Starting /dee2/code/volunteer_pipeline.sh SRR7168998 current disk space = 3059130183680 free memory = 1184119508 SRR7168998 SRAfilesize 8b8f3c18acdc50baa8f52e48841e8087 SRR7168998.sra SRR7168998.sra file validated SRR7168998 is paired end SRR7168998 is conventional basespace SRR7168998 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168998_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23425 34.0 33.0 34.0 33.0 34.0 2 33.4735 34.0 34.0 34.0 33.0 34.0 3 33.496 34.0 34.0 34.0 33.0 34.0 4 33.52675 34.0 34.0 34.0 33.0 34.0 5 33.51175 34.0 34.0 34.0 33.0 34.0 6 37.23475 38.0 38.0 38.0 36.0 38.0 7 37.42075 38.0 38.0 38.0 37.0 38.0 8 37.501 38.0 38.0 38.0 37.0 38.0 9 37.4895 38.0 38.0 38.0 38.0 38.0 10-14 37.535900000000005 38.0 38.0 38.0 37.6 38.0 15-19 37.568349999999995 38.0 38.0 38.0 37.8 38.0 20-24 37.5533 38.0 38.0 38.0 38.0 38.0 25-29 37.52085 38.0 38.0 38.0 38.0 38.0 30-34 37.44709999999999 38.0 38.0 38.0 37.2 38.0 35-39 37.30365 38.0 38.0 38.0 37.0 38.0 40-44 37.216750000000005 38.0 38.0 38.0 36.6 38.0 45-49 37.201049999999995 38.0 38.0 38.0 36.6 38.0 50-54 37.1471 38.0 38.0 38.0 36.0 38.0 55-59 37.0657 38.0 38.0 38.0 36.0 38.0 60-64 37.0382 38.0 38.0 38.0 36.0 38.0 65-69 36.93905 38.0 38.0 38.0 36.0 38.0 70-74 36.953700000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.8101 38.0 38.0 38.0 35.0 38.0 80-84 36.65095 38.0 38.0 38.0 34.6 38.0 85-89 36.45095 38.0 38.0 38.0 34.0 38.0 90-94 36.35735000000001 38.0 38.0 38.0 33.8 38.0 95-99 36.206100000000006 38.0 37.4 38.0 33.2 38.0 100-104 35.85795 38.0 37.0 38.0 31.0 38.0 105-109 35.538850000000004 38.0 37.0 38.0 30.2 38.0 110-114 34.984700000000004 38.0 36.0 38.0 28.0 38.0 115-119 34.6062 38.0 35.4 38.0 26.6 38.0 120-124 34.04195000000001 38.0 34.2 38.0 23.6 38.0 125-129 33.6075 38.0 33.2 38.0 21.4 38.0 130-134 32.8381 38.0 33.0 38.0 15.2 38.0 135-139 31.963 37.6 30.6 38.0 13.4 38.0 140-144 30.6519 36.0 28.0 38.0 12.4 38.0 145-149 28.676 35.2 24.8 38.0 2.0 38.0 150-151 20.737875 17.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 3.0 18 5.0 19 5.0 20 8.0 21 13.0 22 10.0 23 15.0 24 22.0 25 19.0 26 26.0 27 41.0 28 34.0 29 31.0 30 64.0 31 91.0 32 99.0 33 162.0 34 279.0 35 521.0 36 1097.0 37 1446.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.7958617209185 14.307342922028765 9.033560434014635 33.86323492303811 2 24.2 16.650000000000002 31.924999999999997 27.224999999999998 3 19.7 22.025 27.275 31.0 4 22.625 30.125 22.7 24.55 5 22.411205602801402 34.39219609804903 23.536768384192097 19.65982991495748 6 18.825 36.1 24.925 20.150000000000002 7 14.75 26.0 40.6 18.65 8 18.525 26.375 29.5 25.6 9 17.1 24.85 32.85 25.2 10-14 19.66 29.75 26.815 23.775 15-19 20.105 28.810000000000002 27.150000000000002 23.935000000000002 20-24 19.939999999999998 28.810000000000002 27.155 24.095 25-29 19.38 29.78 27.175 23.665 30-34 19.61 29.45 27.325 23.615 35-39 20.135 29.18 27.245 23.44 40-44 20.119999999999997 29.175 27.134999999999998 23.57 45-49 20.445 28.194999999999997 27.345000000000002 24.015 50-54 19.939999999999998 29.049999999999997 27.339999999999996 23.669999999999998 55-59 20.474999999999998 28.725 26.865 23.935000000000002 60-64 20.085 28.675 27.125 24.115000000000002 65-69 19.875 28.405 27.425 24.295 70-74 19.735 29.095 27.115000000000002 24.055 75-79 20.575 29.125 26.61 23.69 80-84 20.285 28.360000000000003 27.07 24.285 85-89 19.66 28.439999999999998 27.68 24.22 90-94 20.355 28.749999999999996 26.66 24.235 95-99 20.47 28.21 27.11 24.21 100-104 20.22 28.665000000000003 27.195000000000004 23.919999999999998 105-109 19.75 28.325 27.66 24.265 110-114 20.625 28.494999999999997 27.38 23.5 115-119 20.645 28.384999999999998 27.029999999999998 23.94 120-124 20.599999999999998 28.389999999999997 27.52 23.49 125-129 19.925 28.345 27.439999999999998 24.29 130-134 20.215 28.04 27.105 24.64 135-139 20.405 28.155 27.279999999999998 24.16 140-144 19.965 28.139999999999997 27.35 24.545 145-149 20.805 27.565 27.415 24.215 150-151 20.6875 27.750000000000004 27.8625 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.5 23 1.5 24 2.5 25 3.0 26 4.5 27 6.0 28 10.0 29 15.0 30 16.0 31 22.5 32 29.0 33 33.5 34 46.5 35 71.0 36 93.0 37 106.0 38 134.5 39 164.0 40 181.0 41 205.0 42 220.5 43 241.0 44 285.0 45 293.5 46 270.0 47 253.0 48 227.0 49 206.0 50 176.0 51 141.5 52 129.5 53 112.5 54 83.5 55 56.0 56 35.5 57 24.0 58 19.0 59 18.0 60 14.5 61 8.5 62 5.0 63 4.5 64 4.5 65 5.5 66 5.5 67 3.5 68 2.5 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0125 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0125 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.025 0.025 0.0 0.0 0.0 84-85 0.025 0.025 0.0 0.0 0.0 86-87 0.025 0.025 0.0 0.0 0.0 88-89 0.05 0.025 0.0 0.0 0.0 90-91 0.075 0.025 0.0 0.0 0.0 92-93 0.0875 0.025 0.0 0.0 0.0 94-95 0.1 0.025 0.0 0.0 0.0 96-97 0.1 0.025 0.0 0.0 0.0 98-99 0.125 0.025 0.0 0.0 0.0 100-101 0.15 0.025 0.0 0.0 0.0 102-103 0.275 0.025 0.0 0.0 0.0 104-105 0.3125 0.025 0.0 0.0 0.0 106-107 0.35 0.025 0.0 0.0 0.0 108-109 0.375 0.025 0.0 0.0 0.0 110-111 0.375 0.025 0.0 0.0 0.0 112-113 0.375 0.025 0.0 0.0 0.0 114-115 0.425 0.025 0.0 0.0 0.0 116-117 0.55 0.025 0.0 0.0 0.0 118-119 0.6625 0.025 0.0 0.0 0.0 120-121 0.7625 0.025 0.0 0.0 0.0 122-123 0.9 0.025 0.0 0.0 0.0 124-125 0.9875 0.025 0.0 0.0 0.0 126-127 1.0499999999999998 0.025 0.0 0.0 0.0 128-129 1.1749999999999998 0.025 0.0 0.0 0.0 130-131 1.25 0.025 0.0 0.0 0.0 132-133 1.3125 0.025 0.0 0.0 0.0 134-135 1.3875000000000002 0.025 0.0 0.0 0.0 136-137 1.6 0.025 0.0 0.0 0.0 138-139 1.7374999999999998 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168998 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168998_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.75 33.0 32.0 33.0 28.0 34.0 2 31.8055 33.0 32.0 34.0 28.0 34.0 3 31.7185 33.0 33.0 34.0 28.0 34.0 4 31.82625 33.0 33.0 34.0 30.0 34.0 5 31.664 33.0 33.0 34.0 29.0 34.0 6 35.815 38.0 37.0 38.0 31.0 38.0 7 35.77275 38.0 37.0 38.0 31.0 38.0 8 35.8625 38.0 37.0 38.0 31.0 38.0 9 35.81725 38.0 37.0 38.0 31.0 38.0 10-14 35.7298 38.0 37.0 38.0 29.8 38.0 15-19 35.59405 38.0 37.0 38.0 29.4 38.0 20-24 35.36325000000001 38.0 36.8 38.0 29.0 38.0 25-29 35.3406 38.0 37.0 38.0 29.0 38.0 30-34 35.1546 38.0 36.2 38.0 28.2 38.0 35-39 35.0829 38.0 36.0 38.0 28.2 38.0 40-44 34.924249999999994 38.0 36.0 38.0 27.4 38.0 45-49 34.72709999999999 38.0 36.0 38.0 27.2 38.0 50-54 34.469100000000005 38.0 35.2 38.0 25.6 38.0 55-59 34.1957 38.0 34.6 38.0 21.4 38.0 60-64 33.963849999999994 38.0 34.2 38.0 18.8 38.0 65-69 33.72495 38.0 34.0 38.0 15.6 38.0 70-74 33.51485 38.0 34.0 38.0 15.0 38.0 75-79 33.137750000000004 38.0 33.2 38.0 15.0 38.0 80-84 32.799099999999996 37.6 32.8 38.0 15.0 38.0 85-89 32.376 37.0 31.4 38.0 15.0 38.0 90-94 31.76135 37.0 29.0 38.0 15.0 38.0 95-99 31.23925 36.8 28.4 38.0 15.0 38.0 100-104 30.2665 35.6 25.6 38.0 15.0 38.0 105-109 29.387 34.2 23.8 38.0 14.0 38.0 110-114 28.528399999999998 33.8 21.8 38.0 8.2 38.0 115-119 27.072650000000003 33.4 15.8 38.0 2.0 38.0 120-124 25.294600000000003 31.6 13.6 38.0 2.0 38.0 125-129 23.7297 28.8 12.0 37.0 2.0 38.0 130-134 22.218149999999998 28.0 3.8 36.2 2.0 38.0 135-139 20.979950000000002 24.8 2.0 35.8 2.0 38.0 140-144 19.0029 18.8 2.0 34.4 2.0 38.0 145-149 16.272100000000002 8.2 2.0 33.0 2.0 38.0 150-151 11.019124999999999 2.0 2.0 17.5 2.0 35.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 11.0 4 5.0 5 7.0 6 7.0 7 9.0 8 6.0 9 8.0 10 6.0 11 10.0 12 13.0 13 16.0 14 18.0 15 19.0 16 36.0 17 34.0 18 56.0 19 42.0 20 71.0 21 67.0 22 73.0 23 72.0 24 85.0 25 101.0 26 94.0 27 130.0 28 143.0 29 144.0 30 200.0 31 255.0 32 279.0 33 414.0 34 447.0 35 508.0 36 469.0 37 120.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.6 23.0 11.799999999999999 23.599999999999998 2 26.164246369554334 25.78868302453681 29.819729594391585 18.227341011517275 3 20.63611319809667 28.524918607563237 30.80390683696469 20.035061357375408 4 23.766591535186578 33.25820185324317 23.26571500125219 19.709491610318057 5 23.64137240170298 35.96293513648885 21.93839218632607 18.457300275482094 6 21.135567783891947 37.218609304652325 23.861930965482742 17.78389194597299 7 20.21516137102827 22.191643732799598 36.22717037778334 21.36602451838879 8 21.48574287143572 26.463231615807903 27.56378189094547 24.487243621810904 9 22.961480740370185 26.088044022011005 27.213606803401703 23.736868434217108 10-14 23.5747149429886 28.255651130226045 26.315263052610522 21.854370874174837 15-19 22.950737684421103 27.781945486371594 27.516879219804952 21.75043760940235 20-24 23.000350157570907 27.972587664449 27.452353559101596 21.574708618878496 25-29 23.999799959992 27.635527105421083 27.4004800960192 20.964192838567712 30-34 22.791395697848923 28.044022011005502 27.453726863431715 21.710855427713856 35-39 22.949589917983594 28.480696139227845 27.20544108821764 21.364272854570913 40-44 23.55706712013604 28.08342502750825 27.033109932979894 21.326397919375815 45-49 23.78070131559202 27.037166725026264 27.482367065179332 21.699764894202392 50-54 22.920730182545636 27.926981745436358 27.656914228557138 21.495373843460865 55-59 23.999599839935975 27.63605442176871 26.970788315326132 21.393557422969188 60-64 23.165791447861967 28.377094273568392 27.051762940735184 21.405351337834457 65-69 23.545886471617905 27.401850462615652 27.526881720430108 21.525381345336335 70-74 23.52705811743523 28.023407022106632 27.498249474842453 20.951285385615684 75-79 23.777133139941984 27.058117435230567 27.698309492847855 21.466439931979593 80-84 23.85596399099775 27.871967991997998 26.76669167291823 21.50537634408602 85-89 24.563597259040666 27.699694893212623 26.574301005351874 21.162406842394837 90-94 23.789757951590317 27.865573114622926 27.120424084816964 21.224244848969796 95-99 23.10077519379845 27.70692673168292 27.67691922980745 21.51537884471118 100-104 23.08961792358472 28.29565913182637 27.240448089617924 21.374274854970995 105-109 24.352435243524354 27.707770777077705 26.997699769976997 20.94209420942094 110-114 23.61854278141721 28.27924188628294 26.699004850727608 21.403210481572234 115-119 23.857157147144143 27.718315494648394 27.20816244873462 21.216364909472844 120-124 23.437890839961977 28.150482765521033 27.34503977187453 21.066586622642454 125-129 23.61389111289031 27.827261809447556 27.016613290632506 21.542233787029623 130-134 24.012006003001503 27.32366183091546 26.96848424212106 21.69584792396198 135-139 23.299319727891156 28.206282513005203 27.110844337735095 21.383553421368546 140-144 24.08222466740022 28.238471541462438 26.642992897869362 21.03631089326798 145-149 24.16483296659332 27.985597119423883 26.915383076615324 20.934186837367474 150-151 24.118529632408105 28.54463615903976 26.9567391847962 20.38009502375594 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.0 26 1.5 27 2.5 28 4.0 29 5.5 30 9.0 31 15.0 32 23.0 33 31.5 34 34.0 35 49.5 36 69.0 37 93.5 38 130.0 39 155.5 40 185.5 41 211.0 42 229.5 43 247.0 44 276.5 45 298.5 46 291.5 47 283.5 48 262.5 49 220.0 50 187.0 51 156.5 52 121.5 53 97.5 54 71.5 55 50.5 56 36.0 57 27.0 58 22.5 59 16.0 60 13.0 61 11.5 62 8.0 63 8.0 64 5.5 65 2.5 66 3.5 67 3.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.5 93 1.5 94 1.0 95 0.5 96 1.0 97 1.0 98 1.0 99 1.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.05 7 0.075 8 0.05 9 0.05 10-14 0.02 15-19 0.025 20-24 0.045 25-29 0.02 30-34 0.05 35-39 0.02 40-44 0.03 45-49 0.045 50-54 0.025 55-59 0.04 60-64 0.025 65-69 0.025 70-74 0.03 75-79 0.03 80-84 0.025 85-89 0.034999999999999996 90-94 0.02 95-99 0.025 100-104 0.02 105-109 0.01 110-114 0.015 115-119 0.03 120-124 0.055 125-129 0.08 130-134 0.05 135-139 0.04 140-144 0.03 145-149 0.02 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4462622703247 98.775 2 0.5285678328718851 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025169896803423106 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.7124999999999999 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.1125 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138-139 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821712 spots for SRR7168998.sra Written 821712 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra Read 821707 spots for SRR7168998.sra Written 821707 spots for SRR7168998.sra SRR ids: ['SRR7168998.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ri4az3o2 SRR7168998.sra spots: 16434145 blocks: [[1, 821707], [821708, 1643414], [1643415, 2465121], [2465122, 3286828], [3286829, 4108535], [4108536, 4930242], [4930243, 5751949], [5751950, 6573656], [6573657, 7395363], [7395364, 8217070], [8217071, 9038777], [9038778, 9860484], [9860485, 10682191], [10682192, 11503898], [11503899, 12325605], [12325606, 13147312], [13147313, 13969019], [13969020, 14790726], [14790727, 15612433], [15612434, 16434145]] SRR7168998 file size 5547292 SRR7168998 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168998 SRR7168998_1.fastq SRR7168998_2.fastq Input file: SRR7168998_1.fastq Paired file: SRR7168998_2.fastq trimmed: SRR7168998-trimmed-pair1.fastq, SRR7168998-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:18:27 2025 >> started Mon Feb 10 15:18:57 2025 >> done (29.474s) 16434145 read pairs processed; of these: 34000 ( 0.21%) short read pairs filtered out after trimming by size control 23166 ( 0.14%) empty read pairs filtered out after trimming by size control 16376979 (99.65%) read pairs available; of these: 7458016 (45.54%) trimmed read pairs available after processing 8918963 (54.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 5 0.00% 21 5 0.00% 22 14 0.00% 23 3 0.00% 24 3 0.00% 25 3 0.00% 26 6 0.00% 27 12 0.00% 28 2 0.00% 29 6 0.00% 30 9 0.00% 31 8 0.00% 32 8 0.00% 33 4 0.00% 34 6 0.00% 35 4 0.00% 36 10 0.00% 37 9 0.00% 38 5 0.00% 39 7 0.00% 40 12 0.00% 41 14 0.00% 42 9 0.00% 43 10 0.00% 44 15 0.00% 45 15 0.00% 46 8 0.00% 47 14 0.00% 48 25 0.00% 49 23 0.00% 50 17 0.00% 51 29 0.00% 52 33 0.00% 53 34 0.00% 54 51 0.00% 55 44 0.00% 56 56 0.00% 57 53 0.00% 58 63 0.00% 59 95 0.00% 60 73 0.00% 61 101 0.00% 62 101 0.00% 63 119 0.00% 64 117 0.00% 65 130 0.00% 66 163 0.00% 67 178 0.00% 68 203 0.00% 69 253 0.00% 70 297 0.00% 71 275 0.00% 72 311 0.00% 73 383 0.00% 74 399 0.00% 75 442 0.00% 76 513 0.00% 77 560 0.00% 78 652 0.00% 79 747 0.00% 80 830 0.01% 81 952 0.01% 82 1216 0.01% 83 1452 0.01% 84 2823 0.02% 85 3838 0.02% 86 3881 0.02% 87 3932 0.02% 88 4094 0.02% 89 4236 0.03% 90 4308 0.03% 91 4401 0.03% 92 4661 0.03% 93 4940 0.03% 94 5231 0.03% 95 5541 0.03% 96 5710 0.03% 97 6051 0.04% 98 6372 0.04% 99 6636 0.04% 100 7044 0.04% 101 7484 0.05% 102 8016 0.05% 103 8538 0.05% 104 9025 0.06% 105 9525 0.06% 106 10232 0.06% 107 10826 0.07% 108 11350 0.07% 109 12022 0.07% 110 12948 0.08% 111 13681 0.08% 112 14368 0.09% 113 15570 0.10% 114 16454 0.10% 115 17594 0.11% 116 19088 0.12% 117 20158 0.12% 118 21299 0.13% 119 22250 0.14% 120 23876 0.15% 121 25493 0.16% 122 27376 0.17% 123 29549 0.18% 124 31702 0.19% 125 33774 0.21% 126 36599 0.22% 127 37736 0.23% 128 39970 0.24% 129 43200 0.26% 130 45997 0.28% 131 49352 0.30% 132 52945 0.32% 133 56453 0.34% 134 61064 0.37% 135 64874 0.40% 136 70479 0.43% 137 76824 0.47% 138 82699 0.50% 139 88892 0.54% 140 97061 0.59% 141 108079 0.66% 142 119473 0.73% 143 135661 0.83% 144 157238 0.96% 145 187955 1.15% 146 232755 1.42% 147 307520 1.88% 148 451520 2.76% 149 820428 5.01% 150 3506122 21.41% 151 8918963 54.46% 16376979 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=37 prefix-density=0.18 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=248.87 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=27.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=35 prefix-density=0.28 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=280.25 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=28.0 sequence=AAGAAGAAGAAG SRR7168998 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:19:44 Started mapping on | Feb 10 15:19:45 Finished on | Feb 10 15:21:36 Mapping speed, Million of reads per hour | 531.15 Number of input reads | 16376979 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15334026 Uniquely mapped reads % | 93.63% Average mapped length | 295.27 Number of splices: Total | 14395715 Number of splices: Annotated (sjdb) | 14171086 Number of splices: GT/AG | 14182562 Number of splices: GC/AG | 170127 Number of splices: AT/AC | 11452 Number of splices: Non-canonical | 31574 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305534 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 67345 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.01% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 768855 768855 768855 N_multimapping 305534 305534 305534 N_noFeature 296190 15173273 362301 N_ambiguous 159428 1132 63896 UnstrandedReadsAssigned:14878408 PositiveStrandReadsAssigned:159621 NegativeStrandReadsAssigned:14907829 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168998 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168998-trimmed-pair1.fastq SRR7168998-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,376,979 reads, 14,856,100 reads pseudoaligned [quant] estimated average fragment length: 263.779 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR7168998.ke.tsv 34699 SRR7168998.se.tsv 87100 total ==> SRR7168998.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.22 249 8.53434 Potri.005G024800.1.v4.1 1035 772.221 21 1.63599 Potri.004G059700.1.v4.1 961 698.303 9 0.775356 Potri.007G009000.2.v4.1 1416 1153.22 0 0 Potri.003G141000.2.v4.1 2943 2680.22 296.063 6.64531 Potri.016G087400.1.v4.1 270 66.0426 1423.16 1296.38 Potri.015G069301.1.v4.1 564 308.163 0 0 Potri.010G195200.1.v4.1 1773 1510.22 37 1.47388 Potri.012G127500.1.v4.1 977 714.233 7176 604.428 ==> SRR7168998.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1452 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168998 completed mapping pipeline successfully