Starting /dee2/code/volunteer_pipeline.sh SRR7169003 current disk space = 3059128086528 free memory = 1455958248 SRR7169003 SRAfilesize e7278e83a339f93b277655b762d07fa6 SRR7169003.sra SRR7169003.sra file validated SRR7169003 is paired end SRR7169003 is conventional basespace SRR7169003 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169003_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14525 34.0 34.0 34.0 33.0 34.0 2 33.52925 34.0 34.0 34.0 33.0 34.0 3 33.5545 34.0 34.0 34.0 33.0 34.0 4 33.5755 34.0 34.0 34.0 33.0 34.0 5 33.5395 34.0 34.0 34.0 33.0 34.0 6 37.26625 38.0 38.0 38.0 36.0 38.0 7 37.4875 38.0 38.0 38.0 37.0 38.0 8 37.5 38.0 38.0 38.0 37.0 38.0 9 37.568 38.0 38.0 38.0 38.0 38.0 10-14 37.585750000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.57505 38.0 38.0 38.0 38.0 38.0 20-24 37.56465 38.0 38.0 38.0 38.0 38.0 25-29 37.530350000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.51345 38.0 38.0 38.0 37.8 38.0 35-39 37.415150000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.3861 38.0 38.0 38.0 37.0 38.0 45-49 37.365449999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.30585000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.25915 38.0 38.0 38.0 37.0 38.0 60-64 37.2396 38.0 38.0 38.0 36.2 38.0 65-69 37.172250000000005 38.0 38.0 38.0 36.4 38.0 70-74 37.174 38.0 38.0 38.0 36.0 38.0 75-79 37.06615000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.0341 38.0 38.0 38.0 36.0 38.0 85-89 36.9679 38.0 38.0 38.0 36.0 38.0 90-94 36.86995 38.0 38.0 38.0 35.4 38.0 95-99 36.719350000000006 38.0 38.0 38.0 35.0 38.0 100-104 36.6305 38.0 38.0 38.0 34.6 38.0 105-109 36.49175000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.3634 38.0 38.0 38.0 34.0 38.0 115-119 36.2547 38.0 38.0 38.0 34.0 38.0 120-124 36.03165 38.0 37.6 38.0 33.2 38.0 125-129 35.898199999999996 38.0 37.0 38.0 32.6 38.0 130-134 35.61065 38.0 36.4 38.0 31.6 38.0 135-139 35.4988 38.0 36.0 38.0 31.0 38.0 140-144 35.0697 38.0 36.0 38.0 29.4 38.0 145-149 34.4739 38.0 35.0 38.0 27.6 38.0 150-151 31.501875 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 0.0 17 2.0 18 3.0 19 2.0 20 1.0 21 4.0 22 8.0 23 8.0 24 9.0 25 10.0 26 9.0 27 17.0 28 22.0 29 30.0 30 26.0 31 59.0 32 54.0 33 75.0 34 113.0 35 224.0 36 512.0 37 2807.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.15357323872276 11.961479979726306 8.768373035985809 40.116573745565134 2 21.4 14.85 35.949999999999996 27.800000000000004 3 18.099999999999998 20.549999999999997 26.25 35.099999999999994 4 21.475 29.7 22.7 26.125 5 21.405351337834457 33.60840210052513 24.831207801950487 20.155038759689923 6 18.95 37.3 25.224999999999998 18.525 7 14.75 26.450000000000003 41.8 17.0 8 18.45 25.874999999999996 30.675 25.0 9 16.325 24.925 34.175 24.575 10-14 19.25 30.570000000000004 26.979999999999997 23.200000000000003 15-19 20.085 28.999999999999996 27.345000000000002 23.57 20-24 20.39 29.13 26.979999999999997 23.5 25-29 19.665 29.404999999999998 27.505000000000003 23.425 30-34 19.935 28.82 27.425 23.82 35-39 20.07 29.304999999999996 26.88 23.745 40-44 20.635 28.89 26.895000000000003 23.580000000000002 45-49 20.61 28.375 27.415 23.599999999999998 50-54 20.48 28.799999999999997 27.339999999999996 23.380000000000003 55-59 19.935 28.82 27.315 23.93 60-64 20.235 28.095 27.33 24.34 65-69 21.065 28.54 27.01 23.385 70-74 20.165 28.575 27.500000000000004 23.76 75-79 20.19 27.92 27.61 24.279999999999998 80-84 20.07 28.84 27.235 23.855 85-89 20.544999999999998 27.560000000000002 27.939999999999998 23.955000000000002 90-94 20.01 28.9 27.235 23.855 95-99 21.035 27.715 27.150000000000002 24.099999999999998 100-104 20.53 28.694999999999997 27.029999999999998 23.745 105-109 20.4 27.634999999999998 28.015 23.95 110-114 20.015 28.155 27.765 24.065 115-119 20.794999999999998 28.24 27.37 23.595 120-124 20.1 28.189999999999998 27.98 23.73 125-129 20.880000000000003 27.74 27.67 23.71 130-134 20.979999999999997 28.02 27.439999999999998 23.56 135-139 20.395 27.694999999999997 28.16 23.75 140-144 20.57 27.735 28.035 23.66 145-149 20.515 27.589999999999996 27.575 24.32 150-151 20.474999999999998 28.275 27.3375 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 2.0 24 3.5 25 2.5 26 4.0 27 6.5 28 9.5 29 11.5 30 17.0 31 23.5 32 30.0 33 39.0 34 63.5 35 85.0 36 95.0 37 105.5 38 125.0 39 143.5 40 164.0 41 205.5 42 237.0 43 259.5 44 256.5 45 254.0 46 265.5 47 247.0 48 232.5 49 228.0 50 205.5 51 158.0 52 123.0 53 111.0 54 78.5 55 51.5 56 40.0 57 30.0 58 22.0 59 16.0 60 13.0 61 8.0 62 3.5 63 4.0 64 6.0 65 4.0 66 2.0 67 1.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.3875000000000002 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.8250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169003 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169003_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07125 33.0 33.0 34.0 32.0 34.0 2 33.17125 34.0 33.0 34.0 33.0 34.0 3 33.1845 34.0 33.0 34.0 33.0 34.0 4 33.2025 34.0 33.0 34.0 33.0 34.0 5 33.175 34.0 33.0 34.0 33.0 34.0 6 37.4045 38.0 38.0 38.0 38.0 38.0 7 37.52075 38.0 38.0 38.0 38.0 38.0 8 37.52025 38.0 38.0 38.0 38.0 38.0 9 37.50075 38.0 38.0 38.0 38.0 38.0 10-14 37.42399999999999 38.0 38.0 38.0 37.4 38.0 15-19 37.35145 38.0 38.0 38.0 37.4 38.0 20-24 37.320299999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.304950000000005 38.0 38.0 38.0 37.2 38.0 30-34 37.3538 38.0 38.0 38.0 37.0 38.0 35-39 37.3009 38.0 38.0 38.0 37.0 38.0 40-44 37.24035 38.0 38.0 38.0 37.0 38.0 45-49 37.232749999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.1572 38.0 38.0 38.0 37.0 38.0 55-59 37.15735000000001 38.0 38.0 38.0 36.6 38.0 60-64 37.10815 38.0 38.0 38.0 36.6 38.0 65-69 37.06415 38.0 38.0 38.0 36.0 38.0 70-74 36.9745 38.0 38.0 38.0 36.0 38.0 75-79 36.936350000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.83685 38.0 38.0 38.0 35.8 38.0 85-89 36.73075 38.0 38.0 38.0 35.2 38.0 90-94 36.591300000000004 38.0 38.0 38.0 34.8 38.0 95-99 36.55335 38.0 38.0 38.0 34.2 38.0 100-104 36.449 38.0 38.0 38.0 34.2 38.0 105-109 36.245 38.0 38.0 38.0 34.0 38.0 110-114 36.0916 38.0 38.0 38.0 33.6 38.0 115-119 35.9246 38.0 37.4 38.0 32.8 38.0 120-124 35.7399 38.0 37.0 38.0 31.0 38.0 125-129 35.61129999999999 38.0 36.8 38.0 31.4 38.0 130-134 35.097500000000004 38.0 36.0 38.0 29.2 38.0 135-139 34.82185 38.0 35.6 38.0 27.8 38.0 140-144 34.4287 38.0 35.0 38.0 26.2 38.0 145-149 33.82015 38.0 34.2 38.0 21.6 38.0 150-151 29.664125 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 2.0 17 5.0 18 3.0 19 3.0 20 5.0 21 3.0 22 13.0 23 16.0 24 8.0 25 13.0 26 19.0 27 12.0 28 29.0 29 36.0 30 43.0 31 48.0 32 62.0 33 85.0 34 138.0 35 230.0 36 542.0 37 2673.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.375 22.1 12.625 29.9 2 26.55155155155155 26.676676676676674 31.756756756756754 15.015015015015015 3 20.240480961923847 28.481963927855713 30.26052104208417 21.017034068136272 4 23.741547708489858 33.63385925369396 23.39093413473579 19.233658903080393 5 24.36764337590784 36.438767843726524 22.564487853744055 16.629100926621586 6 19.279819954988746 39.75993998499625 22.73068267066767 18.229557389347338 7 20.275000000000002 21.175 39.85 18.7 8 22.230557639409852 24.15603900975244 28.00700175043761 25.6064016004001 9 20.674999999999997 24.75 31.874999999999996 22.7 10-14 22.496749024707412 28.83865159547864 26.738021406421925 21.926577973392018 15-19 22.74274274274274 28.043043043043042 27.847847847847845 21.366366366366364 20-24 22.76365819491695 28.051831098659196 27.431458875325195 21.75305183109866 25-29 22.8375606583621 27.565160838461157 28.060433238281057 21.536845264895693 30-34 22.226113056528263 27.838919459729865 28.349174587293646 21.585792896448226 35-39 23.191233863704593 27.824477133993796 27.37916541579105 21.605123586510558 40-44 23.167742258242033 27.440092050627847 27.980389214067735 21.411776477062382 45-49 22.929904437884623 28.308400460299193 27.65797768549557 21.10371741632061 50-54 22.6029110188566 28.2798979642875 27.959785925073778 21.157405091782124 55-59 23.275473963283478 27.957580911410133 27.507378320244108 21.259566805062278 60-64 23.193916349809886 28.176906143686214 27.936762057234343 20.69241544926956 65-69 23.719231538923356 27.996798078847306 27.86171703021813 20.422253352011207 70-74 23.723979183346678 27.942353883106485 27.73218574859888 20.60148118494796 75-79 23.180067043578326 28.043228098263874 27.798068744684045 20.97863611347376 80-84 23.53912347408445 28.056834100460275 27.62157294376626 20.782469481689013 85-89 23.41936774709884 27.991196478591434 28.031212484994 20.558223289315727 90-94 23.84430658395037 28.457074244546725 27.481488893336003 20.217130278166902 95-99 23.935771096993648 27.36231304086839 27.952578660397176 20.749337201740783 100-104 24.019607843137255 27.40096038415366 28.13625450180072 20.443177270908365 105-109 23.704740948189638 27.91058211642328 27.510502100420087 20.874174834966993 110-114 23.803331165908066 28.39993997899265 27.39458810583704 20.402140749262244 115-119 24.111878314820373 27.138997298108674 28.249774842389673 20.499349544681277 120-124 24.013816579895874 27.558069683620346 28.11373648378054 20.314377252703245 125-129 23.70344413295955 27.918502202643168 27.352823388065676 21.025230276331598 130-134 24.114468681208727 27.791675005003004 27.676605963578147 20.417250350210125 135-139 23.69803391865526 27.80029015958777 27.550152583921157 20.95152333783581 140-144 24.141899329530673 28.38486940858601 26.923846692684876 20.54938456919844 145-149 24.266840156140525 28.185366830147135 27.044339905915322 20.503453107797018 150-151 23.74577755536094 27.761791567621668 27.27386463155261 21.218566245464782 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.5 28 5.0 29 8.0 30 12.5 31 17.5 32 22.0 33 33.5 34 43.5 35 56.0 36 75.0 37 102.0 38 145.0 39 179.5 40 194.0 41 218.0 42 253.5 43 269.5 44 300.5 45 301.0 46 266.5 47 256.5 48 247.5 49 216.0 50 165.5 51 142.5 52 125.5 53 93.5 54 71.5 55 54.0 56 34.0 57 25.5 58 19.0 59 13.5 60 9.0 61 2.0 62 1.5 63 5.5 64 4.5 65 1.0 66 1.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.2 4 0.17500000000000002 5 0.17500000000000002 6 0.025 7 0.0 8 0.025 9 0.0 10-14 0.03 15-19 0.1 20-24 0.06 25-29 0.055 30-34 0.05 35-39 0.06999999999999999 40-44 0.055 45-49 0.065 50-54 0.034999999999999996 55-59 0.045 60-64 0.06 65-69 0.06 70-74 0.08 75-79 0.065 80-84 0.06 85-89 0.04 90-94 0.06 95-99 0.045 100-104 0.04 105-109 0.02 110-114 0.034999999999999996 115-119 0.06999999999999999 120-124 0.12 125-129 0.12 130-134 0.06 135-139 0.055 140-144 0.06999999999999999 145-149 0.09 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.775 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.3624999999999998 0.0 0.0 0.0 0.0 136-137 1.575 0.0 0.0 0.0 0.0 138-139 1.7999999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACACG 10 0.006830828 145.0 8 TCCTACA 10 0.006830828 145.0 6 >>END_MODULE Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905642 spots for SRR7169003.sra Written 905642 spots for SRR7169003.sra Read 905654 spots for SRR7169003.sra Written 905654 spots for SRR7169003.sra SRR ids: ['SRR7169003.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jjlbhy4u SRR7169003.sra spots: 18112852 blocks: [[1, 905642], [905643, 1811284], [1811285, 2716926], [2716927, 3622568], [3622569, 4528210], [4528211, 5433852], [5433853, 6339494], [6339495, 7245136], [7245137, 8150778], [8150779, 9056420], [9056421, 9962062], [9962063, 10867704], [10867705, 11773346], [11773347, 12678988], [12678989, 13584630], [13584631, 14490272], [14490273, 15395914], [15395915, 16301556], [16301557, 17207198], [17207199, 18112852]] SRR7169003 file size 6116150 SRR7169003 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169003 SRR7169003_1.fastq SRR7169003_2.fastq Input file: SRR7169003_1.fastq Paired file: SRR7169003_2.fastq trimmed: SRR7169003-trimmed-pair1.fastq, SRR7169003-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:22:34 2025 >> started Mon Feb 10 15:22:55 2025 >> done (20.640s) 18112852 read pairs processed; of these: 12175 ( 0.07%) short read pairs filtered out after trimming by size control 9239 ( 0.05%) empty read pairs filtered out after trimming by size control 18091438 (99.88%) read pairs available; of these: 7163703 (39.60%) trimmed read pairs available after processing 10927735 (60.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 5 0.00% 22 5 0.00% 23 7 0.00% 24 3 0.00% 25 2 0.00% 26 5 0.00% 27 6 0.00% 28 7 0.00% 29 8 0.00% 30 7 0.00% 31 7 0.00% 32 6 0.00% 33 3 0.00% 34 3 0.00% 35 5 0.00% 36 6 0.00% 37 10 0.00% 38 8 0.00% 39 10 0.00% 40 7 0.00% 41 11 0.00% 42 10 0.00% 43 16 0.00% 44 11 0.00% 45 15 0.00% 46 26 0.00% 47 13 0.00% 48 20 0.00% 49 27 0.00% 50 23 0.00% 51 25 0.00% 52 22 0.00% 53 40 0.00% 54 39 0.00% 55 29 0.00% 56 26 0.00% 57 41 0.00% 58 37 0.00% 59 41 0.00% 60 54 0.00% 61 53 0.00% 62 62 0.00% 63 83 0.00% 64 85 0.00% 65 89 0.00% 66 134 0.00% 67 150 0.00% 68 146 0.00% 69 164 0.00% 70 219 0.00% 71 215 0.00% 72 221 0.00% 73 234 0.00% 74 270 0.00% 75 324 0.00% 76 379 0.00% 77 385 0.00% 78 439 0.00% 79 484 0.00% 80 549 0.00% 81 619 0.00% 82 811 0.00% 83 852 0.00% 84 1486 0.01% 85 1850 0.01% 86 1942 0.01% 87 2153 0.01% 88 2246 0.01% 89 2279 0.01% 90 2570 0.01% 91 2688 0.01% 92 2905 0.02% 93 3246 0.02% 94 3356 0.02% 95 3541 0.02% 96 3791 0.02% 97 4099 0.02% 98 4303 0.02% 99 4518 0.02% 100 4962 0.03% 101 5375 0.03% 102 5654 0.03% 103 6082 0.03% 104 6441 0.04% 105 7168 0.04% 106 7624 0.04% 107 8018 0.04% 108 8236 0.05% 109 8923 0.05% 110 9508 0.05% 111 9911 0.05% 112 10651 0.06% 113 11444 0.06% 114 12113 0.07% 115 13165 0.07% 116 13885 0.08% 117 14686 0.08% 118 16102 0.09% 119 16289 0.09% 120 17211 0.10% 121 18075 0.10% 122 19130 0.11% 123 20536 0.11% 124 22112 0.12% 125 23491 0.13% 126 25177 0.14% 127 27131 0.15% 128 28623 0.16% 129 30121 0.17% 130 32524 0.18% 131 35004 0.19% 132 37538 0.21% 133 40752 0.23% 134 43569 0.24% 135 47166 0.26% 136 51494 0.28% 137 55894 0.31% 138 60725 0.34% 139 66223 0.37% 140 73203 0.40% 141 81500 0.45% 142 92370 0.51% 143 106307 0.59% 144 123797 0.68% 145 150953 0.83% 146 186981 1.03% 147 255304 1.41% 148 387750 2.14% 149 775222 4.29% 150 3976985 21.98% 151 10927735 60.40% 18091438 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=42 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=47 fanout-score=139.26 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=11.5 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=35 prefix-density=0.27 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.14 sequence-density-rank=17 fanout-score=50.06 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=12.9 sequence=TGTTGGTGGTGG SRR7169003 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:23:38 Started mapping on | Feb 10 15:23:38 Finished on | Feb 10 15:25:14 Mapping speed, Million of reads per hour | 678.43 Number of input reads | 18091438 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17376131 Uniquely mapped reads % | 96.05% Average mapped length | 297.22 Number of splices: Total | 16435385 Number of splices: Annotated (sjdb) | 16176236 Number of splices: GT/AG | 16210839 Number of splices: GC/AG | 177163 Number of splices: AT/AC | 12907 Number of splices: Non-canonical | 34476 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316734 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 29546 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.01% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 410583 410583 410583 N_multimapping 316734 316734 316734 N_noFeature 388298 17177103 474561 N_ambiguous 182005 1002 68550 UnstrandedReadsAssigned:16805828 PositiveStrandReadsAssigned:198026 NegativeStrandReadsAssigned:16833020 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169003 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169003-trimmed-pair1.fastq SRR7169003-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,091,438 reads, 16,677,573 reads pseudoaligned [quant] estimated average fragment length: 270.07 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,260 rounds 52401 SRR7169003.ke.tsv 34699 SRR7169003.se.tsv 87100 total ==> SRR7169003.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.93 307 9.94947 Potri.005G024800.1.v4.1 1035 765.93 29 2.14607 Potri.004G059700.1.v4.1 961 692.072 3 0.245699 Potri.007G009000.2.v4.1 1416 1146.93 0 0 Potri.003G141000.2.v4.1 2943 2673.93 322.06 6.82685 Potri.016G087400.1.v4.1 270 64.1233 1662 1469.09 Potri.015G069301.1.v4.1 564 302.369 0 0 Potri.010G195200.1.v4.1 1773 1503.93 35 1.31909 Potri.012G127500.1.v4.1 977 707.999 3600 288.207 ==> SRR7169003.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1316 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169003 completed mapping pipeline successfully