Starting /dee2/code/volunteer_pipeline.sh SRR7169010 current disk space = 3059078754304 free memory = 1205024808 SRR7169010 SRAfilesize e643c3a50baf5cad1a881fd44d020ecb SRR7169010.sra SRR7169010.sra file validated SRR7169010 is paired end SRR7169010 is conventional basespace SRR7169010 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169010_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88975 34.0 33.0 34.0 32.0 34.0 2 32.977 34.0 33.0 34.0 32.0 34.0 3 33.11025 34.0 33.0 34.0 32.0 34.0 4 32.86775 34.0 33.0 34.0 32.0 34.0 5 32.6625 34.0 33.0 34.0 32.0 34.0 6 36.497 38.0 37.0 38.0 34.0 38.0 7 37.07975 38.0 38.0 38.0 36.0 38.0 8 37.24675 38.0 38.0 38.0 36.0 38.0 9 37.235 38.0 38.0 38.0 37.0 38.0 10-14 37.31320000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.185649999999995 38.0 38.0 38.0 36.0 38.0 20-24 37.12525 38.0 38.0 38.0 36.0 38.0 25-29 36.97055 38.0 38.0 38.0 35.4 38.0 30-34 36.90815 38.0 38.0 38.0 35.4 38.0 35-39 36.82705 38.0 38.0 38.0 34.8 38.0 40-44 36.48005 38.0 38.0 38.0 33.8 38.0 45-49 36.5988 38.0 38.0 38.0 34.0 38.0 50-54 36.57424999999999 38.0 38.0 38.0 34.0 38.0 55-59 36.334250000000004 38.0 37.6 38.0 33.6 38.0 60-64 36.43825 38.0 37.4 38.0 34.0 38.0 65-69 36.39035 38.0 37.4 38.0 34.0 38.0 70-74 36.295 38.0 37.0 38.0 33.2 38.0 75-79 36.018299999999996 38.0 37.0 38.0 32.2 38.0 80-84 35.978049999999996 38.0 37.0 38.0 32.6 38.0 85-89 35.486000000000004 38.0 36.6 38.0 29.2 38.0 90-94 35.277150000000006 38.0 36.0 38.0 29.0 38.0 95-99 35.43805 38.0 36.0 38.0 29.0 38.0 100-104 34.869 38.0 35.2 38.0 27.0 38.0 105-109 35.217200000000005 38.0 36.0 38.0 28.8 38.0 110-114 34.7603 38.0 35.0 38.0 26.2 38.0 115-119 34.42095 38.0 34.8 38.0 24.4 38.0 120-124 34.23929999999999 38.0 34.4 38.0 24.2 38.0 125-129 33.23455 37.8 32.8 38.0 17.4 38.0 130-134 33.2085 37.8 33.6 38.0 18.6 38.0 135-139 32.62455 36.8 31.2 38.0 17.2 38.0 140-144 32.675200000000004 37.8 32.2 38.0 15.8 38.0 145-149 30.939799999999998 36.0 31.0 38.0 8.6 38.0 150-151 25.84725 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 2.0 17 2.0 18 1.0 19 4.0 20 5.0 21 8.0 22 18.0 23 13.0 24 17.0 25 19.0 26 34.0 27 44.0 28 46.0 29 69.0 30 96.0 31 129.0 32 154.0 33 198.0 34 289.0 35 464.0 36 910.0 37 1471.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.475 14.325 9.5 36.7 2 21.6 17.25 33.125 28.025 3 19.275000000000002 24.0 26.625 30.099999999999998 4 20.974999999999998 31.424999999999997 22.900000000000002 24.7 5 21.466364323507182 35.44973544973545 23.28042328042328 19.80347694633409 6 19.2 35.3 24.675 20.825 7 14.2 25.974999999999998 41.699999999999996 18.125 8 17.75 25.724999999999998 28.7 27.825 9 17.775 25.324999999999996 32.05 24.85 10-14 19.275000000000002 30.764999999999997 25.895000000000003 24.065 15-19 19.919999999999998 29.92 26.525 23.635 20-24 19.79 29.29 27.284999999999997 23.635 25-29 19.12 29.78 27.26 23.84 30-34 19.45 30.080000000000002 27.084999999999997 23.385 35-39 19.79 29.585 26.91 23.715 40-44 19.175 29.470000000000002 27.735 23.62 45-49 19.515 29.485 26.895000000000003 24.104999999999997 50-54 19.56 29.335 27.73 23.375 55-59 19.693862238007103 29.84342954329448 26.707018158171174 23.755690060527236 60-64 19.495 29.154999999999998 27.365000000000002 23.985 65-69 19.285 29.244999999999997 27.169999999999998 24.3 70-74 20.185 29.475 27.025 23.315 75-79 20.153099514684545 28.078250863060987 27.54290288687647 24.225746735377996 80-84 19.850918004902695 28.53069188053429 27.525138826354496 24.093251288208513 85-89 19.955931694125894 28.08352947067955 27.953327657869696 24.00721117732485 90-94 19.729021859574896 29.243477384909845 27.03737282159766 23.9901279339176 95-99 20.445 28.794999999999998 26.695 24.065 100-104 20.64 28.54 27.235 23.585 105-109 20.09024818250188 28.3329155176736 27.81649536224618 23.760340937578338 110-114 19.685 29.285 26.995 24.035 115-119 19.81 29.134999999999998 27.115000000000002 23.94 120-124 20.560000000000002 28.294999999999998 26.985 24.16 125-129 20.535 27.884999999999998 27.715 23.865 130-134 20.878351340536213 27.886154461784713 27.00080032012805 24.23469387755102 135-139 20.13 28.17 27.560000000000002 24.14 140-144 20.169999999999998 27.855 27.705000000000002 24.27 145-149 20.74540418030723 27.70083102493075 27.45907831780408 24.094686476957943 150-151 21.245467050143805 27.635363261222956 26.722520945354507 24.39664874327873 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 1.0 21 0.0 22 0.5 23 1.5 24 2.0 25 2.5 26 5.0 27 5.5 28 7.0 29 12.0 30 19.0 31 30.0 32 39.5 33 49.5 34 70.0 35 85.5 36 100.0 37 121.5 38 137.5 39 173.0 40 209.0 41 230.5 42 237.5 43 242.0 44 254.0 45 272.5 46 279.0 47 234.0 48 198.5 49 189.0 50 162.0 51 123.5 52 106.0 53 95.5 54 72.5 55 56.5 56 45.0 57 36.5 58 28.0 59 16.5 60 13.0 61 9.5 62 7.5 63 7.5 64 3.0 65 2.0 66 1.0 67 0.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.775 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.045 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.065 80-84 0.055 85-89 0.155 90-94 0.73 95-99 0.0 100-104 0.0 105-109 0.27499999999999997 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.04 135-139 0.0 140-144 0.0 145-149 0.7250000000000001 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.9125 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.4500000000000002 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.7375 0.0 0.0 0.0 0.0 136-137 1.8875 0.0 0.0 0.0 0.0 138-139 2.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169010 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169010_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40725 33.0 33.0 34.0 32.0 34.0 2 32.45175 33.0 33.0 34.0 32.0 34.0 3 32.4445 34.0 33.0 34.0 32.0 34.0 4 32.23675 34.0 33.0 34.0 32.0 34.0 5 32.44025 34.0 33.0 34.0 32.0 34.0 6 36.332 38.0 38.0 38.0 34.0 38.0 7 36.45725 38.0 38.0 38.0 35.0 38.0 8 35.99725 38.0 38.0 38.0 34.0 38.0 9 36.22925 38.0 38.0 38.0 34.0 38.0 10-14 36.1678 38.0 38.0 38.0 33.8 38.0 15-19 36.064800000000005 38.0 38.0 38.0 33.6 38.0 20-24 36.326550000000005 38.0 38.0 38.0 34.6 38.0 25-29 36.28245 38.0 38.0 38.0 34.6 38.0 30-34 36.148399999999995 38.0 38.0 38.0 34.0 38.0 35-39 36.17255 38.0 38.0 38.0 34.0 38.0 40-44 36.30045 38.0 38.0 38.0 34.8 38.0 45-49 36.180099999999996 38.0 38.0 38.0 34.6 38.0 50-54 35.97565 38.0 38.0 38.0 33.6 38.0 55-59 35.27475 38.0 38.0 38.0 29.0 38.0 60-64 35.3294 38.0 38.0 38.0 29.6 38.0 65-69 35.3299 38.0 38.0 38.0 29.8 38.0 70-74 35.79925 38.0 38.0 38.0 33.2 38.0 75-79 35.5118 38.0 38.0 38.0 29.8 38.0 80-84 35.511849999999995 38.0 38.0 38.0 31.4 38.0 85-89 35.537549999999996 38.0 37.6 38.0 30.8 38.0 90-94 35.631150000000005 38.0 38.0 38.0 32.0 38.0 95-99 35.32875 38.0 37.4 38.0 30.2 38.0 100-104 35.24785 38.0 37.0 38.0 30.0 38.0 105-109 34.797850000000004 38.0 36.8 38.0 27.0 38.0 110-114 34.475 38.0 36.6 38.0 24.2 38.0 115-119 34.4178 38.0 36.2 38.0 24.0 38.0 120-124 34.45105 38.0 36.0 38.0 25.0 38.0 125-129 34.1878 38.0 35.0 38.0 23.4 38.0 130-134 34.1019 38.0 35.0 38.0 23.0 38.0 135-139 33.61295 38.0 34.8 38.0 20.2 38.0 140-144 32.84015 38.0 33.8 38.0 14.0 38.0 145-149 31.450349999999997 38.0 31.8 38.0 6.4 38.0 150-151 27.842875 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 44.0 3 8.0 4 2.0 5 4.0 6 6.0 7 6.0 8 7.0 9 2.0 10 4.0 11 3.0 12 1.0 13 5.0 14 2.0 15 3.0 16 9.0 17 9.0 18 3.0 19 5.0 20 15.0 21 16.0 22 18.0 23 23.0 24 16.0 25 26.0 26 42.0 27 42.0 28 39.0 29 47.0 30 66.0 31 85.0 32 93.0 33 124.0 34 138.0 35 252.0 36 562.0 37 2273.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.50226928895613 20.726172465960666 16.061522945032777 24.71003530005043 2 28.52121516444891 25.33266382124027 28.6718553853879 17.47426562892292 3 20.26309132304579 28.914748292436126 30.862635972678977 19.959524411839112 4 24.224707676664973 32.89273004575496 24.377224199288257 18.505338078291814 5 23.84056154424668 36.97668588618701 20.732013035848585 18.450739533717726 6 20.916833667334668 37.07414829659319 24.37374749498998 17.635270541082164 7 20.694864048338367 21.097683786505538 38.26787512588117 19.939577039274926 8 23.678861788617887 23.932926829268293 26.448170731707314 25.940040650406505 9 21.482602118003026 26.82803832576904 29.27382753403933 22.415532022188604 10-14 24.051271699636658 28.441663302381915 26.539160274525635 20.967904723455792 15-19 22.85222497848428 28.360249076089705 27.58062066521541 21.2069052802106 20-24 24.195416771594058 27.665575421808107 27.55980861244019 20.579199194157642 25-29 23.605817452357073 28.199598796389168 27.52256770310933 20.672016048144435 30-34 23.023536511768256 28.042647354657014 27.91188895594448 21.021927177630257 35-39 24.06268897399718 27.988308808707924 27.741382785728685 20.20761943156622 40-44 23.566975060337892 28.27835880933226 28.047063555913116 20.107602574416735 45-49 23.63809810714465 27.559371391273785 27.950996636039566 20.851533865542 50-54 23.943023958123614 28.12059593315885 27.55687537749144 20.379504731226092 55-59 23.48794442174091 27.671638741315896 27.605230894973438 21.23518594196976 60-64 23.6358987471235 27.50191766811557 28.41217080030683 20.450012784454106 65-69 23.786855036855037 27.303439803439804 28.403972153972152 20.505733005733006 70-74 24.05958091391063 27.90204493814693 27.452663468821004 20.585710679121433 75-79 23.55173286111814 28.226663293700987 27.821907412092084 20.399696433088792 80-84 23.6911525974026 27.795251623376622 27.800324675324678 20.7132711038961 85-89 23.32481331128151 27.644965669322907 28.587179872700847 20.443041146694732 90-94 23.74436090225564 28.135338345864664 27.654135338345863 20.466165413533837 95-99 23.97546135666516 27.90767838286318 27.756826067280134 20.36003419319153 100-104 24.337264388670494 27.618183650841647 27.981050297349057 20.063501663138798 105-109 24.40261782760895 27.527776368525185 28.16701334280351 19.90259246106235 110-114 23.58775113746741 27.447472010633405 28.316548233730384 20.648228618168805 115-119 24.15390096188101 28.210087027329635 27.736780497735253 19.8992315130541 120-124 24.372023063424418 27.686136876410128 27.41539232890449 20.52644773126097 125-129 24.814294318409956 27.62497490463762 27.64003212206384 19.92069865488858 130-134 24.30572992517451 28.06207000451966 27.765781147993774 19.866418922312057 135-139 24.22478675363773 27.832413447064724 27.81736076266934 20.125439036628197 140-144 24.719891473647188 27.840024116967292 27.84504848515299 19.59503592423253 145-149 24.248527264488192 27.546447812295455 27.727707567594784 20.47731735562157 150-151 25.03138337936229 27.629927190559876 27.46673361787597 19.871955812201858 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.5 10 1.5 11 0.5 12 1.0 13 2.5 14 3.0 15 2.5 16 1.0 17 0.5 18 2.0 19 4.5 20 5.0 21 4.0 22 3.0 23 4.0 24 5.0 25 2.5 26 3.5 27 7.5 28 9.5 29 15.0 30 16.0 31 13.5 32 18.0 33 32.5 34 47.0 35 57.0 36 80.5 37 101.0 38 127.5 39 160.0 40 189.0 41 224.0 42 242.5 43 253.5 44 285.0 45 304.5 46 302.5 47 275.5 48 236.5 49 197.5 50 157.5 51 142.5 52 114.5 53 88.5 54 72.0 55 46.5 56 37.0 57 31.5 58 17.0 59 11.5 60 11.0 61 6.5 62 4.5 63 3.5 64 3.0 65 2.0 66 2.0 67 2.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.42500000000000004 3 1.175 4 1.6500000000000001 5 0.27499999999999997 6 0.2 7 0.7000000000000001 8 1.6 9 0.8500000000000001 10-14 0.9199999999999999 15-19 1.2349999999999999 20-24 0.7250000000000001 25-29 0.3 30-34 0.58 35-39 0.7799999999999999 40-44 0.5599999999999999 45-49 0.415 50-54 0.66 55-59 2.12 60-64 2.225 65-69 2.32 70-74 0.975 75-79 1.175 80-84 1.44 85-89 0.23500000000000001 90-94 0.25 95-99 0.565 100-104 0.79 105-109 1.4449999999999998 110-114 2.1950000000000003 115-119 1.755 120-124 0.27499999999999997 125-129 0.38 130-134 0.43499999999999994 135-139 0.35000000000000003 140-144 0.485 145-149 0.695 150-151 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.075 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.3250000000000002 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.65 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.0999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875098 spots for SRR7169010.sra Written 875098 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra Read 875084 spots for SRR7169010.sra Written 875084 spots for SRR7169010.sra SRR ids: ['SRR7169010.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5yhvesxs SRR7169010.sra spots: 17501694 blocks: [[1, 875084], [875085, 1750168], [1750169, 2625252], [2625253, 3500336], [3500337, 4375420], [4375421, 5250504], [5250505, 6125588], [6125589, 7000672], [7000673, 7875756], [7875757, 8750840], [8750841, 9625924], [9625925, 10501008], [10501009, 11376092], [11376093, 12251176], [12251177, 13126260], [13126261, 14001344], [14001345, 14876428], [14876429, 15751512], [15751513, 16626596], [16626597, 17501694]] SRR7169010 file size 5909049 SRR7169010 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169010 SRR7169010_1.fastq SRR7169010_2.fastq Input file: SRR7169010_1.fastq Paired file: SRR7169010_2.fastq trimmed: SRR7169010-trimmed-pair1.fastq, SRR7169010-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:31:55 2025 >> started Mon Feb 10 15:32:14 2025 >> done (19.271s) 17501694 read pairs processed; of these: 37153 ( 0.21%) short read pairs filtered out after trimming by size control 36345 ( 0.21%) empty read pairs filtered out after trimming by size control 17428196 (99.58%) read pairs available; of these: 8171365 (46.89%) trimmed read pairs available after processing 9256831 (53.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 5 0.00% 21 3 0.00% 22 7 0.00% 23 6 0.00% 24 4 0.00% 25 4 0.00% 26 6 0.00% 27 11 0.00% 28 6 0.00% 29 5 0.00% 30 12 0.00% 31 8 0.00% 32 9 0.00% 33 7 0.00% 34 9 0.00% 35 8 0.00% 36 7 0.00% 37 9 0.00% 38 11 0.00% 39 18 0.00% 40 20 0.00% 41 13 0.00% 42 13 0.00% 43 25 0.00% 44 15 0.00% 45 7 0.00% 46 23 0.00% 47 29 0.00% 48 22 0.00% 49 34 0.00% 50 26 0.00% 51 26 0.00% 52 44 0.00% 53 26 0.00% 54 49 0.00% 55 45 0.00% 56 52 0.00% 57 69 0.00% 58 55 0.00% 59 75 0.00% 60 76 0.00% 61 81 0.00% 62 114 0.00% 63 108 0.00% 64 152 0.00% 65 140 0.00% 66 178 0.00% 67 208 0.00% 68 247 0.00% 69 267 0.00% 70 293 0.00% 71 318 0.00% 72 393 0.00% 73 419 0.00% 74 516 0.00% 75 556 0.00% 76 582 0.00% 77 684 0.00% 78 755 0.00% 79 839 0.00% 80 995 0.01% 81 1172 0.01% 82 1425 0.01% 83 1647 0.01% 84 3283 0.02% 85 3730 0.02% 86 3835 0.02% 87 3889 0.02% 88 4151 0.02% 89 4257 0.02% 90 4437 0.03% 91 4426 0.03% 92 4750 0.03% 93 5133 0.03% 94 5309 0.03% 95 5515 0.03% 96 5865 0.03% 97 6180 0.04% 98 6425 0.04% 99 6668 0.04% 100 7072 0.04% 101 7383 0.04% 102 8043 0.05% 103 8477 0.05% 104 9026 0.05% 105 9814 0.06% 106 10064 0.06% 107 10474 0.06% 108 11074 0.06% 109 11790 0.07% 110 12518 0.07% 111 12631 0.07% 112 13582 0.08% 113 14661 0.08% 114 15688 0.09% 115 16459 0.09% 116 17285 0.10% 117 18290 0.10% 118 18885 0.11% 119 19656 0.11% 120 20631 0.12% 121 22432 0.13% 122 23380 0.13% 123 24824 0.14% 124 26346 0.15% 125 28315 0.16% 126 30141 0.17% 127 31670 0.18% 128 33600 0.19% 129 35775 0.21% 130 38045 0.22% 131 40563 0.23% 132 43397 0.25% 133 46797 0.27% 134 51607 0.30% 135 56276 0.32% 136 60514 0.35% 137 64967 0.37% 138 71040 0.41% 139 78837 0.45% 140 86803 0.50% 141 96533 0.55% 142 110428 0.63% 143 127163 0.73% 144 151848 0.87% 145 187050 1.07% 146 239295 1.37% 147 327428 1.88% 148 493698 2.83% 149 932159 5.35% 150 4246081 24.36% 151 9256831 53.11% 17428196 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=33 prefix-density=0.15 prefix-fanout=3.2 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=142.68 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=18.9 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=27 prefix-density=0.24 prefix-fanout=3.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=283.76 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=30.0 sequence=AAGAAGAAGAAA SRR7169010 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:33:06 Started mapping on | Feb 10 15:33:06 Finished on | Feb 10 15:34:56 Mapping speed, Million of reads per hour | 570.38 Number of input reads | 17428196 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16381916 Uniquely mapped reads % | 94.00% Average mapped length | 295.90 Number of splices: Total | 14740426 Number of splices: Annotated (sjdb) | 14461334 Number of splices: GT/AG | 14500386 Number of splices: GC/AG | 191049 Number of splices: AT/AC | 12639 Number of splices: Non-canonical | 36352 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314935 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 51900 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.84% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 764150 764150 764150 N_multimapping 314935 314935 314935 N_noFeature 433156 16180533 532335 N_ambiguous 174475 1359 71353 UnstrandedReadsAssigned:15774285 PositiveStrandReadsAssigned:200024 NegativeStrandReadsAssigned:15778228 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169010 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169010-trimmed-pair1.fastq SRR7169010-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,428,196 reads, 15,748,544 reads pseudoaligned [quant] estimated average fragment length: 256.093 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR7169010.ke.tsv 34699 SRR7169010.se.tsv 87100 total ==> SRR7169010.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.91 347 10.9186 Potri.005G024800.1.v4.1 1035 779.907 146 10.3843 Potri.004G059700.1.v4.1 961 705.949 6 0.471462 Potri.007G009000.2.v4.1 1416 1160.91 0 0 Potri.003G141000.2.v4.1 2943 2687.91 392.17 8.09336 Potri.016G087400.1.v4.1 270 68.3449 1900.55 1542.56 Potri.015G069301.1.v4.1 564 313.335 0 0 Potri.010G195200.1.v4.1 1773 1517.91 150 5.48169 Potri.012G127500.1.v4.1 977 721.939 18178 1396.74 ==> SRR7169010.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2014 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 453 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169010 completed mapping pipeline successfully