Starting /dee2/code/volunteer_pipeline.sh SRR7169008 current disk space = 3058668437504 free memory = 1530941492 SRR7169008 SRAfilesize d7b1352b77bbb9b92bb52eb9d9067fd3 SRR7169008.sra SRR7169008.sra file validated SRR7169008 is paired end SRR7169008 is conventional basespace SRR7169008 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169008_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.22225 34.0 34.0 34.0 33.0 34.0 2 33.503 34.0 34.0 34.0 33.0 34.0 3 33.515 34.0 34.0 34.0 33.0 34.0 4 33.52825 34.0 34.0 34.0 33.0 34.0 5 33.548 34.0 34.0 34.0 33.0 34.0 6 37.2795 38.0 38.0 38.0 36.0 38.0 7 37.49475 38.0 38.0 38.0 37.0 38.0 8 37.5605 38.0 38.0 38.0 37.0 38.0 9 37.57625 38.0 38.0 38.0 38.0 38.0 10-14 37.5019 38.0 38.0 38.0 37.4 38.0 15-19 37.54725 38.0 38.0 38.0 38.0 38.0 20-24 37.54595 38.0 38.0 38.0 38.0 38.0 25-29 37.5233 38.0 38.0 38.0 38.0 38.0 30-34 37.5283 38.0 38.0 38.0 38.0 38.0 35-39 37.402049999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.289699999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.26649999999999 38.0 38.0 38.0 36.8 38.0 50-54 37.2281 38.0 38.0 38.0 36.8 38.0 55-59 37.1494 38.0 38.0 38.0 36.0 38.0 60-64 37.08755000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.981550000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.97275 38.0 38.0 38.0 36.0 38.0 75-79 36.897149999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.750750000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.56915 38.0 38.0 38.0 34.2 38.0 90-94 36.42005 38.0 38.0 38.0 33.8 38.0 95-99 36.2251 38.0 37.6 38.0 33.0 38.0 100-104 35.91120000000001 38.0 37.0 38.0 31.2 38.0 105-109 35.67955 38.0 37.0 38.0 30.6 38.0 110-114 35.13775 38.0 36.2 38.0 28.4 38.0 115-119 34.8677 38.0 36.0 38.0 28.0 38.0 120-124 34.18245 38.0 34.4 38.0 24.0 38.0 125-129 33.7479 38.0 34.0 38.0 21.4 38.0 130-134 33.04895 38.0 33.0 38.0 17.2 38.0 135-139 32.211650000000006 38.0 31.6 38.0 13.8 38.0 140-144 31.1438 36.2 28.8 38.0 12.8 38.0 145-149 29.243299999999998 36.0 27.0 38.0 2.0 38.0 150-151 21.422375000000002 19.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 2.0 14 2.0 15 2.0 16 1.0 17 0.0 18 4.0 19 6.0 20 4.0 21 13.0 22 14.0 23 19.0 24 17.0 25 25.0 26 21.0 27 33.0 28 39.0 29 33.0 30 58.0 31 76.0 32 97.0 33 159.0 34 223.0 35 492.0 36 1080.0 37 1577.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.041635124905376 14.332576331062327 8.579359071410547 32.04642947262175 2 22.95 16.3 34.300000000000004 26.450000000000003 3 19.825 23.3 27.650000000000002 29.225 4 21.5 29.7 23.95 24.85 5 22.1055263815954 35.25881470367592 24.131032758189548 18.504626156539132 6 18.95 36.225 25.724999999999998 19.1 7 15.1 25.474999999999998 42.525 16.900000000000002 8 19.75 24.95 28.4 26.900000000000002 9 17.0 25.8 32.75 24.45 10-14 20.3 29.815 26.040000000000003 23.845 15-19 20.369999999999997 28.735 27.744999999999997 23.150000000000002 20-24 20.095 28.305000000000003 27.694999999999997 23.905 25-29 19.634999999999998 29.03 27.025 24.310000000000002 30-34 19.64 28.735 27.24 24.385 35-39 20.0 28.76 27.33 23.91 40-44 20.105 28.7 27.800000000000004 23.395 45-49 20.44 28.194999999999997 27.565 23.799999999999997 50-54 20.544999999999998 28.53 27.605 23.32 55-59 19.96 28.804999999999996 27.134999999999998 24.099999999999998 60-64 19.66 28.57 28.01 23.76 65-69 20.465 28.345 27.55 23.64 70-74 20.485 28.000000000000004 27.46 24.055 75-79 20.73 28.335 27.279999999999998 23.655 80-84 20.369999999999997 28.575 27.525 23.53 85-89 20.535 27.825 27.67 23.97 90-94 20.39 28.395 27.415 23.799999999999997 95-99 20.03 27.839999999999996 27.975 24.154999999999998 100-104 20.44 27.705000000000002 27.76 24.095 105-109 20.044999999999998 28.125 27.565 24.265 110-114 20.48 27.800000000000004 27.639999999999997 24.08 115-119 20.175 28.499999999999996 26.87 24.455 120-124 20.57 28.025 27.415 23.990000000000002 125-129 20.825 27.565 27.455000000000002 24.154999999999998 130-134 21.64 27.16 26.884999999999998 24.315 135-139 20.645 27.534999999999997 27.439999999999998 24.38 140-144 21.185000000000002 27.965 26.935 23.915 145-149 20.61 27.839999999999996 27.125 24.425 150-151 20.95 27.6875 27.3625 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 2.5 25 1.5 26 4.5 27 6.0 28 5.0 29 9.5 30 16.0 31 29.0 32 37.5 33 43.5 34 56.5 35 75.5 36 81.5 37 98.5 38 138.0 39 158.0 40 178.5 41 204.0 42 239.5 43 254.5 44 259.0 45 270.0 46 273.0 47 262.0 48 239.5 49 210.0 50 170.0 51 152.0 52 126.5 53 94.5 54 80.0 55 60.0 56 38.5 57 28.5 58 22.5 59 17.0 60 13.5 61 9.0 62 6.0 63 5.5 64 3.5 65 3.5 66 2.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.8875 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.625 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.7875 0.0 0.0 0.0 0.0 138-139 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169008 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169008_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00775 33.0 33.0 34.0 32.0 34.0 2 32.9775 34.0 33.0 34.0 32.0 34.0 3 32.96225 34.0 33.0 34.0 31.0 34.0 4 32.997 34.0 33.0 34.0 33.0 34.0 5 32.904 34.0 33.0 34.0 33.0 34.0 6 37.1875 38.0 38.0 38.0 37.0 38.0 7 37.18 38.0 38.0 38.0 37.0 38.0 8 37.1045 38.0 38.0 38.0 37.0 38.0 9 37.13925 38.0 38.0 38.0 37.0 38.0 10-14 37.130399999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.12665 38.0 38.0 38.0 37.0 38.0 20-24 37.0082 38.0 38.0 38.0 36.6 38.0 25-29 36.9486 38.0 38.0 38.0 36.4 38.0 30-34 36.93895 38.0 38.0 38.0 36.2 38.0 35-39 36.8798 38.0 38.0 38.0 36.0 38.0 40-44 36.85115 38.0 38.0 38.0 36.0 38.0 45-49 36.65015 38.0 38.0 38.0 34.8 38.0 50-54 36.51485 38.0 38.0 38.0 34.6 38.0 55-59 36.4594 38.0 38.0 38.0 34.2 38.0 60-64 36.37785 38.0 38.0 38.0 34.0 38.0 65-69 36.183350000000004 38.0 38.0 38.0 33.8 38.0 70-74 36.05120000000001 38.0 37.6 38.0 33.0 38.0 75-79 35.7973 38.0 37.0 38.0 31.8 38.0 80-84 35.613800000000005 38.0 37.0 38.0 30.8 38.0 85-89 35.4405 38.0 36.6 38.0 29.4 38.0 90-94 35.04155 38.0 36.0 38.0 28.4 38.0 95-99 34.78315 38.0 35.6 38.0 26.4 38.0 100-104 34.0262 38.0 34.0 38.0 22.8 38.0 105-109 33.3908 38.0 33.0 38.0 17.4 38.0 110-114 32.918049999999994 38.0 32.6 38.0 14.8 38.0 115-119 32.0185 37.8 30.8 38.0 14.0 38.0 120-124 30.7511 37.0 28.0 38.0 12.4 38.0 125-129 29.542 36.2 24.8 38.0 11.2 38.0 130-134 28.536700000000003 34.4 21.8 38.0 2.0 38.0 135-139 27.640549999999998 33.2 19.6 38.0 2.0 38.0 140-144 25.876150000000003 32.6 14.0 38.0 2.0 38.0 145-149 23.310650000000003 30.8 4.0 37.8 2.0 38.0 150-151 16.797 15.0 2.0 32.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 1.0 4 2.0 5 0.0 6 2.0 7 4.0 8 2.0 9 2.0 10 2.0 11 3.0 12 3.0 13 3.0 14 1.0 15 9.0 16 11.0 17 14.0 18 15.0 19 16.0 20 14.0 21 20.0 22 37.0 23 27.0 24 39.0 25 42.0 26 48.0 27 55.0 28 61.0 29 96.0 30 102.0 31 136.0 32 201.0 33 272.0 34 439.0 35 675.0 36 1048.0 37 584.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.325 23.275000000000002 11.15 23.25 2 25.732165206508135 25.882352941176475 29.987484355444305 18.39799749687109 3 21.127819548872182 28.195488721804512 31.2280701754386 19.448621553884713 4 23.013286537979443 34.92103284031086 23.640010027575833 18.42567059413387 5 23.76535472549511 36.400100275758334 20.656806217097017 19.177738781649538 6 21.48574287143572 36.91845922961481 22.811405702851424 18.78439219609805 7 20.590442832124094 20.965724293219914 37.72829622216663 20.715536652489366 8 20.590442832124094 25.819364523392547 27.045283962972228 26.54490868151113 9 21.935967983991997 24.437218609304654 29.03951975987994 24.58729364682341 10-14 23.803570535580338 28.774316147422113 25.673851077661645 21.7482622393359 15-19 23.368505275791367 28.069210381557237 27.03905585837876 21.523228484272643 20-24 23.575609024060828 27.672452603671655 27.07718473312991 21.674753639137613 25-29 23.399679935987198 27.790558111622328 27.230446089217843 21.579315863172635 30-34 23.805712570656794 27.90255615026762 27.38732429593317 20.904406983142415 35-39 23.88097024256064 28.02700675168792 26.98674668667167 21.10527631907977 40-44 23.48087021755439 28.142035508877218 27.51187796949237 20.86521630407602 45-49 24.17087689460257 28.042619178630385 27.047171227052175 20.739332699714872 50-54 23.219643928785757 27.680536107221442 27.38047609521904 21.719343868773755 55-59 23.712113634090226 27.42822846854056 27.403220966289886 21.456436931079324 60-64 23.28582145536384 28.172043010752688 27.51187796949237 21.030257564391096 65-69 23.948592288843326 27.934190128519276 26.959043856578486 21.15817372605891 70-74 24.21226367910373 27.158147444233272 27.658297489246774 20.971291387416223 75-79 24.191047761940485 27.576894223555886 27.336834208552137 20.89522380595149 80-84 23.609721944388877 27.545509101820365 27.740548109621926 21.104220844168832 85-89 23.66591647911978 27.906976744186046 27.0717679419855 21.355338834708675 90-94 23.82857428614292 27.874181127169074 27.17907686152923 21.118167725158774 95-99 24.002400240024002 27.542754275427544 27.237723772377237 21.217121712171217 100-104 23.862386238623863 27.797779777977798 27.767776777677767 20.572057205720572 105-109 24.167416741674167 27.602760276027606 27.28772877287729 20.94209420942094 110-114 24.267426742674267 27.622762276227625 27.28772877287729 20.82208220822082 115-119 24.487346203861158 27.443232969890968 27.568270481144342 20.50115034510353 120-124 24.58729364682341 27.098549274637318 27.453726863431715 20.860430215107552 125-129 23.830255717359755 27.64850122604214 27.608467197117548 20.912775859480558 130-134 23.90956382553021 27.155862344937976 27.13085234093637 21.803721488595436 135-139 24.15224567370211 27.52825847754326 27.283184955486643 21.03631089326798 140-144 24.8062015503876 27.656914228557138 27.03675918979745 20.500125031257816 145-149 25.198779816972543 28.119217882682403 26.373956093414012 20.308046206931042 150-151 25.256314078519633 26.85671417854464 27.28182045511378 20.605151287821954 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.5 28 2.5 29 3.5 30 8.0 31 9.0 32 11.5 33 20.5 34 36.5 35 52.5 36 67.0 37 86.0 38 114.5 39 166.5 40 200.0 41 221.0 42 255.0 43 274.0 44 273.5 45 276.5 46 276.0 47 265.0 48 240.0 49 205.0 50 184.5 51 169.0 52 147.5 53 113.0 54 78.5 55 57.5 56 41.5 57 29.5 58 22.0 59 16.5 60 15.0 61 10.0 62 7.0 63 7.5 64 5.5 65 3.5 66 2.5 67 2.0 68 2.0 69 1.5 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.25 4 0.27499999999999997 5 0.27499999999999997 6 0.05 7 0.075 8 0.075 9 0.05 10-14 0.015 15-19 0.015 20-24 0.045 25-29 0.02 30-34 0.045 35-39 0.025 40-44 0.025 45-49 0.045 50-54 0.02 55-59 0.03 60-64 0.025 65-69 0.015 70-74 0.03 75-79 0.025 80-84 0.02 85-89 0.025 90-94 0.015 95-99 0.01 100-104 0.01 105-109 0.01 110-114 0.01 115-119 0.03 120-124 0.05 125-129 0.08499999999999999 130-134 0.04 135-139 0.03 140-144 0.025 145-149 0.015 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.425 0.0 0.0 0.0 0.0 122-123 1.6375 0.0 0.0 0.0 0.0 124-125 1.8250000000000002 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.3499999999999996 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCTGG 10 0.006830828 145.0 5 AGCTGGA 10 0.006830828 145.0 6 >>END_MODULE Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra Read 817177 spots for SRR7169008.sra Written 817177 spots for SRR7169008.sra SRR ids: ['SRR7169008.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kkb6lqxu SRR7169008.sra spots: 16343540 blocks: [[1, 817177], [817178, 1634354], [1634355, 2451531], [2451532, 3268708], [3268709, 4085885], [4085886, 4903062], [4903063, 5720239], [5720240, 6537416], [6537417, 7354593], [7354594, 8171770], [8171771, 8988947], [8988948, 9806124], [9806125, 10623301], [10623302, 11440478], [11440479, 12257655], [12257656, 13074832], [13074833, 13892009], [13892010, 14709186], [14709187, 15526363], [15526364, 16343540]] SRR7169008 file size 5516589 SRR7169008 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169008 SRR7169008_1.fastq SRR7169008_2.fastq Input file: SRR7169008_1.fastq Paired file: SRR7169008_2.fastq trimmed: SRR7169008-trimmed-pair1.fastq, SRR7169008-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:17:57 2025 >> started Mon Feb 10 16:18:21 2025 >> done (23.444s) 16343540 read pairs processed; of these: 25996 ( 0.16%) short read pairs filtered out after trimming by size control 17401 ( 0.11%) empty read pairs filtered out after trimming by size control 16300143 (99.73%) read pairs available; of these: 7281559 (44.67%) trimmed read pairs available after processing 9018584 (55.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 11 0.00% 21 7 0.00% 22 10 0.00% 23 6 0.00% 24 6 0.00% 25 6 0.00% 26 6 0.00% 27 9 0.00% 28 4 0.00% 29 5 0.00% 30 3 0.00% 31 7 0.00% 32 7 0.00% 33 5 0.00% 34 7 0.00% 35 8 0.00% 36 4 0.00% 37 5 0.00% 38 11 0.00% 39 10 0.00% 40 7 0.00% 41 8 0.00% 42 10 0.00% 43 5 0.00% 44 16 0.00% 45 9 0.00% 46 23 0.00% 47 21 0.00% 48 17 0.00% 49 25 0.00% 50 35 0.00% 51 25 0.00% 52 27 0.00% 53 29 0.00% 54 31 0.00% 55 54 0.00% 56 43 0.00% 57 60 0.00% 58 76 0.00% 59 64 0.00% 60 86 0.00% 61 93 0.00% 62 114 0.00% 63 107 0.00% 64 142 0.00% 65 132 0.00% 66 171 0.00% 67 178 0.00% 68 182 0.00% 69 257 0.00% 70 293 0.00% 71 326 0.00% 72 351 0.00% 73 437 0.00% 74 446 0.00% 75 511 0.00% 76 591 0.00% 77 628 0.00% 78 675 0.00% 79 832 0.01% 80 938 0.01% 81 1150 0.01% 82 1384 0.01% 83 1615 0.01% 84 2693 0.02% 85 3437 0.02% 86 3538 0.02% 87 3636 0.02% 88 3886 0.02% 89 3955 0.02% 90 4346 0.03% 91 4682 0.03% 92 4968 0.03% 93 5316 0.03% 94 5800 0.04% 95 6129 0.04% 96 6571 0.04% 97 6954 0.04% 98 7350 0.05% 99 7818 0.05% 100 8616 0.05% 101 9254 0.06% 102 10086 0.06% 103 10828 0.07% 104 11658 0.07% 105 12494 0.08% 106 13258 0.08% 107 13953 0.09% 108 14572 0.09% 109 15481 0.09% 110 16201 0.10% 111 17631 0.11% 112 18611 0.11% 113 20317 0.12% 114 21831 0.13% 115 23112 0.14% 116 23872 0.15% 117 25596 0.16% 118 26310 0.16% 119 27299 0.17% 120 28877 0.18% 121 30656 0.19% 122 32863 0.20% 123 35602 0.22% 124 37585 0.23% 125 39573 0.24% 126 42323 0.26% 127 43435 0.27% 128 45641 0.28% 129 47461 0.29% 130 49865 0.31% 131 52319 0.32% 132 56025 0.34% 133 59947 0.37% 134 63547 0.39% 135 68120 0.42% 136 72652 0.45% 137 77759 0.48% 138 82639 0.51% 139 87867 0.54% 140 94523 0.58% 141 103307 0.63% 142 113304 0.70% 143 128296 0.79% 144 146881 0.90% 145 172449 1.06% 146 210010 1.29% 147 277187 1.70% 148 402222 2.47% 149 739727 4.54% 150 3404468 20.89% 151 9018584 55.33% 16300143 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=25.23 fanout-score-rank=7 prefix-density=0.41 prefix-fanout=9.5 sequence=TTCTCATCAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=262.65 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=10.8 sequence=AGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTGAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTACTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=22.31 fanout-score-rank=3 prefix-density=0.43 prefix-fanout=8.3 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=51.37 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=12.4 sequence=TGTTGGTGGTGG SRR7169008 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:19:27 Started mapping on | Feb 10 16:19:28 Finished on | Feb 10 16:21:30 Mapping speed, Million of reads per hour | 480.99 Number of input reads | 16300143 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15185431 Uniquely mapped reads % | 93.16% Average mapped length | 294.80 Number of splices: Total | 13843313 Number of splices: Annotated (sjdb) | 13607909 Number of splices: GT/AG | 13635788 Number of splices: GC/AG | 163400 Number of splices: AT/AC | 11500 Number of splices: Non-canonical | 32625 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289238 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 95855 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.36% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 847318 847318 847318 N_multimapping 289238 289238 289238 N_noFeature 340186 15007336 417926 N_ambiguous 161290 919 60293 UnstrandedReadsAssigned:14683955 PositiveStrandReadsAssigned:177176 NegativeStrandReadsAssigned:14707212 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169008 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169008-trimmed-pair1.fastq SRR7169008-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,300,143 reads, 14,715,146 reads pseudoaligned [quant] estimated average fragment length: 239.824 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR7169008.ke.tsv 34699 SRR7169008.se.tsv 87100 total ==> SRR7169008.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.18 279 10.1577 Potri.005G024800.1.v4.1 1035 796.176 64 5.20694 Potri.004G059700.1.v4.1 961 722.239 4 0.358749 Potri.007G009000.2.v4.1 1416 1177.18 0 0 Potri.003G141000.2.v4.1 2943 2704.18 243.068 5.82243 Potri.016G087400.1.v4.1 270 77.7962 1433.11 1193.26 Potri.015G069301.1.v4.1 564 330.362 0 0 Potri.010G195200.1.v4.1 1773 1534.18 79 3.33552 Potri.012G127500.1.v4.1 977 738.202 5976 524.381 ==> SRR7169008.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1506 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169008 completed mapping pipeline successfully