Starting /dee2/code/volunteer_pipeline.sh SRR7169005 current disk space = 3059123650560 free memory = 1206737500 SRR7169005 SRAfilesize c30d521adb955f2fdb9e27531f19f97c SRR7169005.sra SRR7169005.sra file validated SRR7169005 is paired end SRR7169005 is conventional basespace SRR7169005 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169005_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.62675 34.0 34.0 34.0 33.0 34.0 2 33.737 34.0 34.0 34.0 33.0 34.0 3 33.753 34.0 34.0 34.0 33.0 34.0 4 33.74925 34.0 34.0 34.0 33.0 34.0 5 33.7375 34.0 34.0 34.0 33.0 34.0 6 37.5155 38.0 38.0 38.0 37.0 38.0 7 37.6825 38.0 38.0 38.0 38.0 38.0 8 37.75475 38.0 38.0 38.0 38.0 38.0 9 37.59675 38.0 38.0 38.0 38.0 38.0 10-14 37.753949999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.77625 38.0 38.0 38.0 38.0 38.0 20-24 37.760000000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.7173 38.0 38.0 38.0 38.0 38.0 30-34 37.713350000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.641000000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.498749999999994 38.0 38.0 38.0 37.8 38.0 45-49 37.4726 38.0 38.0 38.0 37.8 38.0 50-54 37.4433 38.0 38.0 38.0 37.2 38.0 55-59 37.4169 38.0 38.0 38.0 37.0 38.0 60-64 37.39065 38.0 38.0 38.0 37.0 38.0 65-69 37.353649999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.32905 38.0 38.0 38.0 37.0 38.0 75-79 37.2034 38.0 38.0 38.0 37.0 38.0 80-84 37.123200000000004 38.0 38.0 38.0 36.4 38.0 85-89 37.1014 38.0 38.0 38.0 36.2 38.0 90-94 37.053000000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.97665 38.0 38.0 38.0 36.0 38.0 100-104 36.8488 38.0 38.0 38.0 35.6 38.0 105-109 36.7703 38.0 38.0 38.0 35.0 38.0 110-114 36.599450000000004 38.0 38.0 38.0 34.6 38.0 115-119 36.5163 38.0 38.0 38.0 34.4 38.0 120-124 36.29995 38.0 38.0 38.0 34.0 38.0 125-129 36.06255 38.0 37.6 38.0 33.6 38.0 130-134 35.93385 38.0 37.6 38.0 33.0 38.0 135-139 35.809000000000005 38.0 37.0 38.0 33.0 38.0 140-144 35.5764 38.0 36.0 38.0 32.0 38.0 145-149 35.13545 38.0 36.0 38.0 31.2 38.0 150-151 31.9715 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 3.0 16 2.0 17 0.0 18 1.0 19 0.0 20 6.0 21 3.0 22 3.0 23 0.0 24 3.0 25 10.0 26 14.0 27 14.0 28 17.0 29 22.0 30 21.0 31 23.0 32 49.0 33 55.0 34 89.0 35 178.0 36 463.0 37 3018.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.89167502507522 15.57171514543631 11.283851554663991 34.25275827482447 2 23.011505752876438 15.907953976988495 32.86643321660831 28.214107053526767 3 18.75 20.75 27.200000000000003 33.300000000000004 4 20.4 28.349999999999998 24.349999999999998 26.900000000000002 5 22.15 30.349999999999998 25.05 22.45 6 20.349999999999998 32.550000000000004 25.95 21.15 7 14.35 28.1 38.925 18.625 8 17.75 29.375 29.325000000000003 23.549999999999997 9 16.475 28.725 32.85 21.95 10-14 19.31 30.435000000000002 27.58 22.675 15-19 19.545 29.770000000000003 27.52 23.165 20-24 19.445 30.165 27.365000000000002 23.025000000000002 25-29 18.915000000000003 29.985 27.055 24.044999999999998 30-34 18.96 30.04 27.474999999999998 23.525 35-39 19.29 29.785 27.355 23.57 40-44 19.39 30.135 26.965 23.51 45-49 19.36 29.925 27.185 23.53 50-54 19.675 29.39 27.634999999999998 23.3 55-59 19.66 29.595 27.139999999999997 23.605 60-64 20.03 29.985 26.715 23.27 65-69 19.865 28.970000000000002 27.68 23.485 70-74 19.77 29.439999999999998 27.389999999999997 23.400000000000002 75-79 19.845 29.32 27.305 23.53 80-84 19.605 29.62 27.48 23.294999999999998 85-89 19.79 29.28 27.544999999999998 23.385 90-94 20.36 28.79 27.025 23.825 95-99 19.325 29.2 27.21 24.265 100-104 19.515 29.555 27.125 23.805 105-109 20.66 28.53 27.389999999999997 23.419999999999998 110-114 19.85 28.77 27.205000000000002 24.175 115-119 19.97 29.294999999999998 26.939999999999998 23.794999999999998 120-124 20.285 29.34 27.185 23.189999999999998 125-129 20.645 28.715000000000003 27.134999999999998 23.505000000000003 130-134 20.86 28.62 26.900000000000002 23.62 135-139 20.41 28.189999999999998 27.134999999999998 24.265 140-144 20.54 28.175 27.33 23.955000000000002 145-149 20.72 28.67 27.025 23.585 150-151 20.674999999999997 28.8375 26.25 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.5 22 2.0 23 3.0 24 5.0 25 7.0 26 10.0 27 14.5 28 19.0 29 25.0 30 35.5 31 45.0 32 57.5 33 71.5 34 83.5 35 100.0 36 112.5 37 127.0 38 150.0 39 170.5 40 183.0 41 193.5 42 219.5 43 236.5 44 236.0 45 232.5 46 222.0 47 208.0 48 208.0 49 191.0 50 153.5 51 132.5 52 117.0 53 99.5 54 79.0 55 63.5 56 43.5 57 29.5 58 24.5 59 18.0 60 15.0 61 12.0 62 10.0 63 7.5 64 4.0 65 3.5 66 3.0 67 1.5 68 1.5 69 2.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.2 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.4625 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 1.975 0.0 0.0 0.0 0.0 134-135 2.125 0.0 0.0 0.0 0.0 136-137 2.375 0.0 0.0 0.0 0.0 138-139 2.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTGT 10 0.006830828 145.0 1 >>END_MODULE SRR7169005 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169005_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16475 34.0 33.0 34.0 33.0 34.0 2 33.17875 34.0 33.0 34.0 33.0 34.0 3 33.23725 34.0 33.0 34.0 33.0 34.0 4 33.271 34.0 33.0 34.0 33.0 34.0 5 33.2255 34.0 33.0 34.0 33.0 34.0 6 37.39025 38.0 38.0 38.0 38.0 38.0 7 37.4155 38.0 38.0 38.0 38.0 38.0 8 37.43175 38.0 38.0 38.0 38.0 38.0 9 37.426 38.0 38.0 38.0 38.0 38.0 10-14 37.32645 38.0 38.0 38.0 38.0 38.0 15-19 37.2668 38.0 38.0 38.0 37.6 38.0 20-24 37.26205 38.0 38.0 38.0 38.0 38.0 25-29 37.22605 38.0 38.0 38.0 38.0 38.0 30-34 37.22215 38.0 38.0 38.0 38.0 38.0 35-39 37.18635 38.0 38.0 38.0 38.0 38.0 40-44 37.13935 38.0 38.0 38.0 37.6 38.0 45-49 37.102000000000004 38.0 38.0 38.0 37.2 38.0 50-54 37.0458 38.0 38.0 38.0 37.0 38.0 55-59 37.02755 38.0 38.0 38.0 37.0 38.0 60-64 36.959799999999994 38.0 38.0 38.0 36.8 38.0 65-69 36.89795 38.0 38.0 38.0 37.0 38.0 70-74 36.86065 38.0 38.0 38.0 36.6 38.0 75-79 36.778 38.0 38.0 38.0 36.0 38.0 80-84 36.68475 38.0 38.0 38.0 36.0 38.0 85-89 36.6055 38.0 38.0 38.0 35.8 38.0 90-94 36.507850000000005 38.0 38.0 38.0 35.6 38.0 95-99 36.3717 38.0 38.0 38.0 34.6 38.0 100-104 36.294599999999996 38.0 38.0 38.0 34.4 38.0 105-109 36.12325 38.0 38.0 38.0 34.0 38.0 110-114 35.9647 38.0 38.0 38.0 33.6 38.0 115-119 35.804 38.0 38.0 38.0 33.4 38.0 120-124 35.40745 38.0 37.2 38.0 30.2 38.0 125-129 35.2512 38.0 37.0 38.0 30.6 38.0 130-134 35.0165 38.0 36.4 38.0 29.6 38.0 135-139 34.5166 38.0 36.0 38.0 26.4 38.0 140-144 34.0363 38.0 34.6 38.0 23.6 38.0 145-149 33.25935 38.0 33.4 38.0 17.0 38.0 150-151 29.338 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 5.0 4 5.0 5 1.0 6 3.0 7 0.0 8 4.0 9 1.0 10 2.0 11 6.0 12 3.0 13 1.0 14 2.0 15 2.0 16 0.0 17 2.0 18 9.0 19 8.0 20 14.0 21 7.0 22 11.0 23 7.0 24 17.0 25 15.0 26 9.0 27 25.0 28 22.0 29 24.0 30 33.0 31 40.0 32 48.0 33 78.0 34 103.0 35 199.0 36 483.0 37 2801.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.75943985996499 22.50562640660165 15.57889472368092 24.15603900975244 2 27.1 26.35 29.849999999999998 16.7 3 22.35 29.975 28.625 19.05 4 23.575 34.65 23.025000000000002 18.75 5 24.425 34.849999999999994 23.35 17.375 6 21.65 36.575 23.025000000000002 18.75 7 20.3 21.4 37.75 20.549999999999997 8 22.5 25.5 27.400000000000002 24.6 9 21.925 27.400000000000002 27.85 22.825 10-14 24.15 28.16 26.19 21.5 15-19 23.75 28.544999999999998 27.04 20.665 20-24 23.369999999999997 27.884999999999998 28.09 20.655 25-29 23.815 28.050000000000004 26.950000000000003 21.185000000000002 30-34 24.255 28.22 26.99 20.535 35-39 24.125 27.744999999999997 27.284999999999997 20.845 40-44 24.505 27.565 27.305 20.625 45-49 23.49 27.584999999999997 27.605 21.32 50-54 24.235 28.43 26.595000000000002 20.74 55-59 24.345 27.889999999999997 26.790000000000003 20.974999999999998 60-64 23.47 27.810000000000002 27.785 20.935000000000002 65-69 23.77 27.445000000000004 27.595 21.19 70-74 24.21 27.794999999999998 27.584999999999997 20.41 75-79 23.305 27.85 27.700000000000003 21.145 80-84 24.125 27.925 27.224999999999998 20.724999999999998 85-89 23.71 27.865000000000002 27.665 20.76 90-94 23.54 27.755000000000003 27.96 20.745 95-99 23.575 27.634999999999998 27.985 20.805 100-104 24.044999999999998 27.11 28.21 20.635 105-109 24.04 27.389999999999997 27.785 20.785 110-114 24.154999999999998 27.525 27.96 20.36 115-119 23.875 27.284999999999997 28.58 20.26 120-124 23.68 28.07 28.04 20.21 125-129 23.715 27.98 27.800000000000004 20.505000000000003 130-134 23.96 27.200000000000003 28.18 20.66 135-139 23.49 27.185 27.889999999999997 21.435000000000002 140-144 23.87 27.450000000000003 28.175 20.505000000000003 145-149 24.11 27.865000000000002 27.91 20.115 150-151 25.1 27.537499999999998 27.650000000000002 19.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 2.0 25 2.0 26 1.5 27 2.0 28 3.5 29 9.0 30 13.0 31 12.5 32 23.0 33 30.0 34 34.5 35 52.0 36 71.5 37 92.0 38 124.5 39 155.5 40 192.0 41 219.5 42 248.5 43 272.5 44 276.0 45 269.0 46 264.5 47 276.5 48 255.0 49 214.0 50 185.0 51 147.0 52 113.5 53 103.5 54 83.5 55 65.0 56 49.0 57 29.0 58 23.5 59 20.5 60 13.5 61 8.0 62 7.0 63 5.5 64 2.5 65 3.5 66 4.0 67 2.5 68 1.0 69 2.0 70 2.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.7875 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.5125 0.0 0.0 0.0 0.0 128-129 1.7000000000000002 0.0 0.0 0.0 0.0 130-131 1.7875 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.175 0.0 0.0 0.0 0.0 136-137 2.4125 0.0 0.0 0.0 0.0 138-139 2.6624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra Read 692295 spots for SRR7169005.sra Written 692295 spots for SRR7169005.sra SRR ids: ['SRR7169005.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eineh0sp SRR7169005.sra spots: 13845900 blocks: [[1, 692295], [692296, 1384590], [1384591, 2076885], [2076886, 2769180], [2769181, 3461475], [3461476, 4153770], [4153771, 4846065], [4846066, 5538360], [5538361, 6230655], [6230656, 6922950], [6922951, 7615245], [7615246, 8307540], [8307541, 8999835], [8999836, 9692130], [9692131, 10384425], [10384426, 11076720], [11076721, 11769015], [11769016, 12461310], [12461311, 13153605], [13153606, 13845900]] SRR7169005 file size 4670220 SRR7169005 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169005 SRR7169005_1.fastq SRR7169005_2.fastq Input file: SRR7169005_1.fastq Paired file: SRR7169005_2.fastq trimmed: SRR7169005-trimmed-pair1.fastq, SRR7169005-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:16:10 2025 >> started Mon Feb 10 15:16:24 2025 >> done (14.533s) 13845900 read pairs processed; of these: 18548 ( 0.13%) short read pairs filtered out after trimming by size control 13736 ( 0.10%) empty read pairs filtered out after trimming by size control 13813616 (99.77%) read pairs available; of these: 5367522 (38.86%) trimmed read pairs available after processing 8446094 (61.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 9 0.00% 21 10 0.00% 22 17 0.00% 23 12 0.00% 24 10 0.00% 25 8 0.00% 26 4 0.00% 27 7 0.00% 28 9 0.00% 29 11 0.00% 30 11 0.00% 31 7 0.00% 32 12 0.00% 33 9 0.00% 34 8 0.00% 35 11 0.00% 36 3 0.00% 37 7 0.00% 38 11 0.00% 39 11 0.00% 40 13 0.00% 41 10 0.00% 42 15 0.00% 43 17 0.00% 44 21 0.00% 45 14 0.00% 46 15 0.00% 47 20 0.00% 48 23 0.00% 49 16 0.00% 50 16 0.00% 51 25 0.00% 52 29 0.00% 53 21 0.00% 54 19 0.00% 55 27 0.00% 56 26 0.00% 57 38 0.00% 58 47 0.00% 59 47 0.00% 60 68 0.00% 61 46 0.00% 62 72 0.00% 63 67 0.00% 64 84 0.00% 65 86 0.00% 66 93 0.00% 67 120 0.00% 68 130 0.00% 69 176 0.00% 70 180 0.00% 71 200 0.00% 72 195 0.00% 73 224 0.00% 74 257 0.00% 75 269 0.00% 76 340 0.00% 77 359 0.00% 78 463 0.00% 79 512 0.00% 80 569 0.00% 81 652 0.00% 82 771 0.01% 83 856 0.01% 84 1760 0.01% 85 2276 0.02% 86 2411 0.02% 87 2751 0.02% 88 2874 0.02% 89 2877 0.02% 90 3186 0.02% 91 3094 0.02% 92 3308 0.02% 93 3646 0.03% 94 3696 0.03% 95 4203 0.03% 96 4399 0.03% 97 4616 0.03% 98 4933 0.04% 99 5231 0.04% 100 5501 0.04% 101 5992 0.04% 102 6343 0.05% 103 6881 0.05% 104 7372 0.05% 105 7917 0.06% 106 8699 0.06% 107 8930 0.06% 108 9360 0.07% 109 9621 0.07% 110 10454 0.08% 111 11048 0.08% 112 11783 0.09% 113 12410 0.09% 114 13312 0.10% 115 13760 0.10% 116 14777 0.11% 117 15358 0.11% 118 16067 0.12% 119 16787 0.12% 120 17274 0.13% 121 18037 0.13% 122 19212 0.14% 123 20563 0.15% 124 21809 0.16% 125 23059 0.17% 126 24494 0.18% 127 25709 0.19% 128 27010 0.20% 129 28180 0.20% 130 30028 0.22% 131 31156 0.23% 132 32974 0.24% 133 36064 0.26% 134 38805 0.28% 135 42214 0.31% 136 45010 0.33% 137 48731 0.35% 138 52284 0.38% 139 55261 0.40% 140 59556 0.43% 141 64469 0.47% 142 70409 0.51% 143 79164 0.57% 144 89392 0.65% 145 106732 0.77% 146 129625 0.94% 147 171018 1.24% 148 260327 1.88% 149 508127 3.68% 150 2915747 21.11% 151 8446094 61.14% 13813616 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=34 prefix-density=0.25 prefix-fanout=2.5 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=244.71 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=20.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=41 prefix-density=0.23 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=59.03 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=13.4 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAGTGTGCCCAAAGCAGATGCCGTTTTCATGAAGTGGATATGCCATGATTGGAGCGACGCACACTGCTTAAAATTCTTGAAGAATTGCTATGACGCCTTGCCGGAAAACGGCAAGGTGATACTTGTTGAGTGCATTCTTCCCGTGGCTCCTGACACAAGCCTTGCCACCAAGGGAGTCGTGCACATTGATGTTATCATGCTGGCGCACAACCCCGGTGGGAAAGAGAGGACCGAAAAGGAATTTGAGGGCTTAGCAAAGGGAGCTGGCTTTCAAGGTTTTGAAGTAATGTGCTGTGCATTCAACACACATGTCATTGAATTCCGCAAGAACTAAGGCTCAAGTCCAAGCTCCAAGTTACTTGGGGTT SRR7169005 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:17:22 Started mapping on | Feb 10 15:17:22 Finished on | Feb 10 15:18:43 Mapping speed, Million of reads per hour | 613.94 Number of input reads | 13813616 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13017768 Uniquely mapped reads % | 94.24% Average mapped length | 296.38 Number of splices: Total | 11036768 Number of splices: Annotated (sjdb) | 10841849 Number of splices: GT/AG | 10872176 Number of splices: GC/AG | 126204 Number of splices: AT/AC | 9813 Number of splices: Non-canonical | 28575 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254029 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 42214 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.56% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 560318 560318 560318 N_multimapping 254029 254029 254029 N_noFeature 310940 12842406 378342 N_ambiguous 163136 804 54732 UnstrandedReadsAssigned:12543692 PositiveStrandReadsAssigned:174558 NegativeStrandReadsAssigned:12584694 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169005 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169005-trimmed-pair1.fastq SRR7169005-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,813,616 reads, 12,554,212 reads pseudoaligned [quant] estimated average fragment length: 245.447 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,295 rounds 52401 SRR7169005.ke.tsv 34699 SRR7169005.se.tsv 87100 total ==> SRR7169005.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.55 189 7.0084 Potri.005G024800.1.v4.1 1035 790.553 24 1.99655 Potri.004G059700.1.v4.1 961 716.559 4 0.367121 Potri.007G009000.2.v4.1 1416 1171.55 0 0 Potri.003G141000.2.v4.1 2943 2698.55 166 4.04555 Potri.016G087400.1.v4.1 270 70.4741 1356 1265.41 Potri.015G069301.1.v4.1 564 322.171 0 0 Potri.010G195200.1.v4.1 1773 1528.55 6 0.25815 Potri.012G127500.1.v4.1 977 732.559 5763 517.377 ==> SRR7169005.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1390 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 341 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169005 completed mapping pipeline successfully