Starting /dee2/code/volunteer_pipeline.sh SRR7169002 current disk space = 3059076775936 free memory = 1232400296 SRR7169002 SRAfilesize 450c7885edf0347f25aeea1aa7ab3949 SRR7169002.sra SRR7169002.sra file validated SRR7169002 is paired end SRR7169002 is conventional basespace SRR7169002 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169002_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.34225 34.0 34.0 34.0 33.0 34.0 2 33.566 34.0 34.0 34.0 33.0 34.0 3 33.499 34.0 34.0 34.0 33.0 34.0 4 33.546 34.0 34.0 34.0 33.0 34.0 5 33.55825 34.0 34.0 34.0 33.0 34.0 6 37.21625 38.0 38.0 38.0 36.0 38.0 7 37.39825 38.0 38.0 38.0 37.0 38.0 8 37.4155 38.0 38.0 38.0 37.0 38.0 9 37.4985 38.0 38.0 38.0 37.0 38.0 10-14 37.4707 38.0 38.0 38.0 37.2 38.0 15-19 37.509100000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.4939 38.0 38.0 38.0 37.6 38.0 25-29 37.4726 38.0 38.0 38.0 37.4 38.0 30-34 37.470150000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.28595 38.0 38.0 38.0 36.8 38.0 40-44 37.22795000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.208 38.0 38.0 38.0 36.4 38.0 50-54 37.149950000000004 38.0 38.0 38.0 36.2 38.0 55-59 37.09495 38.0 38.0 38.0 36.0 38.0 60-64 37.075900000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.0032 38.0 38.0 38.0 36.0 38.0 70-74 36.8953 38.0 38.0 38.0 35.8 38.0 75-79 36.8601 38.0 38.0 38.0 35.2 38.0 80-84 36.60095 38.0 38.0 38.0 34.4 38.0 85-89 36.48535 38.0 38.0 38.0 34.0 38.0 90-94 36.31255 38.0 37.8 38.0 33.4 38.0 95-99 36.216249999999995 38.0 37.6 38.0 33.2 38.0 100-104 35.83030000000001 38.0 37.0 38.0 31.0 38.0 105-109 35.556349999999995 38.0 37.0 38.0 29.6 38.0 110-114 35.03869999999999 38.0 36.0 38.0 28.0 38.0 115-119 34.785650000000004 38.0 35.8 38.0 26.8 38.0 120-124 34.16664999999999 38.0 34.2 38.0 24.4 38.0 125-129 33.68815 38.0 33.6 38.0 21.2 38.0 130-134 33.0244 38.0 33.0 38.0 17.0 38.0 135-139 31.98845 37.8 31.4 38.0 13.4 38.0 140-144 30.824650000000002 36.2 28.4 38.0 12.2 38.0 145-149 29.182100000000002 36.0 27.4 38.0 2.0 38.0 150-151 21.584 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 6.0 17 4.0 18 1.0 19 10.0 20 13.0 21 4.0 22 12.0 23 13.0 24 15.0 25 20.0 26 22.0 27 34.0 28 51.0 29 39.0 30 69.0 31 69.0 32 125.0 33 167.0 34 250.0 35 474.0 36 1013.0 37 1584.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.2092555331992 13.12877263581489 9.6579476861167 34.00402414486921 2 22.275 15.925 34.875 26.924999999999997 3 20.200000000000003 20.825 27.175 31.8 4 22.425 29.775000000000002 23.7 24.099999999999998 5 21.655413853463365 34.40860215053764 23.655913978494624 20.280070017504375 6 19.625 34.849999999999994 25.224999999999998 20.3 7 14.424999999999999 26.325 41.5 17.75 8 18.05 25.874999999999996 30.25 25.825 9 17.625 24.975 32.925 24.474999999999998 10-14 20.32 29.82 26.845000000000002 23.015 15-19 20.585 28.804999999999996 27.089999999999996 23.52 20-24 20.424999999999997 28.449999999999996 27.450000000000003 23.674999999999997 25-29 19.8 29.34 27.315 23.544999999999998 30-34 19.830000000000002 29.09 27.655 23.425 35-39 20.0 29.189999999999998 27.0 23.810000000000002 40-44 20.895 28.939999999999998 26.790000000000003 23.375 45-49 19.99 28.854999999999997 27.435 23.72 50-54 20.235 28.665000000000003 27.005000000000003 24.095 55-59 20.175 28.999999999999996 26.85 23.974999999999998 60-64 20.14 28.895 27.29 23.674999999999997 65-69 20.21 28.835 27.105 23.849999999999998 70-74 20.23 29.235 27.310000000000002 23.225 75-79 20.27 28.68 26.93 24.12 80-84 21.029999999999998 28.095 27.529999999999998 23.345 85-89 20.810000000000002 28.025 27.375 23.79 90-94 20.424999999999997 28.38 27.055 24.14 95-99 20.325 28.410000000000004 27.185 24.08 100-104 20.71 28.470000000000002 27.37 23.45 105-109 20.925 28.43 26.93 23.715 110-114 20.385 28.98 26.740000000000002 23.895 115-119 20.575 27.99 27.235 24.2 120-124 20.294999999999998 28.825 27.295 23.585 125-129 20.715 27.975 27.445000000000004 23.865 130-134 20.66 28.425 27.08 23.835 135-139 20.735 28.465 26.924999999999997 23.875 140-144 20.54 27.810000000000002 27.24 24.41 145-149 21.245 27.68 27.060000000000002 24.015 150-151 21.2 27.5125 27.9375 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 2.0 22 3.0 23 1.0 24 0.0 25 3.5 26 7.0 27 6.5 28 10.0 29 14.5 30 20.5 31 27.0 32 30.5 33 37.0 34 56.0 35 73.0 36 81.0 37 101.0 38 129.5 39 152.0 40 173.0 41 195.0 42 223.0 43 258.5 44 274.0 45 273.5 46 274.5 47 274.5 48 244.0 49 204.5 50 168.5 51 129.5 52 130.0 53 116.5 54 76.5 55 60.0 56 41.5 57 26.0 58 26.0 59 19.5 60 11.0 61 8.5 62 7.5 63 6.5 64 5.0 65 3.5 66 2.5 67 2.5 68 2.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.1875 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.7375 0.0 0.0 0.0 0.0 138-139 1.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169002 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169002_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8495 33.0 33.0 34.0 32.0 34.0 2 32.9045 34.0 33.0 34.0 32.0 34.0 3 32.84075 34.0 33.0 34.0 31.0 34.0 4 32.8385 34.0 33.0 34.0 32.0 34.0 5 32.81225 34.0 33.0 34.0 31.0 34.0 6 37.0295 38.0 38.0 38.0 37.0 38.0 7 37.015 38.0 38.0 38.0 36.0 38.0 8 37.05775 38.0 38.0 38.0 37.0 38.0 9 37.065 38.0 38.0 38.0 37.0 38.0 10-14 37.04845 38.0 38.0 38.0 37.0 38.0 15-19 37.012350000000005 38.0 38.0 38.0 36.6 38.0 20-24 36.93755 38.0 38.0 38.0 36.0 38.0 25-29 36.84660000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.814 38.0 38.0 38.0 36.0 38.0 35-39 36.72879999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.6589 38.0 38.0 38.0 35.2 38.0 45-49 36.551750000000006 38.0 38.0 38.0 34.6 38.0 50-54 36.42125 38.0 38.0 38.0 34.2 38.0 55-59 36.374649999999995 38.0 38.0 38.0 34.0 38.0 60-64 36.213499999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.08409999999999 38.0 37.6 38.0 33.4 38.0 70-74 35.972500000000004 38.0 37.2 38.0 33.0 38.0 75-79 35.786950000000004 38.0 37.0 38.0 32.0 38.0 80-84 35.59545 38.0 37.0 38.0 30.6 38.0 85-89 35.4053 38.0 36.8 38.0 29.0 38.0 90-94 35.04175 38.0 36.0 38.0 28.4 38.0 95-99 34.69615 38.0 35.6 38.0 26.0 38.0 100-104 34.20955 38.0 34.4 38.0 24.4 38.0 105-109 33.50795 38.0 33.0 38.0 20.0 38.0 110-114 32.983549999999994 38.0 32.6 38.0 14.8 38.0 115-119 32.06515 37.8 30.8 38.0 13.8 38.0 120-124 30.9002 37.0 28.0 38.0 13.0 38.0 125-129 30.0392 36.2 26.2 38.0 11.8 38.0 130-134 28.724200000000003 34.2 22.0 38.0 5.6 38.0 135-139 27.7935 33.0 19.8 38.0 2.0 38.0 140-144 26.16735 33.0 14.2 38.0 2.0 38.0 145-149 23.62085 31.8 4.2 38.0 2.0 38.0 150-151 16.6965 15.0 2.0 32.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 3.0 5 3.0 6 2.0 7 2.0 8 4.0 9 3.0 10 0.0 11 2.0 12 1.0 13 3.0 14 8.0 15 9.0 16 12.0 17 12.0 18 9.0 19 8.0 20 26.0 21 25.0 22 25.0 23 30.0 24 41.0 25 36.0 26 45.0 27 55.0 28 55.0 29 95.0 30 105.0 31 154.0 32 181.0 33 303.0 34 431.0 35 645.0 36 1012.0 37 639.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.475 21.575 12.65 25.3 2 28.021015761821367 25.31898924193145 29.171878909181885 17.4881160870653 3 19.759579263711498 29.7771099423992 30.35311795642374 20.110192837465565 4 24.517906336088156 34.059604307538194 22.839969947407965 18.582519408965688 5 24.442774855997996 37.64087152516905 20.63611319809667 17.28024042073629 6 21.005251312828207 37.409352338084524 23.355838959739934 18.229557389347338 7 19.954988747186796 21.73043260815204 38.584646161540384 19.72993248312078 8 23.23080770192548 24.88122030507627 26.756689172293076 25.131282820705174 9 22.080520130032507 26.331582895723933 27.631907976994246 23.95598899724931 10-14 23.556177808890443 28.826441322066103 26.236311815590778 21.381069053452674 15-19 23.106155307765388 27.85639281964098 27.1963598179909 21.841092054602733 20-24 23.32966593318664 27.720544108821766 27.465493098619724 21.484296859371874 25-29 23.522352235223522 28.052805280528055 27.17271727172717 21.252125212521253 30-34 23.030757689422355 28.092023005751436 27.301825456364092 21.575393848462117 35-39 23.187318731873187 27.93279327932793 27.477747774777477 21.402140214021404 40-44 23.477347734773478 27.987798779877988 27.127712771277128 21.407140714071407 45-49 23.809761952390478 27.460492098419685 27.730546109221844 20.999199839967993 50-54 23.083462519377907 27.669150372555883 27.664149622443368 21.583237485622845 55-59 23.779755951190236 27.370474094818963 27.860572114422883 20.989197839567915 60-64 23.62736273627363 27.482748274827486 27.787778777877786 21.102110211021103 65-69 23.751187559377968 27.791389569478476 27.626381319065953 20.831041552077604 70-74 23.282328232823282 27.512751275127513 28.072807280728075 21.132113211321133 75-79 23.367336733673366 28.002800280028 27.377737773777376 21.252125212521253 80-84 23.92239223922392 27.662766276627664 27.10771077107711 21.307130713071306 85-89 23.453518027704156 27.384107616142423 27.759163874581187 21.403210481572234 90-94 23.551177558877946 27.961398069903492 27.33136656832842 21.156057802890142 95-99 23.165 27.51 27.67 21.654999999999998 100-104 24.065 27.255000000000003 28.02 20.66 105-109 24.437443744374438 26.977697769776977 27.57275727572757 21.012101210121013 110-114 23.941197059852993 27.66638331916596 27.35636781839092 21.03605180259013 115-119 23.693554033104967 27.33410011501725 27.404110616592487 21.568235235285293 120-124 23.301990597179152 27.978393518055416 27.348204461338398 21.371411423427027 125-129 24.251062765691422 27.506876719179797 27.04176044011003 21.200300075018756 130-134 23.563534530179528 27.62914437165575 27.314097114567186 21.493223983597538 135-139 23.88477695539108 27.68553710742148 27.475495099019803 20.954190838167634 140-144 24.132413241324134 27.32773277327733 27.237723772377237 21.302130213021304 145-149 24.271213560678035 27.101355067753385 27.026351317565876 21.6010800540027 150-151 24.0125 26.974999999999998 27.6375 21.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 2.0 25 3.5 26 1.5 27 1.5 28 5.5 29 8.5 30 11.5 31 11.5 32 18.0 33 25.5 34 32.5 35 52.5 36 75.0 37 108.0 38 134.5 39 144.0 40 171.0 41 213.0 42 251.5 43 283.0 44 299.0 45 299.5 46 294.0 47 260.5 48 228.0 49 208.5 50 167.5 51 135.5 52 120.0 53 102.5 54 81.5 55 65.0 56 46.0 57 30.0 58 22.5 59 16.0 60 12.5 61 10.0 62 5.5 63 4.5 64 5.5 65 3.0 66 1.5 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 1.0 90 0.5 91 0.0 92 0.5 93 0.5 94 0.5 95 1.0 96 0.5 97 1.0 98 1.0 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.005 15-19 0.005 20-24 0.02 25-29 0.01 30-34 0.025 35-39 0.01 40-44 0.01 45-49 0.02 50-54 0.015 55-59 0.02 60-64 0.01 65-69 0.005 70-74 0.01 75-79 0.01 80-84 0.01 85-89 0.015 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.005 115-119 0.015 120-124 0.03 125-129 0.025 130-134 0.015 135-139 0.02 140-144 0.01 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37011841773746 98.6 2 0.5542957923910304 1.0999999999999999 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.02519526329050139 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.6499999999999999 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.8999999999999999 0.0 0.0 0.0 0.0 130-131 0.9875 0.0 0.0 0.0 0.0 132-133 1.0499999999999998 0.0 0.0 0.0 0.0 134-135 1.2625000000000002 0.0 0.0 0.0 0.0 136-137 1.45 0.0 0.0 0.0 0.0 138-139 1.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAACT 10 0.006830828 145.0 3 >>END_MODULE Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731566 spots for SRR7169002.sra Written 731566 spots for SRR7169002.sra Read 731580 spots for SRR7169002.sra Written 731580 spots for SRR7169002.sra SRR ids: ['SRR7169002.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r5qa75sc SRR7169002.sra spots: 14631334 blocks: [[1, 731566], [731567, 1463132], [1463133, 2194698], [2194699, 2926264], [2926265, 3657830], [3657831, 4389396], [4389397, 5120962], [5120963, 5852528], [5852529, 6584094], [6584095, 7315660], [7315661, 8047226], [8047227, 8778792], [8778793, 9510358], [9510359, 10241924], [10241925, 10973490], [10973491, 11705056], [11705057, 12436622], [12436623, 13168188], [13168189, 13899754], [13899755, 14631334]] SRR7169002 file size 4936378 SRR7169002 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169002 SRR7169002_1.fastq SRR7169002_2.fastq Input file: SRR7169002_1.fastq Paired file: SRR7169002_2.fastq trimmed: SRR7169002-trimmed-pair1.fastq, SRR7169002-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:04:33 2025 >> started Mon Feb 10 15:04:48 2025 >> done (15.020s) 14631334 read pairs processed; of these: 21187 ( 0.14%) short read pairs filtered out after trimming by size control 13388 ( 0.09%) empty read pairs filtered out after trimming by size control 14596759 (99.76%) read pairs available; of these: 6204712 (42.51%) trimmed read pairs available after processing 8392047 (57.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 4 0.00% 21 3 0.00% 22 6 0.00% 23 6 0.00% 24 12 0.00% 25 4 0.00% 26 4 0.00% 27 7 0.00% 28 4 0.00% 29 6 0.00% 30 12 0.00% 31 7 0.00% 32 5 0.00% 33 4 0.00% 34 7 0.00% 35 6 0.00% 36 2 0.00% 37 8 0.00% 38 8 0.00% 39 7 0.00% 40 10 0.00% 41 12 0.00% 42 10 0.00% 43 8 0.00% 44 16 0.00% 45 12 0.00% 46 20 0.00% 47 12 0.00% 48 13 0.00% 49 15 0.00% 50 19 0.00% 51 26 0.00% 52 21 0.00% 53 37 0.00% 54 25 0.00% 55 35 0.00% 56 41 0.00% 57 43 0.00% 58 47 0.00% 59 39 0.00% 60 57 0.00% 61 73 0.00% 62 64 0.00% 63 83 0.00% 64 83 0.00% 65 115 0.00% 66 121 0.00% 67 111 0.00% 68 152 0.00% 69 159 0.00% 70 193 0.00% 71 191 0.00% 72 269 0.00% 73 281 0.00% 74 308 0.00% 75 333 0.00% 76 343 0.00% 77 413 0.00% 78 536 0.00% 79 482 0.00% 80 564 0.00% 81 728 0.00% 82 822 0.01% 83 966 0.01% 84 1875 0.01% 85 2416 0.02% 86 2332 0.02% 87 2634 0.02% 88 2767 0.02% 89 2717 0.02% 90 2757 0.02% 91 3066 0.02% 92 3023 0.02% 93 3251 0.02% 94 3556 0.02% 95 3766 0.03% 96 4025 0.03% 97 4333 0.03% 98 4521 0.03% 99 4713 0.03% 100 5197 0.04% 101 5452 0.04% 102 5844 0.04% 103 6240 0.04% 104 6528 0.04% 105 7044 0.05% 106 7580 0.05% 107 7802 0.05% 108 8281 0.06% 109 8800 0.06% 110 9196 0.06% 111 10089 0.07% 112 10764 0.07% 113 10991 0.08% 114 11968 0.08% 115 12788 0.09% 116 13849 0.09% 117 14725 0.10% 118 15723 0.11% 119 16063 0.11% 120 16836 0.12% 121 18170 0.12% 122 19339 0.13% 123 20896 0.14% 124 22238 0.15% 125 23505 0.16% 126 24950 0.17% 127 26489 0.18% 128 28433 0.19% 129 30395 0.21% 130 32477 0.22% 131 34141 0.23% 132 37162 0.25% 133 39612 0.27% 134 43560 0.30% 135 45962 0.31% 136 50031 0.34% 137 54607 0.37% 138 58935 0.40% 139 63577 0.44% 140 70761 0.48% 141 78657 0.54% 142 88282 0.60% 143 102120 0.70% 144 118795 0.81% 145 142931 0.98% 146 179719 1.23% 147 243416 1.67% 148 366162 2.51% 149 688761 4.72% 150 3179075 21.78% 151 8392047 57.49% 14596759 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=36 prefix-density=0.28 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.15 sequence-density-rank=10 fanout-score=30.04 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=10.8 sequence=TTCTCATCAAGGT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=9.46 fanout-score-rank=8 prefix-density=0.39 prefix-fanout=6.3 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.17 sequence-density-rank=8 fanout-score=32.44 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=9.6 sequence=TGTTGGTGGTGG SRR7169002 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:05:34 Started mapping on | Feb 10 15:05:34 Finished on | Feb 10 15:06:47 Mapping speed, Million of reads per hour | 719.84 Number of input reads | 14596759 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13747504 Uniquely mapped reads % | 94.18% Average mapped length | 296.42 Number of splices: Total | 12623119 Number of splices: Annotated (sjdb) | 12415679 Number of splices: GT/AG | 12453959 Number of splices: GC/AG | 132447 Number of splices: AT/AC | 9683 Number of splices: Non-canonical | 27030 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 239566 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 80516 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 628187 628187 628187 N_multimapping 239566 239566 239566 N_noFeature 309147 13567108 375784 N_ambiguous 169475 811 55143 UnstrandedReadsAssigned:13268882 PositiveStrandReadsAssigned:179585 NegativeStrandReadsAssigned:13316577 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169002 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169002-trimmed-pair1.fastq SRR7169002-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,596,759 reads, 13,312,165 reads pseudoaligned [quant] estimated average fragment length: 268.28 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52401 SRR7169002.ke.tsv 34699 SRR7169002.se.tsv 87100 total ==> SRR7169002.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.72 251 10.4457 Potri.005G024800.1.v4.1 1035 767.72 21 1.99295 Potri.004G059700.1.v4.1 961 693.791 2 0.21003 Potri.007G009000.2.v4.1 1416 1148.72 0 0 Potri.003G141000.2.v4.1 2943 2675.72 195.027 5.31047 Potri.016G087400.1.v4.1 270 65.4036 933 1039.35 Potri.015G069301.1.v4.1 564 304.545 0 0 Potri.010G195200.1.v4.1 1773 1505.72 9 0.43549 Potri.012G127500.1.v4.1 977 709.75 2207 226.556 ==> SRR7169002.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1423 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169002 completed mapping pipeline successfully