Starting /dee2/code/volunteer_pipeline.sh SRR7169000 current disk space = 3059103883264 free memory = 1452564704 SRR7169000 SRAfilesize 9c542cf3a82b7db3d117a07e715ab342 SRR7169000.sra SRR7169000.sra file validated SRR7169000 is paired end SRR7169000 is conventional basespace SRR7169000 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169000_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98325 34.0 33.0 34.0 32.0 34.0 2 33.07875 34.0 33.0 34.0 32.0 34.0 3 33.11275 34.0 33.0 34.0 32.0 34.0 4 33.044 34.0 33.0 34.0 32.0 34.0 5 32.8295 34.0 33.0 34.0 32.0 34.0 6 36.65675 38.0 37.0 38.0 34.0 38.0 7 37.1095 38.0 38.0 38.0 36.0 38.0 8 37.2665 38.0 38.0 38.0 36.0 38.0 9 37.37025 38.0 38.0 38.0 37.0 38.0 10-14 37.364700000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.2847 38.0 38.0 38.0 36.8 38.0 20-24 37.18345 38.0 38.0 38.0 36.0 38.0 25-29 37.00015 38.0 38.0 38.0 36.0 38.0 30-34 36.96900000000001 38.0 38.0 38.0 35.4 38.0 35-39 36.8956 38.0 38.0 38.0 35.4 38.0 40-44 36.564099999999996 38.0 38.0 38.0 34.2 38.0 45-49 36.66279999999999 38.0 38.0 38.0 34.0 38.0 50-54 36.6391 38.0 38.0 38.0 34.2 38.0 55-59 36.4174 38.0 37.6 38.0 34.0 38.0 60-64 36.52935 38.0 38.0 38.0 34.0 38.0 65-69 36.45915 38.0 37.8 38.0 34.0 38.0 70-74 36.437 38.0 37.0 38.0 34.0 38.0 75-79 36.126099999999994 38.0 37.0 38.0 32.6 38.0 80-84 36.07095 38.0 37.0 38.0 32.2 38.0 85-89 35.6111 38.0 36.6 38.0 30.2 38.0 90-94 35.39965 38.0 36.2 38.0 29.0 38.0 95-99 35.5396 38.0 36.2 38.0 29.8 38.0 100-104 35.03845 38.0 35.4 38.0 27.8 38.0 105-109 35.40745 38.0 36.0 38.0 29.0 38.0 110-114 34.8837 38.0 35.2 38.0 27.2 38.0 115-119 34.6298 38.0 34.8 38.0 25.6 38.0 120-124 34.4889 38.0 34.8 38.0 25.4 38.0 125-129 33.378 37.8 33.4 38.0 17.8 38.0 130-134 33.4658 38.0 33.6 38.0 20.6 38.0 135-139 32.83275 37.2 32.6 38.0 19.6 38.0 140-144 32.791000000000004 38.0 32.4 38.0 15.0 38.0 145-149 31.299899999999997 36.2 31.0 38.0 10.8 38.0 150-151 26.201375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 3.0 17 1.0 18 6.0 19 5.0 20 3.0 21 4.0 22 8.0 23 7.0 24 21.0 25 23.0 26 32.0 27 37.0 28 52.0 29 77.0 30 76.0 31 115.0 32 142.0 33 186.0 34 284.0 35 460.0 36 915.0 37 1538.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.725 12.55 7.8 35.925000000000004 2 21.8 15.825 34.65 27.725 3 19.2 21.775 28.15 30.875000000000004 4 22.525000000000002 29.549999999999997 22.775000000000002 25.15 5 22.57983404576314 34.850389741010815 23.40960523007292 19.16017098315313 6 19.725 36.125 23.75 20.4 7 14.549999999999999 26.85 40.225 18.375 8 18.375 26.55 30.25 24.825 9 16.55 25.0 32.475 25.974999999999998 10-14 19.865 29.965000000000003 26.889999999999997 23.28 15-19 19.689999999999998 28.54 27.775 23.995 20-24 19.78 29.335 27.295 23.59 25-29 19.439999999999998 29.659999999999997 27.32 23.580000000000002 30-34 20.195 29.015 26.865 23.925 35-39 19.7 29.189999999999998 27.224999999999998 23.885 40-44 20.285 29.565 26.715 23.435 45-49 19.744999999999997 28.925 27.49 23.84 50-54 19.97 28.59 27.555000000000003 23.885 55-59 19.847977196579485 28.399259888983348 28.074211131669752 23.678551782767414 60-64 19.875 28.915000000000003 27.18 24.03 65-69 20.23 28.875 27.02 23.875 70-74 19.84 29.195 27.0 23.965 75-79 20.584116823364674 28.085617123424683 27.720544108821766 23.609721944388877 80-84 20.298044706706005 29.134370155523325 27.234085112766916 23.33350002500375 85-89 20.156124899919938 28.532826261008807 27.386909527622098 23.924139311449157 90-94 19.782707107288367 28.449273175393593 27.729993461093507 24.038026256224537 95-99 20.23 28.305000000000003 27.650000000000002 23.815 100-104 20.325 28.15 27.87 23.655 105-109 20.176317371268283 28.015427769985973 27.77499499098377 24.033259867761974 110-114 20.565 27.82 27.915 23.7 115-119 20.135 27.915 27.834999999999997 24.115000000000002 120-124 20.24 28.444999999999997 27.894999999999996 23.419999999999998 125-129 20.785 27.894999999999996 27.025 24.295 130-134 20.943141471220684 27.59913987098065 27.669150372555883 23.788568285242786 135-139 20.62 27.589999999999996 27.575 24.215 140-144 21.67 27.815 27.0 23.515 145-149 20.193129809384903 27.697027611527435 27.77246894331841 24.33737363576925 150-151 20.407652869826183 26.7725397023884 28.085532074527947 24.73427535325747 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 2.0 26 2.0 27 5.0 28 9.0 29 12.0 30 20.5 31 28.0 32 36.0 33 48.5 34 59.0 35 74.0 36 92.0 37 107.5 38 135.0 39 171.0 40 198.5 41 222.5 42 242.0 43 247.5 44 258.5 45 274.0 46 251.5 47 232.0 48 226.5 49 203.0 50 173.0 51 149.5 52 124.0 53 94.0 54 76.0 55 59.0 56 40.0 57 29.0 58 27.5 59 20.5 60 12.0 61 8.0 62 6.0 63 5.0 64 4.5 65 3.0 66 1.0 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.575 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.015 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.02 80-84 0.015 85-89 0.08 90-94 0.5950000000000001 95-99 0.0 100-104 0.0 105-109 0.18 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.0 140-144 0.0 145-149 0.585 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.42500000000000004 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.2 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.5 0.0 0.0 0.0 0.0 138-139 1.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACTG 10 0.0066027166 146.6329 145 >>END_MODULE SRR7169000 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169000_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.518 33.0 33.0 34.0 32.0 34.0 2 32.73825 33.0 33.0 34.0 32.0 34.0 3 32.66825 34.0 33.0 34.0 32.0 34.0 4 32.49325 34.0 33.0 34.0 32.0 34.0 5 32.5555 34.0 33.0 34.0 32.0 34.0 6 36.56525 38.0 38.0 38.0 35.0 38.0 7 36.66775 38.0 38.0 38.0 36.0 38.0 8 36.24025 38.0 38.0 38.0 34.0 38.0 9 36.40575 38.0 38.0 38.0 34.0 38.0 10-14 36.46905 38.0 38.0 38.0 34.6 38.0 15-19 36.3554 38.0 38.0 38.0 34.4 38.0 20-24 36.59985 38.0 38.0 38.0 35.2 38.0 25-29 36.517450000000004 38.0 38.0 38.0 34.8 38.0 30-34 36.388450000000006 38.0 38.0 38.0 34.6 38.0 35-39 36.45445 38.0 38.0 38.0 35.0 38.0 40-44 36.528949999999995 38.0 38.0 38.0 35.4 38.0 45-49 36.482899999999994 38.0 38.0 38.0 34.8 38.0 50-54 36.25175 38.0 38.0 38.0 34.0 38.0 55-59 35.65585 38.0 38.0 38.0 30.8 38.0 60-64 35.660399999999996 38.0 38.0 38.0 31.0 38.0 65-69 35.7445 38.0 38.0 38.0 32.0 38.0 70-74 36.0645 38.0 38.0 38.0 33.2 38.0 75-79 35.86005 38.0 38.0 38.0 32.4 38.0 80-84 35.94415 38.0 38.0 38.0 33.2 38.0 85-89 35.93415 38.0 37.8 38.0 32.0 38.0 90-94 35.9567 38.0 38.0 38.0 33.0 38.0 95-99 35.685700000000004 38.0 37.4 38.0 31.4 38.0 100-104 35.5527 38.0 37.4 38.0 31.2 38.0 105-109 35.09745 38.0 36.8 38.0 28.2 38.0 110-114 34.93365 38.0 36.8 38.0 27.2 38.0 115-119 34.836149999999996 38.0 36.8 38.0 26.6 38.0 120-124 34.8577 38.0 36.2 38.0 27.2 38.0 125-129 34.566250000000004 38.0 35.8 38.0 25.4 38.0 130-134 34.4868 38.0 35.6 38.0 25.0 38.0 135-139 34.05675 38.0 35.0 38.0 23.2 38.0 140-144 33.24515 38.0 34.4 38.0 17.0 38.0 145-149 32.0121 38.0 33.4 38.0 11.0 38.0 150-151 28.088125 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 6.0 4 1.0 5 1.0 6 4.0 7 0.0 8 2.0 9 4.0 10 1.0 11 4.0 12 1.0 13 2.0 14 8.0 15 5.0 16 7.0 17 8.0 18 10.0 19 11.0 20 13.0 21 11.0 22 14.0 23 22.0 24 25.0 25 26.0 26 25.0 27 42.0 28 56.0 29 46.0 30 56.0 31 73.0 32 85.0 33 127.0 34 146.0 35 255.0 36 532.0 37 2350.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.27183488547697 22.476717845456832 11.376793355147244 25.874653913918955 2 26.471324818432258 28.67518156774355 28.775356874530427 16.078136739293765 3 21.444752076516487 27.8882456581928 30.556254719355653 20.110747545935062 4 23.341772151898734 33.974683544303794 24.17721518987342 18.50632911392405 5 25.175175175175173 35.61061061061061 22.42242242242242 16.79179179179179 6 21.860930465232617 37.44372186093047 22.236118059029515 18.459229614807406 7 20.17059708981435 20.898143502257902 38.008028098344205 20.923231309583542 8 21.296530767282857 25.601418080526717 27.85515320334262 25.246897948847806 9 22.590361445783135 24.372489959839356 30.271084337349397 22.766064257028113 10-14 23.943449386194406 28.884081304085328 25.638961561682432 21.533507748037835 15-19 23.23808562197092 28.5187802907916 26.968901453957994 21.27423263327948 20-24 22.89029535864979 28.450874020494272 27.190074341973077 21.46875627888286 25-29 23.72915310261932 28.176491210497325 27.60554915610758 20.48880653077578 30-34 23.276943928517646 28.387129160182724 26.745645298930775 21.590281612368855 35-39 23.32059533386967 28.13254223652454 27.74034593724859 20.8065164923572 40-44 23.671279582831932 28.23405535499398 27.286401925391097 20.808263136782994 45-49 24.118915125081468 27.9691181631323 27.29733794555572 20.61462876623051 50-54 23.181635523407675 28.671890697207154 26.93891902752662 21.20755475185855 55-59 23.933577087141984 27.64574446475726 27.726995734308346 20.693682713792402 60-64 23.49621192861138 27.965627701225404 28.275791935729906 20.262368434433313 65-69 23.368956743002546 27.908396946564885 27.704834605597966 21.017811704834603 70-74 24.029993457802828 27.688591414624327 27.764078305067684 20.517336822505158 75-79 23.852748361069086 27.927382753403933 27.46343923348462 20.75642965204236 80-84 23.877355154821437 27.706218113855634 27.403141890185385 21.013284841137548 85-89 23.72898318654924 27.547037630104082 27.77722177742194 20.94675740592474 90-94 23.93273609929433 28.17676792953306 27.83143986787448 20.059056103298133 95-99 23.88621312462372 27.122215532811563 28.13064419024684 20.86092715231788 100-104 23.782941058137197 28.03761818547576 27.509555421444375 20.669885334942666 105-109 23.59090909090909 28.05050505050505 27.54040404040404 20.81818181818182 110-114 23.838804756580952 27.528204085781077 27.812785852220756 20.82020530541722 115-119 23.9209726443769 27.97872340425532 27.5177304964539 20.58257345491388 120-124 23.782349702157482 27.676828352605497 27.686839865845727 20.8539820793913 125-129 24.462702269425378 27.613847001653223 27.613847001653223 20.309603727268172 130-134 24.196701589052083 27.545240362925462 28.05654418767858 20.20151386034388 135-139 24.341512268402603 27.30595893840761 27.68652979469204 20.66599899849775 140-144 23.882093442951675 27.987768197313013 27.93262482454381 20.197513535191497 145-149 24.47770188830856 27.84250703093612 27.023905182804338 20.655885897950984 150-151 24.583385540659066 27.590527502819196 27.06427765944117 20.761809297080568 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.0 14 0.0 15 0.0 16 0.5 17 1.5 18 3.5 19 3.5 20 2.0 21 2.0 22 2.0 23 3.0 24 4.0 25 4.0 26 4.0 27 4.0 28 4.5 29 7.0 30 10.5 31 13.0 32 16.0 33 26.0 34 38.0 35 50.0 36 66.0 37 90.0 38 124.5 39 158.5 40 197.5 41 237.0 42 256.0 43 276.5 44 290.0 45 290.5 46 295.5 47 279.0 48 244.5 49 212.5 50 183.0 51 137.5 52 107.0 53 94.5 54 71.0 55 47.5 56 35.5 57 28.0 58 19.0 59 16.0 60 9.0 61 6.5 62 6.5 63 4.0 64 3.0 65 2.5 66 2.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.17500000000000002 3 0.675 4 1.25 5 0.1 6 0.05 7 0.35000000000000003 8 1.275 9 0.4 10-14 0.62 15-19 0.96 20-24 0.45999999999999996 25-29 0.165 30-34 0.395 35-39 0.5599999999999999 40-44 0.27999999999999997 45-49 0.265 50-54 0.45999999999999996 55-59 1.54 60-64 1.6650000000000003 65-69 1.7500000000000002 70-74 0.645 75-79 0.8500000000000001 80-84 1.015 85-89 0.08 90-94 0.095 95-99 0.33999999999999997 100-104 0.58 105-109 1.0 110-114 1.6099999999999999 115-119 1.3 120-124 0.11499999999999999 125-129 0.19499999999999998 130-134 0.255 135-139 0.15 140-144 0.26 145-149 0.44 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.42500000000000004 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.2 0.0 0.0 0.0 0.0 134-135 1.3875 0.0 0.0 0.0 0.0 136-137 1.575 0.0 0.0 0.0 0.0 138-139 1.7374999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGACG 10 0.006845402 144.87343 5 >>END_MODULE Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887676 spots for SRR7169000.sra Written 887676 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra Read 887669 spots for SRR7169000.sra Written 887669 spots for SRR7169000.sra SRR ids: ['SRR7169000.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kwyrp22r SRR7169000.sra spots: 17753387 blocks: [[1, 887669], [887670, 1775338], [1775339, 2663007], [2663008, 3550676], [3550677, 4438345], [4438346, 5326014], [5326015, 6213683], [6213684, 7101352], [7101353, 7989021], [7989022, 8876690], [8876691, 9764359], [9764360, 10652028], [10652029, 11539697], [11539698, 12427366], [12427367, 13315035], [13315036, 14202704], [14202705, 15090373], [15090374, 15978042], [15978043, 16865711], [16865712, 17753387]] SRR7169000 file size 5994339 SRR7169000 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169000 SRR7169000_1.fastq SRR7169000_2.fastq Input file: SRR7169000_1.fastq Paired file: SRR7169000_2.fastq trimmed: SRR7169000-trimmed-pair1.fastq, SRR7169000-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:02:55 2025 >> started Mon Feb 10 15:03:15 2025 >> done (20.432s) 17753387 read pairs processed; of these: 25746 ( 0.15%) short read pairs filtered out after trimming by size control 32521 ( 0.18%) empty read pairs filtered out after trimming by size control 17695120 (99.67%) read pairs available; of these: 8118863 (45.88%) trimmed read pairs available after processing 9576257 (54.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 0 0.00% 20 6 0.00% 21 2 0.00% 22 5 0.00% 23 3 0.00% 24 3 0.00% 25 8 0.00% 26 6 0.00% 27 6 0.00% 28 5 0.00% 29 12 0.00% 30 2 0.00% 31 10 0.00% 32 11 0.00% 33 10 0.00% 34 7 0.00% 35 5 0.00% 36 15 0.00% 37 5 0.00% 38 8 0.00% 39 10 0.00% 40 9 0.00% 41 11 0.00% 42 13 0.00% 43 11 0.00% 44 14 0.00% 45 17 0.00% 46 11 0.00% 47 23 0.00% 48 19 0.00% 49 30 0.00% 50 24 0.00% 51 39 0.00% 52 34 0.00% 53 34 0.00% 54 43 0.00% 55 37 0.00% 56 43 0.00% 57 49 0.00% 58 63 0.00% 59 61 0.00% 60 65 0.00% 61 84 0.00% 62 101 0.00% 63 108 0.00% 64 129 0.00% 65 103 0.00% 66 171 0.00% 67 148 0.00% 68 183 0.00% 69 213 0.00% 70 226 0.00% 71 252 0.00% 72 293 0.00% 73 384 0.00% 74 389 0.00% 75 431 0.00% 76 529 0.00% 77 586 0.00% 78 637 0.00% 79 700 0.00% 80 856 0.00% 81 975 0.01% 82 1113 0.01% 83 1396 0.01% 84 2549 0.01% 85 2912 0.02% 86 2954 0.02% 87 3131 0.02% 88 3289 0.02% 89 3382 0.02% 90 3479 0.02% 91 3701 0.02% 92 3867 0.02% 93 4216 0.02% 94 4302 0.02% 95 4718 0.03% 96 5110 0.03% 97 5282 0.03% 98 5816 0.03% 99 5712 0.03% 100 6047 0.03% 101 6357 0.04% 102 6853 0.04% 103 7357 0.04% 104 7806 0.04% 105 8330 0.05% 106 9005 0.05% 107 9402 0.05% 108 10285 0.06% 109 10826 0.06% 110 11407 0.06% 111 11555 0.07% 112 12525 0.07% 113 13442 0.08% 114 14368 0.08% 115 15155 0.09% 116 15869 0.09% 117 17037 0.10% 118 17674 0.10% 119 17997 0.10% 120 19077 0.11% 121 20454 0.12% 122 21726 0.12% 123 22908 0.13% 124 24631 0.14% 125 26213 0.15% 126 28105 0.16% 127 29873 0.17% 128 31668 0.18% 129 33784 0.19% 130 36631 0.21% 131 38857 0.22% 132 41556 0.23% 133 45417 0.26% 134 48989 0.28% 135 53906 0.30% 136 58345 0.33% 137 63059 0.36% 138 68639 0.39% 139 76707 0.43% 140 84623 0.48% 141 94498 0.53% 142 107943 0.61% 143 125166 0.71% 144 149529 0.85% 145 183844 1.04% 146 235918 1.33% 147 323969 1.83% 148 490403 2.77% 149 928845 5.25% 150 4299052 24.30% 151 9576257 54.12% 17695120 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=41 prefix-density=0.15 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=9 fanout-score=256.26 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=28.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=46 prefix-density=0.28 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=312.58 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=29.0 sequence=AAGAAGAAGAAG SRR7169000 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:04:08 Started mapping on | Feb 10 15:04:09 Finished on | Feb 10 15:05:59 Mapping speed, Million of reads per hour | 579.11 Number of input reads | 17695120 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16733831 Uniquely mapped reads % | 94.57% Average mapped length | 296.36 Number of splices: Total | 15959290 Number of splices: Annotated (sjdb) | 15689838 Number of splices: GT/AG | 15717531 Number of splices: GC/AG | 195337 Number of splices: AT/AC | 13531 Number of splices: Non-canonical | 32891 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 335457 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 33145 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.30% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 650433 650433 650433 N_multimapping 335457 335457 335457 N_noFeature 341713 16550605 426882 N_ambiguous 168020 1114 69250 UnstrandedReadsAssigned:16224098 PositiveStrandReadsAssigned:182112 NegativeStrandReadsAssigned:16237699 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169000 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169000-trimmed-pair1.fastq SRR7169000-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,695,120 reads, 16,143,574 reads pseudoaligned [quant] estimated average fragment length: 264.898 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR7169000.ke.tsv 34699 SRR7169000.se.tsv 87100 total ==> SRR7169000.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.1 323 9.97072 Potri.005G024800.1.v4.1 1035 771.102 54 3.79193 Potri.004G059700.1.v4.1 961 697.158 2 0.155338 Potri.007G009000.2.v4.1 1416 1152.1 0 0 Potri.003G141000.2.v4.1 2943 2679.1 302 6.10374 Potri.016G087400.1.v4.1 270 66.5495 1630.04 1326.27 Potri.015G069301.1.v4.1 564 307.338 0 0 Potri.010G195200.1.v4.1 1773 1509.1 52 1.86579 Potri.012G127500.1.v4.1 977 713.123 10689 811.617 ==> SRR7169000.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2013 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 314 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169000 completed mapping pipeline successfully