pair1.fastq SRR7168997-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,563,920 reads, 15,170,696 reads pseudoaligned [quant] estimated average fragment length: 240.483 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR7168997.ke.tsv 34699 SRR7168997.se.tsv 87100 total ==> SRR7168997.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.52 268 8.46662 Potri.005G024800.1.v4.1 1035 795.517 40 2.82517 Potri.004G059700.1.v4.1 961 721.537 9 0.700837 Potri.007G009000.2.v4.1 1416 1176.52 0 0 Potri.003G141000.2.v4.1 2943 2703.52 212 4.40596 Potri.016G087400.1.v4.1 270 74.1312 2015 1527.24 Potri.015G069301.1.v4.1 564 327.681 0 0 Potri.010G195200.1.v4.1 1773 1533.52 13 0.476308 Potri.012G127500.1.v4.1 977 737.527 5826 443.839 ==> SRR7168997.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1358 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 452 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7168997 completed mapping pipeline successfully