Starting /dee2/code/volunteer_pipeline.sh SRR7169006 current disk space = 3059097923584 free memory = 1521138320 SRR7169006 SRAfilesize 721c235a970bc94bff2c0c96bca0bc20 SRR7169006.sra SRR7169006.sra file validated SRR7169006 is paired end SRR7169006 is conventional basespace SRR7169006 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169006_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97175 34.0 33.0 34.0 33.0 34.0 2 33.39775 34.0 34.0 34.0 33.0 34.0 3 33.482 34.0 34.0 34.0 33.0 34.0 4 33.54475 34.0 34.0 34.0 33.0 34.0 5 33.508 34.0 34.0 34.0 33.0 34.0 6 37.25575 38.0 38.0 38.0 36.0 38.0 7 37.522 38.0 38.0 38.0 37.0 38.0 8 37.549 38.0 38.0 38.0 38.0 38.0 9 37.5805 38.0 38.0 38.0 38.0 38.0 10-14 37.5964 38.0 38.0 38.0 38.0 38.0 15-19 37.5792 38.0 38.0 38.0 38.0 38.0 20-24 37.60275 38.0 38.0 38.0 38.0 38.0 25-29 37.5551 38.0 38.0 38.0 38.0 38.0 30-34 37.5394 38.0 38.0 38.0 38.0 38.0 35-39 37.42075 38.0 38.0 38.0 37.2 38.0 40-44 37.359700000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.28965 38.0 38.0 38.0 37.0 38.0 50-54 37.22575 38.0 38.0 38.0 36.4 38.0 55-59 37.2215 38.0 38.0 38.0 36.2 38.0 60-64 37.14919999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.073350000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.086499999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.970600000000005 38.0 38.0 38.0 36.0 38.0 80-84 37.016200000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.89565 38.0 38.0 38.0 35.4 38.0 90-94 36.80175 38.0 38.0 38.0 35.2 38.0 95-99 36.72765 38.0 38.0 38.0 35.0 38.0 100-104 36.6137 38.0 38.0 38.0 34.2 38.0 105-109 36.4528 38.0 38.0 38.0 34.0 38.0 110-114 36.187949999999994 38.0 37.4 38.0 33.6 38.0 115-119 36.1434 38.0 37.0 38.0 33.2 38.0 120-124 36.00279999999999 38.0 37.0 38.0 33.0 38.0 125-129 35.859300000000005 38.0 36.6 38.0 32.2 38.0 130-134 35.53914999999999 38.0 36.0 38.0 31.0 38.0 135-139 35.242850000000004 38.0 36.0 38.0 29.6 38.0 140-144 34.93415 38.0 35.2 38.0 28.8 38.0 145-149 34.378949999999996 38.0 35.0 38.0 26.8 38.0 150-151 31.298375 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 2.0 17 0.0 18 0.0 19 3.0 20 3.0 21 7.0 22 2.0 23 7.0 24 10.0 25 6.0 26 13.0 27 18.0 28 13.0 29 26.0 30 35.0 31 54.0 32 70.0 33 68.0 34 110.0 35 258.0 36 667.0 37 2623.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.41649694501018 13.212830957230143 9.623217922606925 38.747454175152754 2 22.25 15.4 34.949999999999996 27.400000000000002 3 18.224999999999998 21.025 26.05 34.699999999999996 4 21.375 29.475 22.55 26.6 5 22.325 32.975 23.974999999999998 20.724999999999998 6 18.775 35.55 24.8 20.875 7 15.775 26.724999999999998 39.825 17.675 8 17.775 25.85 30.375000000000004 26.0 9 16.7 25.575 33.5 24.224999999999998 10-14 19.900000000000002 29.470000000000002 26.68 23.95 15-19 19.99 28.915000000000003 27.644999999999996 23.45 20-24 19.86 28.804999999999996 27.61 23.724999999999998 25-29 20.1 29.425 26.815 23.66 30-34 19.83599179958998 29.20146007300365 26.46132306615331 24.501225061253063 35-39 20.01600080004 29.811490574528726 26.70133506675334 23.471173558677936 40-44 19.695 29.69 26.655 23.96 45-49 20.02 28.49 27.295 24.195 50-54 19.575 29.485 26.905 24.035 55-59 20.69 29.265 26.27 23.775 60-64 19.715 28.93 27.400000000000002 23.955000000000002 65-69 20.105 28.73 27.195000000000004 23.97 70-74 19.755 28.28 27.215 24.75 75-79 20.080000000000002 28.599999999999998 27.1 24.22 80-84 19.99 29.015 27.13 23.865 85-89 20.09 28.255000000000003 27.785 23.87 90-94 20.14 28.605000000000004 27.12 24.135 95-99 20.29 28.305000000000003 27.189999999999998 24.215 100-104 20.580000000000002 28.849999999999998 26.99 23.580000000000002 105-109 20.544999999999998 28.285 27.415 23.755000000000003 110-114 20.075000000000003 28.444999999999997 27.310000000000002 24.169999999999998 115-119 19.88 28.625 27.35 24.145 120-124 21.125 27.744999999999997 27.05 24.08 125-129 20.560000000000002 28.315 27.589999999999996 23.535 130-134 21.345 27.715 27.01 23.93 135-139 20.595 27.794999999999998 27.450000000000003 24.16 140-144 20.705000000000002 28.365000000000002 27.705000000000002 23.225 145-149 20.599999999999998 27.675 27.72 24.005000000000003 150-151 21.099999999999998 28.4125 27.187499999999996 23.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.5 25 2.0 26 4.0 27 4.0 28 7.0 29 10.5 30 13.5 31 20.5 32 29.0 33 36.5 34 43.5 35 69.5 36 91.0 37 106.5 38 145.5 39 177.0 40 186.0 41 200.5 42 229.0 43 250.5 44 270.5 45 266.0 46 262.0 47 268.5 48 253.5 49 224.0 50 180.0 51 143.0 52 121.0 53 99.0 54 77.0 55 58.0 56 39.5 57 30.0 58 20.5 59 13.0 60 10.0 61 8.0 62 7.5 63 6.0 64 4.0 65 2.0 66 1.5 67 2.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7999999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.9 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.0625 0.0 0.0 0.0 0.0 130-131 1.1375 0.0 0.0 0.0 0.0 132-133 1.2125 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.6375 0.0 0.0 0.0 0.0 138-139 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCTTC 10 0.0068343505 144.975 5 >>END_MODULE SRR7169006 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169006_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.004 33.0 33.0 34.0 32.0 34.0 2 33.13925 34.0 33.0 34.0 33.0 34.0 3 33.141 34.0 33.0 34.0 33.0 34.0 4 33.144 34.0 33.0 34.0 33.0 34.0 5 33.1455 34.0 33.0 34.0 33.0 34.0 6 37.32775 38.0 38.0 38.0 37.0 38.0 7 37.31625 38.0 38.0 38.0 37.0 38.0 8 37.34975 38.0 38.0 38.0 37.0 38.0 9 37.383 38.0 38.0 38.0 38.0 38.0 10-14 37.305099999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.240899999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.22265 38.0 38.0 38.0 37.0 38.0 25-29 37.19245 38.0 38.0 38.0 37.0 38.0 30-34 37.22165 38.0 38.0 38.0 37.0 38.0 35-39 37.19665 38.0 38.0 38.0 37.0 38.0 40-44 37.198249999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.1045 38.0 38.0 38.0 36.8 38.0 50-54 37.12425 38.0 38.0 38.0 37.0 38.0 55-59 37.037099999999995 38.0 38.0 38.0 36.4 38.0 60-64 36.980650000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.802350000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.7787 38.0 38.0 38.0 36.0 38.0 75-79 36.73949999999999 38.0 38.0 38.0 35.4 38.0 80-84 36.64215 38.0 38.0 38.0 35.0 38.0 85-89 36.517649999999996 38.0 38.0 38.0 34.6 38.0 90-94 36.3733 38.0 38.0 38.0 34.0 38.0 95-99 36.40415 38.0 38.0 38.0 34.0 38.0 100-104 36.143150000000006 38.0 38.0 38.0 33.8 38.0 105-109 36.165350000000004 38.0 38.0 38.0 33.8 38.0 110-114 35.925799999999995 38.0 37.2 38.0 33.0 38.0 115-119 35.7418 38.0 37.0 38.0 32.6 38.0 120-124 35.4314 38.0 36.4 38.0 31.0 38.0 125-129 35.2285 38.0 36.0 38.0 30.0 38.0 130-134 34.89495 38.0 35.6 38.0 28.0 38.0 135-139 34.52915 38.0 35.0 38.0 26.2 38.0 140-144 34.043549999999996 38.0 35.0 38.0 23.0 38.0 145-149 33.30575 38.0 34.2 38.0 18.6 38.0 150-151 29.090249999999997 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 5.0 12 1.0 13 1.0 14 1.0 15 2.0 16 3.0 17 3.0 18 0.0 19 7.0 20 6.0 21 5.0 22 7.0 23 9.0 24 13.0 25 14.0 26 20.0 27 15.0 28 30.0 29 37.0 30 43.0 31 58.0 32 66.0 33 104.0 34 148.0 35 272.0 36 599.0 37 2517.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.475 21.275 13.5 28.749999999999996 2 28.125 23.925 32.025 15.925 3 20.200000000000003 27.975 30.925000000000004 20.9 4 23.150000000000002 35.199999999999996 22.900000000000002 18.75 5 24.5 35.475 21.75 18.275 6 19.625 36.675000000000004 24.0 19.7 7 18.55 22.925 39.175 19.35 8 22.85 25.074999999999996 26.724999999999998 25.35 9 21.25 24.95 30.55 23.25 10-14 23.385 28.665000000000003 26.215 21.735 15-19 23.380000000000003 27.505000000000003 27.334999999999997 21.78 20-24 23.665 27.744999999999997 27.224999999999998 21.365000000000002 25-29 23.125 27.694999999999997 28.084999999999997 21.095 30-34 23.165 27.915 27.32 21.6 35-39 23.365 27.855 27.735 21.044999999999998 40-44 23.494999999999997 27.860000000000003 27.925 20.72 45-49 23.7 27.694999999999997 27.3 21.305 50-54 23.395 28.095 27.145000000000003 21.365000000000002 55-59 23.435 27.445000000000004 28.125 20.995 60-64 23.185 27.48 28.485 20.849999999999998 65-69 23.665 27.794999999999998 27.675 20.865000000000002 70-74 23.56 27.775 27.54 21.125 75-79 23.645 27.325 28.12 20.91 80-84 24.095 27.634999999999998 27.33 20.94 85-89 23.82 27.865000000000002 27.685 20.630000000000003 90-94 23.525 27.32 27.765 21.39 95-99 23.810000000000002 27.82 27.939999999999998 20.43 100-104 24.115000000000002 27.495000000000005 27.750000000000004 20.64 105-109 23.47 27.529999999999998 28.4 20.599999999999998 110-114 23.555 27.33 28.544999999999998 20.57 115-119 23.535 27.43 28.410000000000004 20.625 120-124 24.16 27.439999999999998 27.49 20.91 125-129 23.885 27.165 28.345 20.605 130-134 24.310000000000002 27.250000000000004 27.975 20.465 135-139 23.61 27.365000000000002 28.485 20.54 140-144 23.785 28.09 27.815 20.31 145-149 24.005000000000003 27.455000000000002 27.889999999999997 20.65 150-151 24.087500000000002 27.175 27.787499999999998 20.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 1.5 26 1.5 27 3.0 28 5.5 29 7.0 30 7.0 31 8.5 32 10.5 33 19.0 34 32.5 35 47.0 36 72.0 37 87.5 38 107.5 39 154.5 40 196.5 41 235.0 42 257.0 43 277.5 44 297.5 45 306.5 46 296.5 47 280.5 48 254.0 49 210.0 50 180.5 51 147.5 52 116.0 53 91.0 54 79.0 55 58.0 56 35.5 57 29.5 58 20.0 59 15.0 60 15.0 61 11.0 62 8.0 63 6.0 64 2.5 65 0.0 66 0.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.7250000000000001 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.2374999999999998 0.0 0.0 0.0 0.0 134-135 1.45 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCAT 10 0.006830828 145.0 8 >>END_MODULE Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra Read 665124 spots for SRR7169006.sra Written 665124 spots for SRR7169006.sra SRR ids: ['SRR7169006.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gh68nj24 SRR7169006.sra spots: 13302480 blocks: [[1, 665124], [665125, 1330248], [1330249, 1995372], [1995373, 2660496], [2660497, 3325620], [3325621, 3990744], [3990745, 4655868], [4655869, 5320992], [5320993, 5986116], [5986117, 6651240], [6651241, 7316364], [7316365, 7981488], [7981489, 8646612], [8646613, 9311736], [9311737, 9976860], [9976861, 10641984], [10641985, 11307108], [11307109, 11972232], [11972233, 12637356], [12637357, 13302480]] SRR7169006 file size 4486073 SRR7169006 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169006 SRR7169006_1.fastq SRR7169006_2.fastq Input file: SRR7169006_1.fastq Paired file: SRR7169006_2.fastq trimmed: SRR7169006-trimmed-pair1.fastq, SRR7169006-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:30:12 2025 >> started Mon Feb 10 15:30:28 2025 >> done (15.464s) 13302480 read pairs processed; of these: 12738 ( 0.10%) short read pairs filtered out after trimming by size control 11896 ( 0.09%) empty read pairs filtered out after trimming by size control 13277846 (99.81%) read pairs available; of these: 5186738 (39.06%) trimmed read pairs available after processing 8091108 (60.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 5 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 5 0.00% 25 3 0.00% 26 2 0.00% 27 4 0.00% 28 3 0.00% 29 5 0.00% 30 3 0.00% 31 5 0.00% 32 5 0.00% 33 3 0.00% 34 3 0.00% 35 6 0.00% 36 10 0.00% 37 4 0.00% 38 5 0.00% 39 7 0.00% 40 7 0.00% 41 10 0.00% 42 6 0.00% 43 8 0.00% 44 8 0.00% 45 17 0.00% 46 10 0.00% 47 10 0.00% 48 11 0.00% 49 11 0.00% 50 11 0.00% 51 16 0.00% 52 14 0.00% 53 21 0.00% 54 20 0.00% 55 20 0.00% 56 27 0.00% 57 29 0.00% 58 29 0.00% 59 32 0.00% 60 31 0.00% 61 39 0.00% 62 52 0.00% 63 49 0.00% 64 64 0.00% 65 66 0.00% 66 78 0.00% 67 78 0.00% 68 96 0.00% 69 106 0.00% 70 129 0.00% 71 147 0.00% 72 149 0.00% 73 167 0.00% 74 171 0.00% 75 235 0.00% 76 260 0.00% 77 271 0.00% 78 285 0.00% 79 336 0.00% 80 408 0.00% 81 462 0.00% 82 557 0.00% 83 647 0.00% 84 1184 0.01% 85 1639 0.01% 86 1673 0.01% 87 1819 0.01% 88 1747 0.01% 89 1862 0.01% 90 2085 0.02% 91 2203 0.02% 92 2318 0.02% 93 2485 0.02% 94 2642 0.02% 95 2909 0.02% 96 2975 0.02% 97 3327 0.03% 98 3342 0.03% 99 3490 0.03% 100 3857 0.03% 101 4018 0.03% 102 4465 0.03% 103 4803 0.04% 104 4913 0.04% 105 5273 0.04% 106 5754 0.04% 107 6089 0.05% 108 6437 0.05% 109 6551 0.05% 110 7129 0.05% 111 7414 0.06% 112 8104 0.06% 113 8429 0.06% 114 9272 0.07% 115 10127 0.08% 116 10505 0.08% 117 11126 0.08% 118 11899 0.09% 119 12413 0.09% 120 13024 0.10% 121 13557 0.10% 122 14800 0.11% 123 15646 0.12% 124 16789 0.13% 125 17917 0.13% 126 19041 0.14% 127 20317 0.15% 128 21333 0.16% 129 23024 0.17% 130 24110 0.18% 131 25924 0.20% 132 28195 0.21% 133 30076 0.23% 134 32346 0.24% 135 35031 0.26% 136 37983 0.29% 137 41593 0.31% 138 44885 0.34% 139 48657 0.37% 140 53227 0.40% 141 59634 0.45% 142 67255 0.51% 143 76257 0.57% 144 89600 0.67% 145 106707 0.80% 146 132772 1.00% 147 179848 1.35% 148 275948 2.08% 149 546358 4.11% 150 2883317 21.72% 151 8091108 60.94% 13277846 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=44 prefix-density=0.26 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=47 fanout-score=83.77 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.5 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=38 prefix-density=0.24 prefix-fanout=2.2 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=11 fanout-score=44.21 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=12.8 sequence=TGTTGGTGGTGG SRR7169006 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:31:13 Started mapping on | Feb 10 15:31:14 Finished on | Feb 10 15:32:22 Mapping speed, Million of reads per hour | 702.94 Number of input reads | 13277846 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12693681 Uniquely mapped reads % | 95.60% Average mapped length | 297.18 Number of splices: Total | 11705474 Number of splices: Annotated (sjdb) | 11520296 Number of splices: GT/AG | 11547187 Number of splices: GC/AG | 126155 Number of splices: AT/AC | 9446 Number of splices: Non-canonical | 22686 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234865 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 20554 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.44% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 361601 361601 361601 N_multimapping 234865 234865 234865 N_noFeature 266797 12527742 330366 N_ambiguous 156199 845 53176 UnstrandedReadsAssigned:12270685 PositiveStrandReadsAssigned:165094 NegativeStrandReadsAssigned:12310139 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169006 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169006-trimmed-pair1.fastq SRR7169006-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,277,846 reads, 12,215,171 reads pseudoaligned [quant] estimated average fragment length: 265.84 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7169006.ke.tsv 34699 SRR7169006.se.tsv 87100 total ==> SRR7169006.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.16 222 9.66186 Potri.005G024800.1.v4.1 1035 770.16 32 3.17029 Potri.004G059700.1.v4.1 961 696.251 3 0.328764 Potri.007G009000.2.v4.1 1416 1151.16 0 0 Potri.003G141000.2.v4.1 2943 2678.16 204.029 5.8128 Potri.016G087400.1.v4.1 270 65.6798 1011 1174.49 Potri.015G069301.1.v4.1 564 305.969 0 0 Potri.010G195200.1.v4.1 1773 1508.16 7 0.354144 Potri.012G127500.1.v4.1 977 712.195 3944 422.539 ==> SRR7169006.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1083 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169006 completed mapping pipeline successfully