Starting /dee2/code/volunteer_pipeline.sh SRR7169009 current disk space = 3058772238336 free memory = 1084244116 SRR7169009 SRAfilesize e967f9f1e4228c02383340650651d3ea SRR7169009.sra SRR7169009.sra file validated SRR7169009 is paired end SRR7169009 is conventional basespace SRR7169009 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169009_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0535 34.0 33.0 34.0 28.0 34.0 2 32.72425 34.0 33.0 34.0 28.0 34.0 3 32.97275 34.0 33.0 34.0 32.0 34.0 4 33.1365 34.0 33.0 34.0 32.0 34.0 5 33.09625 34.0 33.0 34.0 32.0 34.0 6 36.75825 38.0 37.0 38.0 34.0 38.0 7 37.107 38.0 38.0 38.0 36.0 38.0 8 37.247 38.0 38.0 38.0 36.0 38.0 9 37.264 38.0 38.0 38.0 37.0 38.0 10-14 37.23565 38.0 38.0 38.0 36.6 38.0 15-19 37.2456 38.0 38.0 38.0 36.6 38.0 20-24 37.210499999999996 38.0 38.0 38.0 36.6 38.0 25-29 37.11795 38.0 38.0 38.0 36.0 38.0 30-34 37.104850000000006 38.0 38.0 38.0 36.0 38.0 35-39 37.072199999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.88965 38.0 38.0 38.0 35.6 38.0 45-49 36.7871 38.0 38.0 38.0 35.0 38.0 50-54 36.6708 38.0 38.0 38.0 34.2 38.0 55-59 36.5916 38.0 38.0 38.0 34.2 38.0 60-64 36.53425 38.0 38.0 38.0 34.0 38.0 65-69 36.397749999999995 38.0 37.8 38.0 34.0 38.0 70-74 36.345600000000005 38.0 37.2 38.0 33.8 38.0 75-79 36.17705 38.0 37.2 38.0 33.0 38.0 80-84 36.068400000000004 38.0 37.0 38.0 32.8 38.0 85-89 36.06515 38.0 37.0 38.0 33.0 38.0 90-94 35.79185 38.0 37.0 38.0 31.0 38.0 95-99 35.457550000000005 38.0 36.2 38.0 29.2 38.0 100-104 35.1502 38.0 36.0 38.0 28.4 38.0 105-109 35.0458 38.0 36.0 38.0 28.2 38.0 110-114 34.9176 38.0 35.4 38.0 27.6 38.0 115-119 34.62270000000001 38.0 34.8 38.0 26.0 38.0 120-124 33.87425 38.0 34.2 38.0 20.0 38.0 125-129 33.567949999999996 38.0 34.0 38.0 19.4 38.0 130-134 33.661950000000004 38.0 34.0 38.0 21.8 38.0 135-139 33.07165 38.0 33.4 38.0 15.0 38.0 140-144 32.33985 37.4 32.6 38.0 14.4 38.0 145-149 30.8719 36.0 30.4 38.0 8.8 38.0 150-151 27.222375 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 2.0 15 3.0 16 5.0 17 4.0 18 7.0 19 5.0 20 7.0 21 7.0 22 8.0 23 12.0 24 12.0 25 31.0 26 34.0 27 36.0 28 42.0 29 61.0 30 83.0 31 111.0 32 137.0 33 164.0 34 248.0 35 408.0 36 880.0 37 1686.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.64062081883864 13.540272946213541 11.560074926411561 36.25903130853626 2 22.400000000000002 17.5 34.300000000000004 25.8 3 19.375 23.9 26.474999999999998 30.25 4 21.95 30.349999999999998 24.375 23.325000000000003 5 20.880220055013755 34.40860215053764 24.756189047261813 19.954988747186796 6 19.125 35.6 24.775 20.5 7 13.700000000000001 26.400000000000002 40.425 19.475 8 19.125 26.35 28.775000000000002 25.75 9 16.825000000000003 25.124999999999996 34.0 24.05 10-14 20.325 29.885 25.655 24.135 15-19 19.900000000000002 28.765 27.894999999999996 23.44 20-24 20.330000000000002 28.910000000000004 27.345000000000002 23.415 25-29 19.759999999999998 29.225 26.884999999999998 24.13 30-34 20.225 29.4 27.089999999999996 23.285 35-39 20.244999999999997 29.244999999999997 26.68 23.830000000000002 40-44 19.675 29.45 27.26 23.615 45-49 19.36 28.975 27.47 24.195 50-54 20.49 28.865000000000002 27.755000000000003 22.89 55-59 20.375 28.77 27.134999999999998 23.72 60-64 20.075000000000003 28.849999999999998 27.26 23.815 65-69 20.395 29.09 27.155 23.36 70-74 20.29 29.220000000000002 27.250000000000004 23.24 75-79 20.265 28.720000000000002 27.534999999999997 23.48 80-84 19.965 29.13 27.375 23.53 85-89 19.895 29.215000000000003 27.375 23.515 90-94 20.43 28.835 27.43 23.305 95-99 19.994999999999997 28.43 28.08 23.494999999999997 100-104 20.7 28.634999999999998 27.325 23.34 105-109 20.415 28.845 27.015 23.724999999999998 110-114 19.950000000000003 28.79 27.265 23.995 115-119 20.345 28.43 27.74 23.485 120-124 20.225 28.410000000000004 27.6 23.765 125-129 20.599999999999998 28.93 27.310000000000002 23.16 130-134 20.96 28.144999999999996 27.615000000000002 23.28 135-139 20.605 28.865000000000002 27.060000000000002 23.47 140-144 20.905 28.01 27.43 23.655 145-149 21.095 28.689999999999998 27.355 22.86 150-151 20.962500000000002 28.249999999999996 26.937499999999996 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.5 24 2.0 25 4.0 26 7.5 27 8.5 28 8.0 29 13.0 30 18.5 31 22.5 32 35.0 33 54.5 34 61.0 35 80.0 36 101.5 37 108.5 38 126.5 39 161.5 40 192.0 41 213.5 42 249.5 43 266.0 44 255.0 45 256.0 46 272.0 47 262.0 48 229.5 49 201.5 50 172.0 51 133.5 52 114.0 53 95.5 54 74.5 55 59.5 56 37.0 57 25.0 58 16.0 59 8.0 60 9.0 61 8.5 62 4.5 63 5.0 64 4.5 65 3.5 66 3.5 67 4.0 68 2.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.575 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.7250000000000001 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.025 0.0 0.0 0.0 0.0 132-133 1.0499999999999998 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACAA 10 0.0068378756 144.95 3 >>END_MODULE SRR7169009 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169009_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.51225 33.0 33.0 34.0 32.0 34.0 2 32.57775 33.0 33.0 34.0 32.0 34.0 3 32.584 33.0 33.0 34.0 32.0 34.0 4 32.549 33.0 33.0 34.0 32.0 34.0 5 32.5835 33.0 33.0 34.0 32.0 34.0 6 36.7605 38.0 38.0 38.0 35.0 38.0 7 36.89475 38.0 38.0 38.0 36.0 38.0 8 36.78275 38.0 38.0 38.0 36.0 38.0 9 36.86575 38.0 38.0 38.0 36.0 38.0 10-14 36.7962 38.0 38.0 38.0 35.6 38.0 15-19 36.74765 38.0 38.0 38.0 35.6 38.0 20-24 36.7519 38.0 38.0 38.0 35.8 38.0 25-29 36.667249999999996 38.0 38.0 38.0 35.4 38.0 30-34 36.5322 38.0 38.0 38.0 34.6 38.0 35-39 36.59224999999999 38.0 38.0 38.0 34.8 38.0 40-44 36.627199999999995 38.0 38.0 38.0 35.0 38.0 45-49 36.55305 38.0 38.0 38.0 34.4 38.0 50-54 36.526300000000006 38.0 38.0 38.0 34.4 38.0 55-59 36.3382 38.0 38.0 38.0 34.0 38.0 60-64 36.38325 38.0 38.0 38.0 34.0 38.0 65-69 36.22070000000001 38.0 38.0 38.0 33.6 38.0 70-74 36.16605 38.0 38.0 38.0 33.4 38.0 75-79 36.0236 38.0 38.0 38.0 32.6 38.0 80-84 35.89865 38.0 37.8 38.0 31.8 38.0 85-89 35.77355 38.0 37.0 38.0 30.6 38.0 90-94 35.7743 38.0 37.0 38.0 31.4 38.0 95-99 35.534349999999996 38.0 37.0 38.0 29.8 38.0 100-104 35.42155 38.0 37.0 38.0 29.0 38.0 105-109 35.3585 38.0 37.0 38.0 29.2 38.0 110-114 35.1839 38.0 36.6 38.0 28.6 38.0 115-119 34.79565 38.0 36.0 38.0 26.8 38.0 120-124 34.631899999999995 38.0 36.0 38.0 25.8 38.0 125-129 34.179700000000004 38.0 35.2 38.0 23.0 38.0 130-134 33.80195 38.0 35.0 38.0 21.8 38.0 135-139 33.32449999999999 38.0 34.4 38.0 16.2 38.0 140-144 32.8811 38.0 34.0 38.0 14.2 38.0 145-149 32.17524999999999 38.0 33.2 38.0 11.0 38.0 150-151 27.816499999999998 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 2.0 5 2.0 6 0.0 7 1.0 8 3.0 9 2.0 10 2.0 11 4.0 12 3.0 13 1.0 14 5.0 15 6.0 16 9.0 17 7.0 18 8.0 19 11.0 20 16.0 21 11.0 22 10.0 23 22.0 24 29.0 25 37.0 26 29.0 27 39.0 28 44.0 29 52.0 30 68.0 31 77.0 32 94.0 33 139.0 34 157.0 35 245.0 36 582.0 37 2272.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.07696164452244 21.233391827525697 15.066432689897216 26.62321383805465 2 27.81257830117765 26.409421197694815 29.64169381107492 16.136306690052617 3 21.03284031085485 29.405866131862624 29.957382802707443 19.603910754575082 4 22.005012531328322 35.21303258145363 23.909774436090224 18.87218045112782 5 24.43609022556391 37.24310776942356 20.100250626566414 18.220551378446114 6 21.371371371371374 37.26226226226226 22.972972972972975 18.393393393393392 7 19.11911911911912 20.47047047047047 39.58958958958959 20.82082082082082 8 21.246246246246248 25.325325325325327 27.52752752752753 25.900900900900904 9 21.22122122122122 24.924924924924923 29.654654654654657 24.1991991991992 10-14 23.289453926622954 28.239651634215928 26.58791731317884 21.88297712598228 15-19 23.029180639671658 27.67405776064868 28.10450973522198 21.19225186445768 20-24 22.786204134754968 27.887070130650248 27.897081643890477 21.42964409070431 25-29 23.04650347900085 28.202432797717375 27.386494468638933 21.36456925464284 30-34 23.04534988487336 27.45520072079287 28.641505656221845 20.857943738111924 35-39 22.885173691060164 27.7305035539093 28.05586144759235 21.328461307438182 40-44 22.89247096515819 27.813376051261514 28.44413295955146 20.850020024028833 45-49 23.41544007209372 27.245419044758183 28.261740262341046 21.077400620807047 50-54 23.180498548403243 28.186004605065573 27.805586144759236 20.82791070177195 55-59 23.73229213595635 27.121189367772942 28.397657305901784 20.748861190368924 60-64 22.478097622027533 27.784730913642054 28.74092615769712 20.99624530663329 65-69 23.13507559827776 28.331831380795037 27.726043857014123 20.80704916391309 70-74 23.257560584818744 28.159423192469458 27.738834368115363 20.844181854596435 75-79 23.066139288038855 28.097932208481453 28.253141741350824 20.582786762128872 80-84 23.148565419858798 27.85038305543037 28.06569525812428 20.93535626658655 85-89 23.428972009413652 27.870412097541436 28.561414050373042 20.139201842671874 90-94 23.241023586559166 27.727978366468026 27.567729981471278 21.463268065501527 95-99 22.97060443687716 27.758024938654913 28.50418148129601 20.767189143171915 100-104 23.67669888326907 27.137062446792527 28.2437778556763 20.942460814262105 105-109 23.54296014420188 27.55357500500701 28.18946525135189 20.713999599439216 110-114 23.957342412256548 27.427026485755768 28.147999799729632 20.46763130225805 115-119 23.704111784444333 26.8893674563029 28.707367155807084 20.699153603445687 120-124 23.244867300951427 27.44616925388082 28.82824236354532 20.480721081622434 125-129 23.615423134702056 28.052078117175768 27.986980470706058 20.345518277416126 130-134 23.62780448717949 27.804487179487182 27.904647435897434 20.663060897435898 135-139 23.670505758637958 27.811717576364547 28.327491236855284 20.190285428142214 140-144 23.93449191165423 27.73075574698252 27.740772274252517 20.59398006711073 145-149 24.34530068599469 27.805317710680487 27.590005507986582 20.25937609533824 150-151 23.945424959319066 27.963449743397174 28.063587432719988 20.027537864563776 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 0.5 24 0.5 25 2.0 26 2.5 27 5.0 28 7.0 29 8.0 30 12.0 31 13.5 32 21.0 33 34.0 34 39.0 35 57.5 36 84.5 37 113.5 38 135.5 39 163.0 40 200.0 41 231.0 42 258.0 43 280.5 44 294.5 45 287.0 46 279.5 47 262.0 48 224.0 49 185.0 50 169.0 51 150.0 52 120.5 53 86.5 54 65.5 55 61.5 56 42.0 57 28.0 58 22.0 59 14.5 60 10.5 61 7.5 62 3.5 63 1.0 64 1.5 65 2.0 66 2.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.22499999999999998 3 0.27499999999999997 4 0.25 5 0.25 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.105 15-19 0.105 20-24 0.11499999999999999 25-29 0.11499999999999999 30-34 0.11 35-39 0.11 40-44 0.12 45-49 0.13 50-54 0.11 55-59 0.11499999999999999 60-64 0.125 65-69 0.13 70-74 0.13999999999999999 75-79 0.135 80-84 0.145 85-89 0.145 90-94 0.155 95-99 0.155 100-104 0.155 105-109 0.13999999999999999 110-114 0.135 115-119 0.165 120-124 0.15 125-129 0.15 130-134 0.16 135-139 0.15 140-144 0.165 145-149 0.145 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.4273504273504274 0.8500000000000001 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.125 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.2625000000000002 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.4500000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCATTC 10 0.006830828 145.0 9 >>END_MODULE Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra Read 959616 spots for SRR7169009.sra Written 959616 spots for SRR7169009.sra Read 959606 spots for SRR7169009.sra Written 959606 spots for SRR7169009.sra SRR ids: ['SRR7169009.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v9aiypnc SRR7169009.sra spots: 19192130 blocks: [[1, 959606], [959607, 1919212], [1919213, 2878818], [2878819, 3838424], [3838425, 4798030], [4798031, 5757636], [5757637, 6717242], [6717243, 7676848], [7676849, 8636454], [8636455, 9596060], [9596061, 10555666], [10555667, 11515272], [11515273, 12474878], [12474879, 13434484], [13434485, 14394090], [14394091, 15353696], [15353697, 16313302], [16313303, 17272908], [17272909, 18232514], [18232515, 19192130]] SRR7169009 file size 6481882 SRR7169009 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169009 SRR7169009_1.fastq SRR7169009_2.fastq Input file: SRR7169009_1.fastq Paired file: SRR7169009_2.fastq trimmed: SRR7169009-trimmed-pair1.fastq, SRR7169009-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:53:16 2025 >> started Mon Feb 10 15:53:38 2025 >> done (21.851s) 19192130 read pairs processed; of these: 22976 ( 0.12%) short read pairs filtered out after trimming by size control 66261 ( 0.35%) empty read pairs filtered out after trimming by size control 19102893 (99.54%) read pairs available; of these: 9158981 (47.95%) trimmed read pairs available after processing 9943912 (52.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 0 0.00% 20 4 0.00% 21 5 0.00% 22 5 0.00% 23 6 0.00% 24 6 0.00% 25 3 0.00% 26 7 0.00% 27 7 0.00% 28 7 0.00% 29 5 0.00% 30 12 0.00% 31 10 0.00% 32 8 0.00% 33 17 0.00% 34 10 0.00% 35 11 0.00% 36 19 0.00% 37 13 0.00% 38 12 0.00% 39 15 0.00% 40 18 0.00% 41 16 0.00% 42 20 0.00% 43 29 0.00% 44 25 0.00% 45 25 0.00% 46 20 0.00% 47 33 0.00% 48 33 0.00% 49 32 0.00% 50 46 0.00% 51 42 0.00% 52 61 0.00% 53 59 0.00% 54 63 0.00% 55 69 0.00% 56 76 0.00% 57 81 0.00% 58 77 0.00% 59 92 0.00% 60 112 0.00% 61 145 0.00% 62 175 0.00% 63 175 0.00% 64 201 0.00% 65 181 0.00% 66 218 0.00% 67 298 0.00% 68 323 0.00% 69 328 0.00% 70 371 0.00% 71 391 0.00% 72 460 0.00% 73 498 0.00% 74 538 0.00% 75 605 0.00% 76 654 0.00% 77 813 0.00% 78 885 0.00% 79 970 0.01% 80 1117 0.01% 81 1291 0.01% 82 1435 0.01% 83 1715 0.01% 84 2654 0.01% 85 3092 0.02% 86 3272 0.02% 87 3348 0.02% 88 3565 0.02% 89 3695 0.02% 90 3794 0.02% 91 4056 0.02% 92 4380 0.02% 93 4702 0.02% 94 5149 0.03% 95 5178 0.03% 96 5536 0.03% 97 5795 0.03% 98 6127 0.03% 99 6463 0.03% 100 7038 0.04% 101 7566 0.04% 102 8018 0.04% 103 8834 0.05% 104 9231 0.05% 105 9903 0.05% 106 10429 0.05% 107 10858 0.06% 108 11489 0.06% 109 12106 0.06% 110 12747 0.07% 111 13833 0.07% 112 14625 0.08% 113 15761 0.08% 114 16791 0.09% 115 18050 0.09% 116 19167 0.10% 117 20062 0.11% 118 20847 0.11% 119 22013 0.12% 120 23183 0.12% 121 24861 0.13% 122 26571 0.14% 123 28361 0.15% 124 30517 0.16% 125 32614 0.17% 126 35213 0.18% 127 37572 0.20% 128 39149 0.20% 129 42168 0.22% 130 44946 0.24% 131 47615 0.25% 132 51781 0.27% 133 55684 0.29% 134 60006 0.31% 135 65439 0.34% 136 70455 0.37% 137 76401 0.40% 138 83135 0.44% 139 90965 0.48% 140 100634 0.53% 141 113238 0.59% 142 127699 0.67% 143 149043 0.78% 144 173869 0.91% 145 210934 1.10% 146 267973 1.40% 147 367069 1.92% 148 559453 2.93% 149 1078616 5.65% 150 4688640 24.54% 151 9943912 52.05% 19102893 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=37 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=257.31 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=18.5 sequence=TGCTTTCTTTTCCGTTACATAAGTCTTTACTGTTTGAAGCATAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=38 prefix-density=0.30 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=27 fanout-score=215.87 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=27.2 sequence=AAGAAGAAGAAA SRR7169009 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:54:20 Started mapping on | Feb 10 15:54:20 Finished on | Feb 10 15:56:24 Mapping speed, Million of reads per hour | 554.60 Number of input reads | 19102893 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17945637 Uniquely mapped reads % | 93.94% Average mapped length | 295.92 Number of splices: Total | 16803125 Number of splices: Annotated (sjdb) | 16535486 Number of splices: GT/AG | 16562991 Number of splices: GC/AG | 188590 Number of splices: AT/AC | 13306 Number of splices: Non-canonical | 38238 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350063 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 37691 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 826025 826025 826025 N_multimapping 350063 350063 350063 N_noFeature 398102 17751880 476101 N_ambiguous 186492 955 70042 UnstrandedReadsAssigned:17361043 PositiveStrandReadsAssigned:192802 NegativeStrandReadsAssigned:17399494 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169009 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169009-trimmed-pair1.fastq SRR7169009-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,102,893 reads, 17,304,838 reads pseudoaligned [quant] estimated average fragment length: 272.487 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR7169009.ke.tsv 34699 SRR7169009.se.tsv 87100 total ==> SRR7169009.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.51 297 9.00812 Potri.005G024800.1.v4.1 1035 763.513 56 3.88527 Potri.004G059700.1.v4.1 961 689.579 4 0.307274 Potri.007G009000.2.v4.1 1416 1144.51 0 0 Potri.003G141000.2.v4.1 2943 2671.51 271.079 5.37511 Potri.016G087400.1.v4.1 270 63.2615 1512 1266.08 Potri.015G069301.1.v4.1 564 299.718 0 0 Potri.010G195200.1.v4.1 1773 1501.51 26 0.917263 Potri.012G127500.1.v4.1 977 705.543 5936 445.676 ==> SRR7169009.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1591 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169009 completed mapping pipeline successfully