Starting /dee2/code/volunteer_pipeline.sh SRR7169001 current disk space = 3059131203584 free memory = 1275622596 SRR7169001 SRAfilesize c2002eb4cc28d2c0140c9063efcd96e2 SRR7169001.sra SRR7169001.sra file validated SRR7169001 is paired end SRR7169001 is conventional basespace SRR7169001 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169001_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94525 34.0 33.0 34.0 32.0 34.0 2 33.06925 34.0 33.0 34.0 32.0 34.0 3 33.1115 34.0 33.0 34.0 32.0 34.0 4 32.9365 34.0 33.0 34.0 32.0 34.0 5 32.7615 34.0 33.0 34.0 32.0 34.0 6 36.62225 38.0 37.0 38.0 34.0 38.0 7 37.002 38.0 38.0 38.0 35.0 38.0 8 37.19775 38.0 38.0 38.0 36.0 38.0 9 37.28025 38.0 38.0 38.0 37.0 38.0 10-14 37.311949999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.181349999999995 38.0 38.0 38.0 36.2 38.0 20-24 37.109750000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.9407 38.0 38.0 38.0 35.6 38.0 30-34 36.95029999999999 38.0 38.0 38.0 35.6 38.0 35-39 36.840250000000005 38.0 38.0 38.0 35.0 38.0 40-44 36.4862 38.0 38.0 38.0 34.2 38.0 45-49 36.65085 38.0 38.0 38.0 34.4 38.0 50-54 36.64274999999999 38.0 38.0 38.0 34.4 38.0 55-59 36.36125 38.0 37.8 38.0 33.8 38.0 60-64 36.4557 38.0 38.0 38.0 34.0 38.0 65-69 36.3487 38.0 37.4 38.0 33.6 38.0 70-74 36.3375 38.0 37.2 38.0 33.4 38.0 75-79 36.17105 38.0 37.0 38.0 33.2 38.0 80-84 36.05405 38.0 37.0 38.0 32.2 38.0 85-89 35.55105 38.0 36.6 38.0 30.0 38.0 90-94 35.3592 38.0 36.0 38.0 29.4 38.0 95-99 35.59665 38.0 36.4 38.0 29.8 38.0 100-104 35.0567 38.0 35.4 38.0 27.6 38.0 105-109 35.33120000000001 38.0 36.0 38.0 29.4 38.0 110-114 34.9713 38.0 35.4 38.0 27.6 38.0 115-119 34.6521 38.0 35.0 38.0 26.0 38.0 120-124 34.53060000000001 38.0 34.6 38.0 26.0 38.0 125-129 33.463649999999994 37.8 33.6 38.0 17.8 38.0 130-134 33.56195 38.0 34.0 38.0 20.6 38.0 135-139 32.829899999999995 37.2 32.6 38.0 18.4 38.0 140-144 32.9071 38.0 32.8 38.0 17.0 38.0 145-149 31.203300000000002 36.8 31.0 38.0 8.6 38.0 150-151 26.322125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 1.0 11 1.0 12 0.0 13 2.0 14 1.0 15 1.0 16 3.0 17 3.0 18 5.0 19 2.0 20 3.0 21 7.0 22 9.0 23 15.0 24 16.0 25 21.0 26 30.0 27 36.0 28 61.0 29 58.0 30 83.0 31 118.0 32 176.0 33 172.0 34 257.0 35 451.0 36 848.0 37 1617.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.85 12.85 8.725 34.575 2 21.425 16.325 33.650000000000006 28.599999999999998 3 18.425 25.174999999999997 25.6 30.8 4 21.45 31.424999999999997 23.9 23.225 5 21.802618328298088 34.566968781470294 24.018126888217523 19.6122860020141 6 19.925 34.675 25.424999999999997 19.975 7 14.149999999999999 27.875 39.625 18.35 8 16.950000000000003 24.85 31.075000000000003 27.125 9 16.900000000000002 25.6 32.300000000000004 25.2 10-14 19.71 30.514999999999997 26.325 23.45 15-19 19.115 29.395 27.6 23.89 20-24 19.955000000000002 29.465000000000003 27.125 23.455000000000002 25-29 19.79 29.304999999999996 27.35 23.555 30-34 19.994999999999997 29.765000000000004 26.87 23.369999999999997 35-39 19.814999999999998 29.509999999999998 27.189999999999998 23.485 40-44 20.07 29.060000000000002 26.97 23.9 45-49 20.424999999999997 29.580000000000002 26.39 23.605 50-54 20.505000000000003 29.84 26.695 22.96 55-59 20.43715300355124 29.140199069674388 26.914420047016456 23.508227879757914 60-64 20.36 29.494999999999997 26.71 23.435 65-69 20.380000000000003 29.675 26.69 23.255 70-74 20.05 29.349999999999998 27.065 23.535 75-79 19.778900505227355 28.943024360962433 27.20724325946676 24.070831874343455 80-84 20.244109849432245 28.86298834475514 27.322295032764742 23.57060677304787 85-89 20.21622703839031 29.676159967966363 26.45277541418489 23.65483757945843 90-94 20.16726283439972 28.7369640787949 27.185248627134868 23.910524459670512 95-99 20.119999999999997 29.085 27.055 23.74 100-104 19.814999999999998 28.34 27.384999999999998 24.46 105-109 19.601062496867637 28.857815867288128 27.10369368014835 24.437427955695885 110-114 20.68 27.91 27.944999999999997 23.465 115-119 20.13 28.244999999999997 27.725 23.9 120-124 20.64 28.744999999999997 26.93 23.685000000000002 125-129 20.685000000000002 28.54 26.705000000000002 24.07 130-134 21.196358907672302 28.048414524357305 27.2481744523357 23.507052115634693 135-139 21.16 28.050000000000004 27.47 23.32 140-144 20.7 27.67 27.77 23.86 145-149 21.217926097696225 28.744265765992843 26.33966829661743 23.698139839693503 150-151 21.156011510071313 28.800200175153257 26.598273489303143 23.445514825472287 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 2.5 24 6.0 25 5.5 26 6.0 27 8.5 28 12.5 29 18.0 30 20.0 31 29.5 32 41.5 33 48.0 34 69.0 35 82.5 36 92.5 37 110.5 38 131.0 39 152.0 40 175.0 41 201.5 42 224.5 43 270.0 44 279.0 45 261.0 46 246.0 47 248.5 48 235.5 49 185.0 50 169.5 51 159.0 52 127.0 53 95.0 54 73.0 55 53.0 56 40.5 57 33.0 58 23.0 59 15.5 60 12.0 61 6.5 62 3.0 63 4.0 64 5.0 65 2.5 66 3.0 67 4.0 68 1.5 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.7000000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.034999999999999996 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.045 80-84 0.045 85-89 0.105 90-94 0.755 95-99 0.0 100-104 0.0 105-109 0.23500000000000001 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.03 135-139 0.0 140-144 0.0 145-149 0.815 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.6000000000000001 0.0 0.0 0.0 0.0 120-121 0.7125 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.9125 0.0 0.0 0.0 0.0 126-127 1.0499999999999998 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.6625 0.0 0.0 0.0 0.0 132-133 1.975 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.5125 0.0 0.0 0.0 0.0 138-139 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCACTG 10 0.006841402 144.925 2 GGCAGCT 10 0.006841402 144.925 1 >>END_MODULE SRR7169001 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169001_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40425 33.0 33.0 34.0 32.0 34.0 2 32.5725 33.0 33.0 34.0 32.0 34.0 3 32.48525 34.0 33.0 34.0 32.0 34.0 4 32.257 34.0 33.0 34.0 32.0 34.0 5 32.50475 34.0 33.0 34.0 32.0 34.0 6 36.45925 38.0 38.0 38.0 34.0 38.0 7 36.685 38.0 38.0 38.0 35.0 38.0 8 36.07375 38.0 38.0 38.0 34.0 38.0 9 36.314 38.0 38.0 38.0 34.0 38.0 10-14 36.31745 38.0 38.0 38.0 34.0 38.0 15-19 36.187149999999995 38.0 38.0 38.0 33.8 38.0 20-24 36.413799999999995 38.0 38.0 38.0 35.0 38.0 25-29 36.3858 38.0 38.0 38.0 34.8 38.0 30-34 36.222500000000004 38.0 38.0 38.0 34.2 38.0 35-39 36.20694999999999 38.0 38.0 38.0 34.4 38.0 40-44 36.291199999999996 38.0 38.0 38.0 34.4 38.0 45-49 36.259550000000004 38.0 38.0 38.0 34.6 38.0 50-54 36.024800000000006 38.0 38.0 38.0 33.4 38.0 55-59 35.4053 38.0 38.0 38.0 29.8 38.0 60-64 35.3457 38.0 38.0 38.0 29.4 38.0 65-69 35.41994999999999 38.0 38.0 38.0 29.8 38.0 70-74 35.7907 38.0 38.0 38.0 32.0 38.0 75-79 35.63775 38.0 38.0 38.0 31.0 38.0 80-84 35.5311 38.0 38.0 38.0 31.0 38.0 85-89 35.6312 38.0 38.0 38.0 31.0 38.0 90-94 35.70295 38.0 38.0 38.0 32.2 38.0 95-99 35.44325 38.0 37.6 38.0 30.2 38.0 100-104 35.17785 38.0 37.2 38.0 29.0 38.0 105-109 34.8447 38.0 37.0 38.0 26.8 38.0 110-114 34.59535 38.0 37.0 38.0 25.4 38.0 115-119 34.55145 38.0 36.2 38.0 25.4 38.0 120-124 34.552550000000004 38.0 36.0 38.0 25.2 38.0 125-129 34.28724999999999 38.0 35.8 38.0 23.2 38.0 130-134 34.17215 38.0 35.2 38.0 23.2 38.0 135-139 33.8497 38.0 35.0 38.0 20.6 38.0 140-144 33.07085 38.0 34.4 38.0 14.2 38.0 145-149 31.7583 38.0 32.6 38.0 8.6 38.0 150-151 28.11025 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 15.0 4 4.0 5 5.0 6 9.0 7 6.0 8 3.0 9 1.0 10 6.0 11 4.0 12 5.0 13 5.0 14 4.0 15 6.0 16 9.0 17 6.0 18 13.0 19 14.0 20 8.0 21 14.0 22 20.0 23 20.0 24 17.0 25 28.0 26 28.0 27 37.0 28 41.0 29 50.0 30 66.0 31 68.0 32 89.0 33 125.0 34 166.0 35 247.0 36 499.0 37 2342.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.179616548940466 22.09889001009082 11.175580221997981 24.545913218970735 2 26.962628542763984 26.410835214446955 30.198143967895664 16.4283922748934 3 21.192220257640816 27.68375852488002 31.52311189694367 19.60090932053549 4 24.491869918699187 33.511178861788615 22.586382113821138 19.410569105691057 5 24.086129193790686 35.92889334001001 22.8592889334001 17.1256885327992 6 21.27127127127127 37.11211211211211 23.2982982982983 18.31831831831832 7 20.863670600050213 20.81345719307055 38.13708260105449 20.185789605824755 8 21.49390243902439 25.304878048780488 27.489837398373986 25.71138211382114 9 21.814526262880122 24.8303593867806 29.303845187232973 24.05126916310631 10-14 22.810908907596914 28.62327972979785 26.57659928416595 21.98921207843928 15-19 23.152410339420303 28.12990034903131 27.553239921088572 21.16444939045981 20-24 22.742138364779873 28.432704402515725 27.828930817610065 20.99622641509434 25-29 23.38410662391021 27.983765908407655 27.62300831746668 21.00911915021545 30-34 23.572577402492964 27.543224768797746 27.864897466827504 21.019300361881786 35-39 23.296227270437715 27.965546768750315 27.366141137359595 21.372084823452376 40-44 23.58964063441076 27.444288295522988 27.896004818309578 21.070066251756675 45-49 23.450905624404193 27.499874567257038 27.9614670613617 21.08775274697707 50-54 23.020461515258155 28.243929415313456 27.615504499522398 21.120104569905987 55-59 23.6823325517382 27.943725150372106 27.693954531552656 20.67998776633704 60-64 22.81104814417726 27.589727880737225 28.820135804360035 20.779088170725483 65-69 23.41969441463539 27.472022075732028 28.069906484746284 21.0383770248863 70-74 23.3445962983509 28.049826012406072 28.39780120026224 20.207776488980787 75-79 23.49641160416456 27.69635095522086 27.989487516425754 20.81774992418882 80-84 23.684343818062096 27.84784480575394 27.91369092843033 20.554120447753636 85-89 23.879849812265334 27.62453066332916 28.000000000000004 20.495619524405505 90-94 23.664580725907385 27.52941176470588 28.31038798498123 20.495619524405505 95-99 22.910807553234232 27.571313780634792 28.68621936520691 20.831659300924066 100-104 24.203950020153165 27.63502619911326 27.821442966545746 20.339580814187826 105-109 23.69713851608002 27.1714358065333 28.255254494808813 20.876171182577867 110-114 24.070769387651048 27.634732065466782 27.64492938357212 20.64956916331005 115-119 23.854050208354508 27.30460412643561 28.508994816546394 20.332350848663484 120-124 24.23377403846154 26.953125 28.335336538461537 20.477764423076923 125-129 23.85201523962302 27.45137357128534 28.173250451173047 20.52336073791859 130-134 24.054379452192233 27.465636600782585 27.576000802648743 20.903983144376443 135-139 24.427633886077853 27.24312409197936 27.944491758929914 20.384750263012876 140-144 24.34778246036524 27.58880192655027 27.734296608468796 20.32911900461569 145-149 24.277165987831246 27.99316136169357 27.69145673052748 20.038215919947707 150-151 24.921649743011155 26.96502444528018 27.554218377836282 20.559107433872384 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 2.0 15 4.0 16 2.5 17 1.0 18 1.0 19 0.5 20 2.0 21 2.0 22 3.0 23 5.0 24 7.0 25 7.5 26 9.0 27 11.0 28 7.0 29 8.5 30 15.5 31 20.5 32 24.0 33 30.5 34 42.5 35 59.5 36 82.0 37 99.5 38 135.5 39 175.0 40 204.5 41 213.0 42 242.0 43 274.0 44 260.5 45 277.5 46 292.0 47 261.0 48 225.0 49 195.5 50 168.0 51 145.0 52 116.0 53 92.5 54 66.0 55 42.5 56 40.0 57 35.0 58 28.0 59 21.5 60 11.0 61 6.0 62 6.0 63 6.5 64 4.5 65 2.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.325 3 1.0250000000000001 4 1.6 5 0.15 6 0.1 7 0.42500000000000004 8 1.6 9 0.525 10-14 0.815 15-19 1.155 20-24 0.625 25-29 0.21 30-34 0.52 35-39 0.735 40-44 0.38 45-49 0.345 50-54 0.545 55-59 1.91 60-64 2.0650000000000004 65-69 2.155 70-74 0.855 75-79 1.0699999999999998 80-84 1.2850000000000001 85-89 0.125 90-94 0.125 95-99 0.44 100-104 0.76 105-109 1.275 110-114 1.9349999999999998 115-119 1.6099999999999999 120-124 0.16 125-129 0.26 130-134 0.33 135-139 0.19499999999999998 140-144 0.33999999999999997 145-149 0.565 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.47762694821518353 0.95 3 0.0 0.0 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.6124999999999998 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.45 0.0 0.0 0.0 0.0 138-139 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGACT 10 0.0069410685 144.20253 1 GGGGGGG 20 0.0060953954 28.840506 120-124 >>END_MODULE Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra Read 816698 spots for SRR7169001.sra Written 816698 spots for SRR7169001.sra Read 816680 spots for SRR7169001.sra Written 816680 spots for SRR7169001.sra SRR ids: ['SRR7169001.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o1oj39q6 SRR7169001.sra spots: 16333618 blocks: [[1, 816680], [816681, 1633360], [1633361, 2450040], [2450041, 3266720], [3266721, 4083400], [4083401, 4900080], [4900081, 5716760], [5716761, 6533440], [6533441, 7350120], [7350121, 8166800], [8166801, 8983480], [8983481, 9800160], [9800161, 10616840], [10616841, 11433520], [11433521, 12250200], [12250201, 13066880], [13066881, 13883560], [13883561, 14700240], [14700241, 15516920], [15516921, 16333618]] SRR7169001 file size 5513226 SRR7169001 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169001 SRR7169001_1.fastq SRR7169001_2.fastq Input file: SRR7169001_1.fastq Paired file: SRR7169001_2.fastq trimmed: SRR7169001-trimmed-pair1.fastq, SRR7169001-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:25:58 2025 >> started Mon Feb 10 15:26:15 2025 >> done (16.865s) 16333618 read pairs processed; of these: 32713 ( 0.20%) short read pairs filtered out after trimming by size control 32303 ( 0.20%) empty read pairs filtered out after trimming by size control 16268602 (99.60%) read pairs available; of these: 7586346 (46.63%) trimmed read pairs available after processing 8682256 (53.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 9 0.00% 21 11 0.00% 22 10 0.00% 23 11 0.00% 24 7 0.00% 25 6 0.00% 26 9 0.00% 27 9 0.00% 28 9 0.00% 29 13 0.00% 30 10 0.00% 31 6 0.00% 32 11 0.00% 33 13 0.00% 34 10 0.00% 35 8 0.00% 36 13 0.00% 37 12 0.00% 38 19 0.00% 39 10 0.00% 40 7 0.00% 41 18 0.00% 42 12 0.00% 43 14 0.00% 44 15 0.00% 45 22 0.00% 46 21 0.00% 47 21 0.00% 48 28 0.00% 49 30 0.00% 50 41 0.00% 51 29 0.00% 52 43 0.00% 53 42 0.00% 54 46 0.00% 55 52 0.00% 56 46 0.00% 57 66 0.00% 58 71 0.00% 59 83 0.00% 60 88 0.00% 61 89 0.00% 62 100 0.00% 63 120 0.00% 64 135 0.00% 65 155 0.00% 66 174 0.00% 67 177 0.00% 68 211 0.00% 69 211 0.00% 70 263 0.00% 71 295 0.00% 72 342 0.00% 73 440 0.00% 74 466 0.00% 75 522 0.00% 76 579 0.00% 77 657 0.00% 78 700 0.00% 79 828 0.01% 80 951 0.01% 81 1105 0.01% 82 1296 0.01% 83 1641 0.01% 84 3031 0.02% 85 3419 0.02% 86 3618 0.02% 87 3723 0.02% 88 3881 0.02% 89 3969 0.02% 90 4074 0.03% 91 4373 0.03% 92 4698 0.03% 93 4926 0.03% 94 5181 0.03% 95 5315 0.03% 96 5849 0.04% 97 5922 0.04% 98 6028 0.04% 99 6400 0.04% 100 6763 0.04% 101 7010 0.04% 102 7561 0.05% 103 8041 0.05% 104 8574 0.05% 105 9396 0.06% 106 10076 0.06% 107 10164 0.06% 108 11084 0.07% 109 11609 0.07% 110 12216 0.08% 111 12506 0.08% 112 13269 0.08% 113 14218 0.09% 114 15223 0.09% 115 16033 0.10% 116 17028 0.10% 117 17953 0.11% 118 18261 0.11% 119 18877 0.12% 120 20111 0.12% 121 21211 0.13% 122 22402 0.14% 123 24049 0.15% 124 25574 0.16% 125 26963 0.17% 126 28777 0.18% 127 30817 0.19% 128 31706 0.19% 129 34029 0.21% 130 36019 0.22% 131 38123 0.23% 132 41330 0.25% 133 44705 0.27% 134 48402 0.30% 135 53269 0.33% 136 56889 0.35% 137 61521 0.38% 138 67416 0.41% 139 73614 0.45% 140 80379 0.49% 141 90664 0.56% 142 101958 0.63% 143 117489 0.72% 144 140232 0.86% 145 172310 1.06% 146 220190 1.35% 147 299498 1.84% 148 450758 2.77% 149 851948 5.24% 150 3941257 24.23% 151 8682256 53.37% 16268602 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=42 prefix-density=0.21 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=275.39 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=18.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=74.70 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.1 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7169001 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:27:02 Started mapping on | Feb 10 15:27:02 Finished on | Feb 10 15:28:50 Mapping speed, Million of reads per hour | 542.29 Number of input reads | 16268602 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15287337 Uniquely mapped reads % | 93.97% Average mapped length | 295.86 Number of splices: Total | 14156797 Number of splices: Annotated (sjdb) | 13929562 Number of splices: GT/AG | 13956720 Number of splices: GC/AG | 160314 Number of splices: AT/AC | 11887 Number of splices: Non-canonical | 27876 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285610 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 29448 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 725967 725967 725967 N_multimapping 285610 285610 285610 N_noFeature 356846 15094434 451604 N_ambiguous 161512 853 62798 UnstrandedReadsAssigned:14768979 PositiveStrandReadsAssigned:192050 NegativeStrandReadsAssigned:14772935 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169001 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169001-trimmed-pair1.fastq SRR7169001-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,268,602 reads, 14,686,101 reads pseudoaligned [quant] estimated average fragment length: 252.999 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR7169001.ke.tsv 34699 SRR7169001.se.tsv 87100 total ==> SRR7169001.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766 291 9.92184 Potri.005G024800.1.v4.1 1035 783.001 41 3.15291 Potri.004G059700.1.v4.1 961 709.042 4 0.339686 Potri.007G009000.2.v4.1 1416 1164 0 0 Potri.003G141000.2.v4.1 2943 2691 230.052 5.14756 Potri.016G087400.1.v4.1 270 69.9196 1319.51 1136.32 Potri.015G069301.1.v4.1 564 316.885 0 0 Potri.010G195200.1.v4.1 1773 1521 13 0.51464 Potri.012G127500.1.v4.1 977 725.042 5032 417.895 ==> SRR7169001.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1343 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169001 completed mapping pipeline successfully