Starting /dee2/code/volunteer_pipeline.sh SRR7169007 current disk space = 3058636369920 free memory = 1532992032 SRR7169007 SRAfilesize 79bb368ff21aa10ae77da9599eaef692 SRR7169007.sra SRR7169007.sra file validated SRR7169007 is paired end SRR7169007 is conventional basespace SRR7169007 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169007_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9145 34.0 33.0 34.0 32.0 34.0 2 33.06775 34.0 33.0 34.0 32.0 34.0 3 33.0285 34.0 33.0 34.0 32.0 34.0 4 32.942 34.0 33.0 34.0 32.0 34.0 5 32.80825 34.0 33.0 34.0 32.0 34.0 6 36.5375 38.0 37.0 38.0 34.0 38.0 7 37.0125 38.0 38.0 38.0 36.0 38.0 8 37.207 38.0 38.0 38.0 36.0 38.0 9 37.189 38.0 38.0 38.0 37.0 38.0 10-14 37.2624 38.0 38.0 38.0 37.0 38.0 15-19 37.2075 38.0 38.0 38.0 36.2 38.0 20-24 37.10545 38.0 38.0 38.0 36.0 38.0 25-29 36.9495 38.0 38.0 38.0 35.8 38.0 30-34 36.90195 38.0 38.0 38.0 35.4 38.0 35-39 36.8658 38.0 38.0 38.0 35.2 38.0 40-44 36.450450000000004 38.0 38.0 38.0 33.8 38.0 45-49 36.67155 38.0 38.0 38.0 34.2 38.0 50-54 36.675399999999996 38.0 38.0 38.0 34.2 38.0 55-59 36.3859 38.0 37.8 38.0 33.6 38.0 60-64 36.464949999999995 38.0 37.6 38.0 34.0 38.0 65-69 36.400549999999996 38.0 37.2 38.0 33.8 38.0 70-74 36.2925 38.0 37.0 38.0 33.0 38.0 75-79 35.988150000000005 38.0 37.0 38.0 32.0 38.0 80-84 35.963649999999994 38.0 37.0 38.0 32.0 38.0 85-89 35.512299999999996 38.0 36.4 38.0 29.6 38.0 90-94 35.31660000000001 38.0 36.0 38.0 29.2 38.0 95-99 35.51875 38.0 36.0 38.0 29.4 38.0 100-104 34.982600000000005 38.0 35.6 38.0 27.0 38.0 105-109 35.2965 38.0 36.0 38.0 28.8 38.0 110-114 34.749849999999995 38.0 35.0 38.0 25.8 38.0 115-119 34.452349999999996 38.0 34.6 38.0 25.0 38.0 120-124 34.3828 38.0 34.6 38.0 24.6 38.0 125-129 33.230900000000005 37.8 33.4 38.0 16.2 38.0 130-134 33.26975 37.8 33.4 38.0 17.8 38.0 135-139 32.566 36.8 31.4 38.0 18.4 38.0 140-144 32.675149999999995 37.8 32.2 38.0 15.8 38.0 145-149 31.115550000000002 36.2 31.0 38.0 10.8 38.0 150-151 26.48275 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 1.0 16 2.0 17 2.0 18 3.0 19 7.0 20 9.0 21 8.0 22 9.0 23 19.0 24 17.0 25 25.0 26 38.0 27 45.0 28 47.0 29 63.0 30 86.0 31 90.0 32 146.0 33 224.0 34 284.0 35 470.0 36 898.0 37 1504.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.75 12.15 9.85 41.25 2 20.599999999999998 16.950000000000003 35.8 26.650000000000002 3 20.125 20.45 25.124999999999996 34.300000000000004 4 22.825 28.575 21.325 27.275 5 22.38430583501006 33.32494969818913 22.937625754527165 21.35311871227364 6 18.55 35.85 24.925 20.674999999999997 7 13.825000000000001 25.874999999999996 42.05 18.25 8 18.099999999999998 25.05 30.7 26.150000000000002 9 17.299999999999997 24.3 32.775 25.624999999999996 10-14 19.415 30.37 26.695 23.52 15-19 19.63 28.560000000000002 28.225 23.585 20-24 19.925 28.345 27.815 23.915 25-29 19.384999999999998 29.67 27.175 23.77 30-34 19.925 29.4 26.619999999999997 24.055 35-39 19.5 29.375 27.125 24.0 40-44 19.8 29.79 26.87 23.54 45-49 19.689999999999998 29.115000000000002 27.275 23.919999999999998 50-54 19.81 29.07 27.544999999999998 23.575 55-59 19.798959791958392 29.73594718943789 26.685337067413485 23.779755951190236 60-64 19.71 29.080000000000002 27.700000000000003 23.51 65-69 19.875 28.93 27.22 23.974999999999998 70-74 19.950000000000003 29.220000000000002 26.845000000000002 23.985 75-79 19.5918571500025 28.74506077126994 27.439603861351475 24.223478217376083 80-84 19.93398679735947 29.195839167833565 27.185437087417487 23.684736947389478 85-89 20.024022821680596 28.45202942795656 27.781392322706573 23.742555427656274 90-94 19.68277945619335 28.363544813695874 27.623363544813696 24.33031218529708 95-99 19.475 28.799999999999997 27.98 23.745 100-104 20.044999999999998 28.93 27.18 23.845 105-109 20.167351438019843 28.830544142699672 27.347429602164546 23.654674817115943 110-114 20.26 28.965000000000003 27.18 23.595 115-119 20.080000000000002 28.325 28.15 23.445 120-124 19.975 28.33 27.83 23.865 125-129 20.485 27.834999999999997 27.815 23.865 130-134 20.133019952992946 28.87433114967245 27.389108366254938 23.603540531079663 135-139 20.53 28.33 27.315 23.825 140-144 20.7 28.015 27.52 23.765 145-149 20.63683998387747 28.562071745264006 27.60479645304313 23.1962918178154 150-151 20.282605977241467 28.72327122671002 28.09803676378642 22.896086032262097 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 2.5 25 4.0 26 7.0 27 8.5 28 12.5 29 17.0 30 25.5 31 30.5 32 32.5 33 46.0 34 58.5 35 73.5 36 88.0 37 103.5 38 135.0 39 154.0 40 185.5 41 231.0 42 247.0 43 257.0 44 278.0 45 267.5 46 236.5 47 240.5 48 232.5 49 203.5 50 176.0 51 142.5 52 123.5 53 109.5 54 76.5 55 56.0 56 43.0 57 26.5 58 16.0 59 8.5 60 9.5 61 8.0 62 4.0 63 1.5 64 3.5 65 5.5 66 3.5 67 1.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.6 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.02 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.034999999999999996 80-84 0.02 85-89 0.095 90-94 0.7000000000000001 95-99 0.0 100-104 0.0 105-109 0.21 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.0 140-144 0.0 145-149 0.76 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.7125 0.0 0.0 0.0 0.0 128-129 0.8999999999999999 0.0 0.0 0.0 0.0 130-131 1.025 0.0 0.0 0.0 0.0 132-133 1.1125 0.0 0.0 0.0 0.0 134-135 1.2375 0.0 0.0 0.0 0.0 136-137 1.3375 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0036592125 20.853527 3 >>END_MODULE SRR7169007 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169007_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4415 33.0 33.0 34.0 32.0 34.0 2 32.608 34.0 33.0 34.0 32.0 34.0 3 32.638 34.0 33.0 34.0 32.0 34.0 4 32.34775 34.0 33.0 34.0 32.0 34.0 5 32.5615 34.0 33.0 34.0 32.0 34.0 6 36.53275 38.0 38.0 38.0 34.0 38.0 7 36.64025 38.0 38.0 38.0 35.0 38.0 8 36.105 38.0 38.0 38.0 34.0 38.0 9 36.36025 38.0 38.0 38.0 34.0 38.0 10-14 36.379000000000005 38.0 38.0 38.0 34.0 38.0 15-19 36.267199999999995 38.0 38.0 38.0 34.0 38.0 20-24 36.543600000000005 38.0 38.0 38.0 35.2 38.0 25-29 36.4885 38.0 38.0 38.0 34.6 38.0 30-34 36.3352 38.0 38.0 38.0 34.2 38.0 35-39 36.362700000000004 38.0 38.0 38.0 34.4 38.0 40-44 36.44475 38.0 38.0 38.0 34.4 38.0 45-49 36.383 38.0 38.0 38.0 34.4 38.0 50-54 36.20375 38.0 38.0 38.0 34.0 38.0 55-59 35.503949999999996 38.0 37.8 38.0 29.6 38.0 60-64 35.52105 38.0 38.0 38.0 30.0 38.0 65-69 35.572649999999996 38.0 38.0 38.0 30.2 38.0 70-74 35.9532 38.0 38.0 38.0 32.6 38.0 75-79 35.73094999999999 38.0 37.8 38.0 30.6 38.0 80-84 35.74855 38.0 38.0 38.0 31.4 38.0 85-89 35.807500000000005 38.0 37.6 38.0 31.6 38.0 90-94 35.9239 38.0 38.0 38.0 33.0 38.0 95-99 35.6719 38.0 37.4 38.0 31.6 38.0 100-104 35.48185 38.0 37.2 38.0 30.0 38.0 105-109 34.95515 38.0 37.0 38.0 27.2 38.0 110-114 34.76545 38.0 37.0 38.0 26.2 38.0 115-119 34.69185 38.0 36.6 38.0 25.8 38.0 120-124 34.76520000000001 38.0 36.0 38.0 26.8 38.0 125-129 34.485 38.0 35.8 38.0 25.4 38.0 130-134 34.3822 38.0 35.8 38.0 24.2 38.0 135-139 34.0039 38.0 35.0 38.0 21.6 38.0 140-144 33.17305 38.0 34.2 38.0 16.0 38.0 145-149 31.8057 38.0 32.6 38.0 10.8 38.0 150-151 28.2835 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 6.0 4 3.0 5 2.0 6 1.0 7 2.0 8 4.0 9 3.0 10 2.0 11 2.0 12 1.0 13 0.0 14 5.0 15 9.0 16 9.0 17 11.0 18 9.0 19 19.0 20 12.0 21 21.0 22 9.0 23 20.0 24 25.0 25 30.0 26 22.0 27 51.0 28 46.0 29 60.0 30 64.0 31 75.0 32 100.0 33 107.0 34 151.0 35 246.0 36 549.0 37 2306.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.047379032258064 20.035282258064516 14.969758064516128 30.94758064516129 2 26.464697045568354 25.037556334501755 31.69754631947922 16.800200300450676 3 20.08557764913164 28.2154543166373 30.78278379058646 20.9161842436446 4 22.377090724784594 34.693360364926505 23.441459706031427 19.488089204257474 5 24.0990990990991 35.86086086086086 23.0980980980981 16.941941941941945 6 20.115086314736054 37.25293970477858 23.992994746059544 18.638979234425822 7 19.98995479658463 19.964841788046208 39.50276243093923 20.542440984429934 8 20.02029941639178 25.6787617356001 29.002791169753873 25.298147678254253 9 22.024108488196887 24.711200401808135 29.784028126569563 23.480662983425415 10-14 23.6533131771227 28.097757621567144 26.832955404383974 21.415973796926178 15-19 23.103361132170836 28.177912560020218 27.990902198635332 20.727824109173618 20-24 23.12063156836124 27.450093025594608 28.415547845326095 21.013727560718056 25-29 22.98983016882922 28.0496969089725 28.199989980461897 20.760482941736385 30-34 22.951725523685134 28.723564575275027 27.37228110714824 20.952428793891595 35-39 22.956512985705658 28.29675860680491 28.125629152405878 20.621099255083553 40-44 23.669292128630914 27.998795966487734 28.149300155520997 20.18261174936036 45-49 23.27214364530043 28.202427525328517 28.4180960979035 20.10733273146755 50-54 23.056421603137885 28.34657548023735 28.27617419289953 20.320828723725235 55-59 23.44785401162198 28.35151391579162 27.566520542359058 20.634111530227344 60-64 22.724255884004695 27.993056619186195 28.462755909531833 20.819931587277278 65-69 23.801492384749054 27.971992231421854 28.01287948482061 20.213635899008484 70-74 23.257923111805308 28.341814883861538 27.87826875598327 20.521993248349876 75-79 23.064874696847212 28.18310428455942 28.506467259498784 20.245553759094584 80-84 23.245569620253164 28.31898734177215 28.212658227848102 20.222784810126583 85-89 23.54619157241517 27.62986688019217 28.19037133420078 20.633570213191874 90-94 23.532355737951054 27.62124017816926 28.497072218607677 20.349331865272006 95-99 23.254880313142973 27.6459075626035 28.57429618106087 20.524915943192653 100-104 23.754847157173792 27.416024575716374 28.82107065518457 20.008057611925263 105-109 23.791915712693747 27.899908823827374 27.910039509674807 20.398135953804072 110-114 23.332653477462777 27.880889251478685 28.630430348766062 20.156026922292476 115-119 23.833722939323103 27.457058644171155 28.071958532371177 20.63725988413457 120-124 23.964956195244056 27.944931163954944 27.9549436795995 20.1351689612015 125-129 23.450107753220067 27.98576655139578 28.010825439783492 20.55330025560066 130-134 23.84773559356036 27.49887155825267 28.747680425297155 19.905712422889817 135-139 23.925673645196834 27.927476710407696 28.142842832815784 20.004006811579686 140-144 24.21385224936055 27.21299964892923 28.53202266914088 20.041125432569338 145-149 23.71118480554718 27.911767661541553 28.328811174756307 20.04823635815496 150-151 24.489284371475122 27.547311693194636 28.261686928186492 19.701717007143753 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.5 14 1.5 15 1.5 16 2.0 17 2.5 18 2.0 19 2.5 20 4.5 21 3.5 22 3.0 23 5.5 24 5.5 25 3.5 26 8.5 27 11.0 28 10.0 29 14.0 30 15.5 31 23.5 32 30.5 33 43.5 34 54.0 35 68.5 36 97.5 37 107.5 38 131.0 39 161.5 40 193.0 41 239.5 42 264.0 43 270.0 44 278.5 45 271.0 46 258.5 47 257.0 48 232.0 49 190.0 50 158.5 51 135.5 52 108.5 53 88.0 54 72.0 55 53.0 56 34.0 57 22.0 58 17.5 59 11.5 60 6.0 61 6.5 62 6.5 63 3.0 64 2.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.15 3 0.675 4 1.35 5 0.1 6 0.075 7 0.44999999999999996 8 1.4749999999999999 9 0.44999999999999996 10-14 0.775 15-19 1.075 20-24 0.565 25-29 0.19499999999999998 30-34 0.46499999999999997 35-39 0.66 40-44 0.335 45-49 0.31 50-54 0.5700000000000001 55-59 1.91 60-64 2.0650000000000004 65-69 2.17 70-74 0.765 75-79 1.04 80-84 1.25 85-89 0.09 90-94 0.095 95-99 0.365 100-104 0.715 105-109 1.29 110-114 1.94 115-119 1.6099999999999999 120-124 0.125 125-129 0.23500000000000001 130-134 0.305 135-139 0.16999999999999998 140-144 0.305 145-149 0.49 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5375 0.0 0.0 0.0 0.0 126-127 0.6625 0.0 0.0 0.0 0.0 128-129 0.8500000000000001 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 55 9.799075E-5 18.868605 55-59 >>END_MODULE Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968369 spots for SRR7169007.sra Written 968369 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra Read 968351 spots for SRR7169007.sra Written 968351 spots for SRR7169007.sra SRR ids: ['SRR7169007.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g19ld9zq SRR7169007.sra spots: 19367038 blocks: [[1, 968351], [968352, 1936702], [1936703, 2905053], [2905054, 3873404], [3873405, 4841755], [4841756, 5810106], [5810107, 6778457], [6778458, 7746808], [7746809, 8715159], [8715160, 9683510], [9683511, 10651861], [10651862, 11620212], [11620213, 12588563], [12588564, 13556914], [13556915, 14525265], [14525266, 15493616], [15493617, 16461967], [16461968, 17430318], [17430319, 18398669], [18398670, 19367038]] SRR7169007 file size 6541153 SRR7169007 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169007 SRR7169007_1.fastq SRR7169007_2.fastq Input file: SRR7169007_1.fastq Paired file: SRR7169007_2.fastq trimmed: SRR7169007-trimmed-pair1.fastq, SRR7169007-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:20:05 2025 >> started Mon Feb 10 16:20:30 2025 >> done (24.701s) 19367038 read pairs processed; of these: 20881 ( 0.11%) short read pairs filtered out after trimming by size control 28278 ( 0.15%) empty read pairs filtered out after trimming by size control 19317879 (99.75%) read pairs available; of these: 8803349 (45.57%) trimmed read pairs available after processing 10514530 (54.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 2 0.00% 21 8 0.00% 22 5 0.00% 23 5 0.00% 24 8 0.00% 25 5 0.00% 26 8 0.00% 27 7 0.00% 28 5 0.00% 29 3 0.00% 30 9 0.00% 31 9 0.00% 32 6 0.00% 33 11 0.00% 34 7 0.00% 35 12 0.00% 36 14 0.00% 37 7 0.00% 38 7 0.00% 39 14 0.00% 40 9 0.00% 41 14 0.00% 42 8 0.00% 43 21 0.00% 44 14 0.00% 45 19 0.00% 46 24 0.00% 47 26 0.00% 48 26 0.00% 49 20 0.00% 50 34 0.00% 51 27 0.00% 52 38 0.00% 53 49 0.00% 54 36 0.00% 55 46 0.00% 56 54 0.00% 57 53 0.00% 58 54 0.00% 59 61 0.00% 60 89 0.00% 61 83 0.00% 62 113 0.00% 63 112 0.00% 64 135 0.00% 65 174 0.00% 66 163 0.00% 67 180 0.00% 68 225 0.00% 69 242 0.00% 70 266 0.00% 71 287 0.00% 72 346 0.00% 73 379 0.00% 74 420 0.00% 75 503 0.00% 76 585 0.00% 77 554 0.00% 78 660 0.00% 79 760 0.00% 80 889 0.00% 81 1057 0.01% 82 1184 0.01% 83 1401 0.01% 84 2324 0.01% 85 2636 0.01% 86 2639 0.01% 87 2999 0.02% 88 3063 0.02% 89 3183 0.02% 90 3510 0.02% 91 3487 0.02% 92 3824 0.02% 93 4210 0.02% 94 4126 0.02% 95 4734 0.02% 96 4976 0.03% 97 5134 0.03% 98 5550 0.03% 99 5622 0.03% 100 6052 0.03% 101 6332 0.03% 102 7073 0.04% 103 7290 0.04% 104 7537 0.04% 105 8409 0.04% 106 9049 0.05% 107 9566 0.05% 108 9912 0.05% 109 10768 0.06% 110 11493 0.06% 111 11632 0.06% 112 12415 0.06% 113 13308 0.07% 114 13938 0.07% 115 14729 0.08% 116 15699 0.08% 117 16887 0.09% 118 17376 0.09% 119 18205 0.09% 120 19206 0.10% 121 20280 0.10% 122 21482 0.11% 123 22877 0.12% 124 24700 0.13% 125 25861 0.13% 126 28160 0.15% 127 29791 0.15% 128 31660 0.16% 129 33874 0.18% 130 36397 0.19% 131 39323 0.20% 132 42375 0.22% 133 45804 0.24% 134 49880 0.26% 135 54546 0.28% 136 59205 0.31% 137 64247 0.33% 138 71078 0.37% 139 80247 0.42% 140 88749 0.46% 141 99335 0.51% 142 113675 0.59% 143 133397 0.69% 144 159818 0.83% 145 198777 1.03% 146 255893 1.32% 147 353097 1.83% 148 541103 2.80% 149 1029289 5.33% 150 4727935 24.47% 151 10514530 54.43% 19317879 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=41 prefix-density=0.17 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=250.40 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=42 prefix-density=0.34 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=275.99 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=30.8 sequence=AAGAAGAAGAAA SRR7169007 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:21:14 Started mapping on | Feb 10 16:21:15 Finished on | Feb 10 16:23:22 Mapping speed, Million of reads per hour | 547.59 Number of input reads | 19317879 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18352161 Uniquely mapped reads % | 95.00% Average mapped length | 296.69 Number of splices: Total | 17812281 Number of splices: Annotated (sjdb) | 17526204 Number of splices: GT/AG | 17549048 Number of splices: GC/AG | 211302 Number of splices: AT/AC | 13910 Number of splices: Non-canonical | 38021 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 337727 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 104489 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 648855 648855 648855 N_multimapping 337727 337727 337727 N_noFeature 465220 18155326 561521 N_ambiguous 180748 1578 79053 UnstrandedReadsAssigned:17706193 PositiveStrandReadsAssigned:195257 NegativeStrandReadsAssigned:17711587 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169007 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169007-trimmed-pair1.fastq SRR7169007-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,317,879 reads, 17,622,294 reads pseudoaligned [quant] estimated average fragment length: 273.393 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR7169007.ke.tsv 34699 SRR7169007.se.tsv 87100 total ==> SRR7169007.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.61 370 11.6575 Potri.005G024800.1.v4.1 1035 762.607 68 4.90409 Potri.004G059700.1.v4.1 961 688.657 4 0.319454 Potri.007G009000.2.v4.1 1416 1143.61 0 0 Potri.003G141000.2.v4.1 2943 2670.61 310.163 6.38749 Potri.016G087400.1.v4.1 270 63.1754 1764.63 1536.23 Potri.015G069301.1.v4.1 564 298.497 0 0 Potri.010G195200.1.v4.1 1773 1500.61 33 1.20948 Potri.012G127500.1.v4.1 977 704.638 7325 571.731 ==> SRR7169007.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1307 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 376 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169007 completed mapping pipeline successfully