Starting /dee2/code/volunteer_pipeline.sh SRR7169004 current disk space = 3059096121344 free memory = 1403757168 SRR7169004 SRAfilesize a8e655d5db6df2e0918bf89754fdbf37 SRR7169004.sra SRR7169004.sra file validated SRR7169004 is paired end SRR7169004 is conventional basespace SRR7169004 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169004_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91325 34.0 34.0 34.0 33.0 34.0 2 33.457 34.0 34.0 34.0 33.0 34.0 3 33.53025 34.0 34.0 34.0 33.0 34.0 4 33.57 34.0 34.0 34.0 33.0 34.0 5 33.558 34.0 34.0 34.0 33.0 34.0 6 37.2235 38.0 38.0 38.0 36.0 38.0 7 37.47075 38.0 38.0 38.0 37.0 38.0 8 37.49225 38.0 38.0 38.0 38.0 38.0 9 37.55275 38.0 38.0 38.0 38.0 38.0 10-14 37.57925 38.0 38.0 38.0 38.0 38.0 15-19 37.6192 38.0 38.0 38.0 38.0 38.0 20-24 37.6234 38.0 38.0 38.0 38.0 38.0 25-29 37.5428 38.0 38.0 38.0 38.0 38.0 30-34 37.536 38.0 38.0 38.0 38.0 38.0 35-39 37.4157 38.0 38.0 38.0 37.2 38.0 40-44 37.3399 38.0 38.0 38.0 37.0 38.0 45-49 37.3447 38.0 38.0 38.0 37.0 38.0 50-54 37.3231 38.0 38.0 38.0 37.0 38.0 55-59 37.2433 38.0 38.0 38.0 36.8 38.0 60-64 37.2039 38.0 38.0 38.0 37.0 38.0 65-69 37.231700000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.1498 38.0 38.0 38.0 36.0 38.0 75-79 37.06314999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.0363 38.0 38.0 38.0 36.0 38.0 85-89 36.92515 38.0 38.0 38.0 36.0 38.0 90-94 36.869099999999996 38.0 38.0 38.0 35.8 38.0 95-99 36.721000000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.63 38.0 38.0 38.0 35.0 38.0 105-109 36.5532 38.0 38.0 38.0 34.2 38.0 110-114 36.427200000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.2704 38.0 38.0 38.0 34.0 38.0 120-124 36.069050000000004 38.0 37.8 38.0 33.4 38.0 125-129 35.921499999999995 38.0 37.4 38.0 32.8 38.0 130-134 35.79575 38.0 37.0 38.0 32.0 38.0 135-139 35.63725 38.0 36.4 38.0 31.6 38.0 140-144 35.203 38.0 36.0 38.0 31.0 38.0 145-149 34.66394999999999 38.0 36.0 38.0 27.8 38.0 150-151 31.953375 37.0 33.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 2.0 13 3.0 14 3.0 15 1.0 16 1.0 17 1.0 18 0.0 19 3.0 20 3.0 21 2.0 22 4.0 23 11.0 24 4.0 25 15.0 26 10.0 27 24.0 28 24.0 29 21.0 30 33.0 31 45.0 32 49.0 33 74.0 34 101.0 35 211.0 36 488.0 37 2866.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.83036169128884 12.786551197147222 8.91492613346918 37.46816097809476 2 22.325 16.425 36.025 25.224999999999998 3 19.6 22.2 27.150000000000002 31.05 4 22.175 31.0 22.85 23.974999999999998 5 22.35 34.975 23.875 18.8 6 19.45 36.025 24.15 20.375 7 14.325 25.424999999999997 42.5 17.75 8 19.05 25.6 29.549999999999997 25.8 9 17.325 25.15 32.25 25.275 10-14 19.555 29.985 26.834999999999997 23.625 15-19 19.74 28.849999999999998 27.555000000000003 23.855 20-24 20.025000000000002 29.085 27.325 23.565 25-29 19.835 29.145 27.6 23.419999999999998 30-34 20.16 29.154999999999998 27.065 23.62 35-39 20.415 28.935 27.11 23.54 40-44 19.575 29.425 27.815 23.185 45-49 20.74 28.435 27.27 23.555 50-54 19.43 29.285 27.045 24.240000000000002 55-59 20.19 28.68 27.395000000000003 23.735 60-64 20.215 28.88 27.375 23.53 65-69 19.98 28.744999999999997 27.700000000000003 23.575 70-74 20.305 29.104999999999997 27.47 23.119999999999997 75-79 20.165 28.835 27.29 23.71 80-84 20.064999999999998 28.794999999999998 27.255000000000003 23.885 85-89 20.19 28.605000000000004 27.55 23.655 90-94 20.225 28.939999999999998 27.279999999999998 23.555 95-99 20.47 28.155 27.24 24.135 100-104 20.215 28.895 26.700000000000003 24.19 105-109 20.19 28.895 27.224999999999998 23.69 110-114 20.64 28.79 27.16 23.41 115-119 20.715 28.59 27.07 23.625 120-124 20.64 28.65 27.534999999999997 23.175 125-129 20.474999999999998 28.315 27.450000000000003 23.76 130-134 20.64 28.410000000000004 27.435 23.515 135-139 21.05 28.375 26.974999999999998 23.599999999999998 140-144 21.17 27.805000000000003 27.16 23.865 145-149 20.53 28.625 27.255000000000003 23.59 150-151 20.8625 28.6125 26.775 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 1.5 22 1.0 23 1.0 24 1.5 25 3.0 26 5.5 27 7.0 28 10.5 29 20.0 30 27.0 31 29.0 32 33.5 33 48.0 34 54.5 35 66.5 36 97.0 37 110.0 38 121.0 39 145.0 40 178.0 41 212.0 42 230.5 43 261.0 44 293.5 45 275.5 46 263.5 47 260.0 48 227.5 49 194.0 50 175.5 51 143.5 52 112.5 53 102.5 54 78.0 55 55.5 56 43.5 57 32.0 58 20.0 59 11.5 60 10.0 61 9.5 62 6.5 63 5.5 64 3.0 65 2.0 66 1.0 67 0.5 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.1749999999999998 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCCCC 10 0.006830828 145.0 145 >>END_MODULE SRR7169004 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169004_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0605 33.0 33.0 34.0 32.0 34.0 2 33.1955 34.0 33.0 34.0 33.0 34.0 3 33.19475 34.0 33.0 34.0 33.0 34.0 4 33.20575 34.0 33.0 34.0 33.0 34.0 5 33.18875 34.0 33.0 34.0 33.0 34.0 6 37.4675 38.0 38.0 38.0 37.0 38.0 7 37.433 38.0 38.0 38.0 38.0 38.0 8 37.4335 38.0 38.0 38.0 38.0 38.0 9 37.45825 38.0 38.0 38.0 38.0 38.0 10-14 37.379450000000006 38.0 38.0 38.0 37.4 38.0 15-19 37.36755 38.0 38.0 38.0 37.2 38.0 20-24 37.3092 38.0 38.0 38.0 37.0 38.0 25-29 37.3192 38.0 38.0 38.0 37.0 38.0 30-34 37.3527 38.0 38.0 38.0 37.0 38.0 35-39 37.2746 38.0 38.0 38.0 37.0 38.0 40-44 37.241600000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.21485 38.0 38.0 38.0 37.0 38.0 50-54 37.1695 38.0 38.0 38.0 37.0 38.0 55-59 37.160900000000005 38.0 38.0 38.0 36.6 38.0 60-64 37.128 38.0 38.0 38.0 36.6 38.0 65-69 37.06225 38.0 38.0 38.0 36.0 38.0 70-74 36.99425 38.0 38.0 38.0 36.0 38.0 75-79 36.9849 38.0 38.0 38.0 36.0 38.0 80-84 36.90685 38.0 38.0 38.0 36.0 38.0 85-89 36.811699999999995 38.0 38.0 38.0 35.4 38.0 90-94 36.6877 38.0 38.0 38.0 35.0 38.0 95-99 36.581999999999994 38.0 38.0 38.0 34.2 38.0 100-104 36.489 38.0 38.0 38.0 34.0 38.0 105-109 36.31325 38.0 38.0 38.0 34.0 38.0 110-114 36.217349999999996 38.0 38.0 38.0 34.0 38.0 115-119 35.97825 38.0 37.6 38.0 33.0 38.0 120-124 35.7484 38.0 37.0 38.0 31.6 38.0 125-129 35.67809999999999 38.0 36.8 38.0 31.8 38.0 130-134 35.181650000000005 38.0 36.0 38.0 29.4 38.0 135-139 34.82525 38.0 35.6 38.0 27.8 38.0 140-144 34.4651 38.0 35.0 38.0 26.2 38.0 145-149 33.769349999999996 38.0 34.2 38.0 22.4 38.0 150-151 29.6115 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 2.0 13 0.0 14 2.0 15 2.0 16 1.0 17 3.0 18 5.0 19 4.0 20 1.0 21 8.0 22 9.0 23 14.0 24 10.0 25 12.0 26 13.0 27 21.0 28 34.0 29 39.0 30 42.0 31 43.0 32 77.0 33 76.0 34 129.0 35 191.0 36 590.0 37 2667.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.85 21.5 12.275 28.375 2 26.738369184592298 25.26263131565783 31.44072036018009 16.558279139569784 3 20.23511755877939 28.91445722861431 30.540270135067534 20.31015507753877 4 23.686843421710854 34.04202101050525 22.786393196598297 19.484742371185593 5 23.336668334167083 36.39319659829915 22.56128064032016 17.70885442721361 6 19.775000000000002 38.15 23.9 18.175 7 19.5 21.45 38.125 20.925 8 22.50562640660165 24.956239059764943 28.232058014503625 24.306076519129782 9 22.675 23.3 30.75 23.275000000000002 10-14 23.869773954790958 28.080616123224644 25.71514302860572 22.334466893378675 15-19 22.87143571785893 28.289144572286144 27.088544272136065 21.750875437718857 20-24 23.271981594478344 28.26347904371311 27.558267480244076 20.90627188156447 25-29 22.964185674269707 28.416366546618647 27.591036414565828 21.028411364545818 30-34 23.025756439109777 28.11202800700175 27.651912978244564 21.21030257564391 35-39 22.779111644657863 27.566026410564227 28.15126050420168 21.50360144057623 40-44 22.868003801330467 27.779722903016058 28.064822687940776 21.2874506077127 45-49 23.362008602580776 27.6332899869961 27.798339501850556 21.20636190857257 50-54 23.328499274891236 27.954193128969347 27.619142871430714 21.098164724708706 55-59 23.26698009402821 27.34320296088827 28.193458037411222 21.196358907672302 60-64 22.914165666266506 27.310924369747898 29.141656662665067 20.63325330132053 65-69 23.298154354023907 28.14485069774421 28.18486470264593 20.372130245585954 70-74 24.044617847138856 27.581032412965182 27.77611044417767 20.598239295718287 75-79 23.659463785514205 27.21588635454182 28.061224489795915 21.06342537014806 80-84 23.221966589976994 27.378213464039213 28.19845953786136 21.201360408122436 85-89 23.552065619685905 27.74332299689907 28.08342502750825 20.621186355906772 90-94 23.67210163048915 27.418225467640294 27.96338901670501 20.94628388516555 95-99 23.275818954738682 27.45686421605401 28.152038009502377 21.115278819704926 100-104 24.006001500375092 27.47686921730433 27.636909227306827 20.880220055013755 105-109 23.402340234023402 27.552755275527552 28.102810281028102 20.94209420942094 110-114 23.399679935987198 27.785557111422282 28.050610122024406 20.76415283056611 115-119 23.139255702280913 28.211284513805523 27.886154461784713 20.763305322128854 120-124 23.640638287229255 27.18723425541494 28.017607923565606 21.154519533790207 125-129 24.25712856428214 27.423711855927962 27.18359179589795 21.135567783891947 130-134 23.622086625987794 27.128138441532464 28.063419025707713 21.186355906772032 135-139 24.027208162448733 27.718315494648394 27.533259977993396 20.721216364909473 140-144 24.26970788315326 27.425970388155264 27.866146458583437 20.438175270108044 145-149 24.34352023208123 27.97979292752463 27.659680888310913 20.017005952083228 150-151 24.634237839189694 26.5474552957359 27.235213204951858 21.583093660122547 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 1.0 26 1.5 27 3.5 28 3.5 29 7.5 30 10.5 31 8.5 32 21.0 33 36.0 34 46.5 35 60.0 36 72.5 37 100.0 38 122.0 39 143.5 40 184.0 41 232.0 42 270.0 43 282.0 44 294.5 45 291.5 46 272.0 47 260.5 48 240.0 49 206.5 50 177.0 51 144.0 52 122.5 53 105.5 54 75.0 55 52.5 56 39.5 57 30.0 58 19.0 59 16.0 60 12.5 61 5.0 62 4.5 63 6.5 64 4.0 65 1.5 66 1.5 67 1.5 68 1.5 69 1.5 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.02 15-19 0.05 20-24 0.03 25-29 0.04 30-34 0.025 35-39 0.04 40-44 0.034999999999999996 45-49 0.03 50-54 0.015 55-59 0.03 60-64 0.04 65-69 0.034999999999999996 70-74 0.04 75-79 0.04 80-84 0.03 85-89 0.03 90-94 0.03 95-99 0.025 100-104 0.025 105-109 0.01 110-114 0.02 115-119 0.04 120-124 0.045 125-129 0.05 130-134 0.03 135-139 0.03 140-144 0.04 145-149 0.034999999999999996 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.675 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.0750000000000002 0.0 0.0 0.0 0.0 130-131 1.1749999999999998 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.6124999999999998 0.0 0.0 0.0 0.0 138-139 1.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748510 spots for SRR7169004.sra Written 748510 spots for SRR7169004.sra Read 748512 spots for SRR7169004.sra Written 748512 spots for SRR7169004.sra SRR ids: ['SRR7169004.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_api2riuq SRR7169004.sra spots: 14970202 blocks: [[1, 748510], [748511, 1497020], [1497021, 2245530], [2245531, 2994040], [2994041, 3742550], [3742551, 4491060], [4491061, 5239570], [5239571, 5988080], [5988081, 6736590], [6736591, 7485100], [7485101, 8233610], [8233611, 8982120], [8982121, 9730630], [9730631, 10479140], [10479141, 11227650], [11227651, 11976160], [11976161, 12724670], [12724671, 13473180], [13473181, 14221690], [14221691, 14970202]] SRR7169004 file size 5051209 SRR7169004 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169004 SRR7169004_1.fastq SRR7169004_2.fastq Input file: SRR7169004_1.fastq Paired file: SRR7169004_2.fastq trimmed: SRR7169004-trimmed-pair1.fastq, SRR7169004-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:33:13 2025 >> started Mon Feb 10 15:33:32 2025 >> done (19.099s) 14970202 read pairs processed; of these: 11713 ( 0.08%) short read pairs filtered out after trimming by size control 7812 ( 0.05%) empty read pairs filtered out after trimming by size control 14950677 (99.87%) read pairs available; of these: 5871584 (39.27%) trimmed read pairs available after processing 9079093 (60.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 3 0.00% 21 7 0.00% 22 3 0.00% 23 4 0.00% 24 5 0.00% 25 4 0.00% 26 4 0.00% 27 3 0.00% 28 5 0.00% 29 6 0.00% 30 5 0.00% 31 6 0.00% 32 3 0.00% 33 1 0.00% 34 6 0.00% 35 5 0.00% 36 3 0.00% 37 5 0.00% 38 6 0.00% 39 3 0.00% 40 11 0.00% 41 10 0.00% 42 10 0.00% 43 9 0.00% 44 8 0.00% 45 12 0.00% 46 16 0.00% 47 6 0.00% 48 13 0.00% 49 17 0.00% 50 11 0.00% 51 14 0.00% 52 19 0.00% 53 14 0.00% 54 22 0.00% 55 37 0.00% 56 36 0.00% 57 30 0.00% 58 31 0.00% 59 31 0.00% 60 48 0.00% 61 70 0.00% 62 52 0.00% 63 73 0.00% 64 55 0.00% 65 67 0.00% 66 92 0.00% 67 91 0.00% 68 113 0.00% 69 113 0.00% 70 144 0.00% 71 152 0.00% 72 160 0.00% 73 197 0.00% 74 191 0.00% 75 273 0.00% 76 265 0.00% 77 318 0.00% 78 311 0.00% 79 382 0.00% 80 428 0.00% 81 489 0.00% 82 583 0.00% 83 644 0.00% 84 1167 0.01% 85 1525 0.01% 86 1633 0.01% 87 1680 0.01% 88 1754 0.01% 89 1881 0.01% 90 1946 0.01% 91 2138 0.01% 92 2332 0.02% 93 2452 0.02% 94 2604 0.02% 95 2771 0.02% 96 2845 0.02% 97 3116 0.02% 98 3294 0.02% 99 3564 0.02% 100 3808 0.03% 101 4159 0.03% 102 4437 0.03% 103 4760 0.03% 104 5113 0.03% 105 5589 0.04% 106 5830 0.04% 107 6305 0.04% 108 6416 0.04% 109 7092 0.05% 110 7534 0.05% 111 8142 0.05% 112 8524 0.06% 113 9284 0.06% 114 9868 0.07% 115 10619 0.07% 116 11420 0.08% 117 12137 0.08% 118 12735 0.09% 119 13317 0.09% 120 13786 0.09% 121 14743 0.10% 122 15755 0.11% 123 17038 0.11% 124 18182 0.12% 125 19321 0.13% 126 20971 0.14% 127 22094 0.15% 128 23452 0.16% 129 25037 0.17% 130 26487 0.18% 131 28369 0.19% 132 31113 0.21% 133 33751 0.23% 134 36530 0.24% 135 39331 0.26% 136 42770 0.29% 137 46485 0.31% 138 50496 0.34% 139 54691 0.37% 140 60792 0.41% 141 67059 0.45% 142 75906 0.51% 143 87347 0.58% 144 102347 0.68% 145 124038 0.83% 146 154217 1.03% 147 209529 1.40% 148 316999 2.12% 149 630535 4.22% 150 3262857 21.82% 151 9079093 60.73% 14950677 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=39 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=6 fanout-score=31.20 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=11.1 sequence=TTCTCATCAAGGT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.64 fanout-score-rank=15 prefix-density=0.34 prefix-fanout=4.0 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=44 fanout-score=45.03 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=6.3 sequence=CTCTTCTTTTCTCCCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTGGATGAAGTGAGAGCCAGTGACTACAGCACATGCACTACAGGCAATGCAATCACTTCAGATAGCAGTGGTGCTACCACAATAGCCCTCAAGACTGCCGGAACTCATTATTTCATTTGTGGTGTTCCTGGCCACTGTGGGAGTGGCATGAAGGTTGCAGTCACTGTTGCAGCAGCAGGATCGAGCACAAGTCCCTCCTCCGGAACTCCATCTTCTGATGGCACTACCACTTCTCCGGCCGGTAGTAACGTCACCAATTACAAGCCTTCATCCAACAACGTACCCGATTCATC SRR7169004 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:34:29 Started mapping on | Feb 10 15:34:29 Finished on | Feb 10 15:35:42 Mapping speed, Million of reads per hour | 737.29 Number of input reads | 14950677 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 13828917 Uniquely mapped reads % | 92.50% Average mapped length | 289.22 Number of splices: Total | 12382830 Number of splices: Annotated (sjdb) | 12192466 Number of splices: GT/AG | 12216432 Number of splices: GC/AG | 132009 Number of splices: AT/AC | 9525 Number of splices: Non-canonical | 24864 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 246030 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 31331 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.61% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 889353 889353 889353 N_multimapping 246030 246030 246030 N_noFeature 312324 13667581 370227 N_ambiguous 172843 912 68756 UnstrandedReadsAssigned:13343750 PositiveStrandReadsAssigned:160424 NegativeStrandReadsAssigned:13389934 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169004 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169004-trimmed-pair1.fastq SRR7169004-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,950,677 reads, 13,698,065 reads pseudoaligned [quant] estimated average fragment length: 260.733 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7169004.ke.tsv 34699 SRR7169004.se.tsv 87100 total ==> SRR7169004.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.27 268 10.9516 Potri.005G024800.1.v4.1 1035 775.267 26 2.40963 Potri.004G059700.1.v4.1 961 701.321 3 0.30735 Potri.007G009000.2.v4.1 1416 1156.27 0 0 Potri.003G141000.2.v4.1 2943 2683.27 193.076 5.17004 Potri.016G087400.1.v4.1 270 68.4312 1133 1189.61 Potri.015G069301.1.v4.1 564 310.516 0 0 Potri.010G195200.1.v4.1 1773 1513.27 6 0.284882 Potri.012G127500.1.v4.1 977 717.297 3563 356.899 ==> SRR7169004.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1507 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 209 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169004 completed mapping pipeline successfully