Starting /dee2/code/volunteer_pipeline.sh SRR7169011 current disk space = 3058990751744 free memory = 1205117700 SRR7169011 SRAfilesize 1733b4e3aaa44f04c67d250830758544 SRR7169011.sra SRR7169011.sra file validated SRR7169011 is paired end SRR7169011 is conventional basespace SRR7169011 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169011_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.66375 34.0 33.0 34.0 25.0 34.0 2 32.63175 34.0 33.0 34.0 28.0 34.0 3 32.92675 34.0 33.0 34.0 32.0 34.0 4 33.1445 34.0 33.0 34.0 32.0 34.0 5 33.13625 34.0 33.0 34.0 32.0 34.0 6 36.78525 38.0 37.0 38.0 35.0 38.0 7 37.20025 38.0 38.0 38.0 36.0 38.0 8 37.339 38.0 38.0 38.0 37.0 38.0 9 37.449 38.0 38.0 38.0 37.0 38.0 10-14 37.28779999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.3275 38.0 38.0 38.0 37.0 38.0 20-24 37.2923 38.0 38.0 38.0 37.0 38.0 25-29 37.243100000000005 38.0 38.0 38.0 36.8 38.0 30-34 37.25715 38.0 38.0 38.0 37.0 38.0 35-39 37.16605 38.0 38.0 38.0 36.6 38.0 40-44 37.03305 38.0 38.0 38.0 35.8 38.0 45-49 36.912349999999996 38.0 38.0 38.0 35.2 38.0 50-54 36.81025 38.0 38.0 38.0 35.0 38.0 55-59 36.717949999999995 38.0 38.0 38.0 34.8 38.0 60-64 36.65225 38.0 38.0 38.0 34.0 38.0 65-69 36.53915 38.0 38.0 38.0 34.0 38.0 70-74 36.56335 38.0 38.0 38.0 34.0 38.0 75-79 36.345 38.0 37.4 38.0 33.8 38.0 80-84 36.236399999999996 38.0 37.2 38.0 33.4 38.0 85-89 36.19855 38.0 37.0 38.0 33.2 38.0 90-94 35.9623 38.0 37.0 38.0 32.2 38.0 95-99 35.655449999999995 38.0 36.8 38.0 30.6 38.0 100-104 35.24425 38.0 36.0 38.0 28.6 38.0 105-109 35.2332 38.0 36.0 38.0 29.0 38.0 110-114 34.920500000000004 38.0 35.6 38.0 27.6 38.0 115-119 34.643150000000006 38.0 35.0 38.0 26.4 38.0 120-124 33.971450000000004 38.0 34.2 38.0 22.4 38.0 125-129 33.5275 38.0 34.0 38.0 18.6 38.0 130-134 33.88055 38.0 34.2 38.0 23.0 38.0 135-139 33.288650000000004 38.0 34.0 38.0 17.4 38.0 140-144 32.5952 38.0 33.2 38.0 14.4 38.0 145-149 30.901400000000002 36.0 30.6 38.0 8.6 38.0 150-151 27.464 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 5.0 17 6.0 18 3.0 19 11.0 20 12.0 21 9.0 22 8.0 23 17.0 24 10.0 25 28.0 26 30.0 27 34.0 28 46.0 29 40.0 30 74.0 31 87.0 32 119.0 33 172.0 34 228.0 35 370.0 36 965.0 37 1719.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.80151843817787 13.015184381778742 10.981561822125814 37.20173535791757 2 22.775000000000002 16.175 34.699999999999996 26.35 3 19.825 21.0 27.275 31.900000000000002 4 21.224999999999998 29.775000000000002 24.65 24.349999999999998 5 20.880220055013755 32.0830207551888 24.85621405351338 22.18054513628407 6 20.75 35.699999999999996 23.375 20.175 7 14.975 27.525 39.324999999999996 18.175 8 18.099999999999998 26.825 29.375 25.7 9 16.2 26.25 32.4 25.15 10-14 20.54 29.654999999999998 26.619999999999997 23.185 15-19 19.625 29.115000000000002 26.6 24.66 20-24 20.32 28.675 27.015 23.990000000000002 25-29 19.439999999999998 30.42 26.655 23.485 30-34 19.725 29.26 26.784999999999997 24.23 35-39 20.175 28.975 26.939999999999998 23.91 40-44 20.155 29.26 27.075 23.51 45-49 20.244999999999997 29.04 26.765 23.95 50-54 20.599999999999998 29.099999999999998 26.834999999999997 23.465 55-59 20.3 29.13 26.6 23.97 60-64 20.215 28.810000000000002 26.950000000000003 24.025 65-69 20.31 28.435 27.310000000000002 23.945 70-74 20.78 28.799999999999997 27.01 23.41 75-79 20.32 28.694999999999997 26.715 24.27 80-84 20.495 28.71 27.134999999999998 23.66 85-89 21.145 28.675 26.69 23.49 90-94 20.27 28.665000000000003 27.045 24.02 95-99 21.32 27.87 27.27 23.54 100-104 20.4 28.895 27.315 23.39 105-109 20.715 28.01 27.565 23.71 110-114 21.005 28.615000000000002 26.8 23.580000000000002 115-119 20.560000000000002 28.689999999999998 27.025 23.724999999999998 120-124 21.035 28.005000000000003 27.365000000000002 23.595 125-129 20.54 27.575 27.575 24.310000000000002 130-134 21.435000000000002 27.575 27.439999999999998 23.549999999999997 135-139 20.47 28.084999999999997 27.41 24.035 140-144 21.355 27.275 27.24 24.13 145-149 20.965 28.215 26.974999999999998 23.845 150-151 21.325 28.0875 26.6 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 3.0 25 4.0 26 5.5 27 8.5 28 14.0 29 19.5 30 20.0 31 22.5 32 31.0 33 44.5 34 56.5 35 62.0 36 84.0 37 107.0 38 119.5 39 144.5 40 174.5 41 207.5 42 230.0 43 247.0 44 262.0 45 262.5 46 265.0 47 267.5 48 239.0 49 214.5 50 186.5 51 150.5 52 120.5 53 98.0 54 84.0 55 58.0 56 43.5 57 36.5 58 26.0 59 16.0 60 12.0 61 10.5 62 8.0 63 7.5 64 7.5 65 3.5 66 3.5 67 2.5 68 1.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.8 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.7875000000000001 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.9125000000000001 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.1749999999999998 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.5375 0.0 0.0 0.0 0.0 132-133 1.65 0.0 0.0 0.0 0.0 134-135 1.825 0.0 0.0 0.0 0.0 136-137 2.0125 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169011 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169011_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56625 33.0 33.0 34.0 32.0 34.0 2 32.68225 33.0 33.0 34.0 32.0 34.0 3 32.62925 34.0 33.0 34.0 32.0 34.0 4 32.663 34.0 33.0 34.0 32.0 34.0 5 32.6655 34.0 33.0 34.0 32.0 34.0 6 36.78075 38.0 38.0 38.0 36.0 38.0 7 36.8725 38.0 38.0 38.0 36.0 38.0 8 36.826 38.0 38.0 38.0 36.0 38.0 9 36.82025 38.0 38.0 38.0 36.0 38.0 10-14 36.7992 38.0 38.0 38.0 35.8 38.0 15-19 36.79485 38.0 38.0 38.0 36.0 38.0 20-24 36.826100000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.67065 38.0 38.0 38.0 35.6 38.0 30-34 36.558 38.0 38.0 38.0 35.2 38.0 35-39 36.655350000000006 38.0 38.0 38.0 35.4 38.0 40-44 36.6274 38.0 38.0 38.0 35.4 38.0 45-49 36.5588 38.0 38.0 38.0 35.0 38.0 50-54 36.496 38.0 38.0 38.0 34.8 38.0 55-59 36.4289 38.0 38.0 38.0 34.4 38.0 60-64 36.364549999999994 38.0 38.0 38.0 34.2 38.0 65-69 36.20559999999999 38.0 38.0 38.0 34.0 38.0 70-74 36.17125 38.0 38.0 38.0 33.8 38.0 75-79 36.13810000000001 38.0 38.0 38.0 33.6 38.0 80-84 35.96865 38.0 38.0 38.0 33.0 38.0 85-89 35.789 38.0 38.0 38.0 31.8 38.0 90-94 35.596000000000004 38.0 37.2 38.0 30.8 38.0 95-99 35.42255 38.0 37.0 38.0 29.6 38.0 100-104 35.29119999999999 38.0 37.0 38.0 29.0 38.0 105-109 35.2952 38.0 37.0 38.0 29.6 38.0 110-114 35.063599999999994 38.0 36.8 38.0 28.2 38.0 115-119 34.7615 38.0 36.0 38.0 26.8 38.0 120-124 34.66795 38.0 36.0 38.0 26.8 38.0 125-129 34.188649999999996 38.0 35.4 38.0 23.0 38.0 130-134 33.63005 38.0 35.0 38.0 17.4 38.0 135-139 33.40655 38.0 34.8 38.0 17.0 38.0 140-144 32.948499999999996 38.0 34.4 38.0 14.2 38.0 145-149 32.1933 38.0 33.6 38.0 8.6 38.0 150-151 27.716875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 5.0 4 2.0 5 2.0 6 2.0 7 2.0 8 2.0 9 1.0 10 2.0 11 3.0 12 8.0 13 4.0 14 3.0 15 5.0 16 6.0 17 9.0 18 6.0 19 7.0 20 15.0 21 20.0 22 15.0 23 22.0 24 24.0 25 29.0 26 34.0 27 39.0 28 26.0 29 46.0 30 65.0 31 79.0 32 90.0 33 111.0 34 143.0 35 256.0 36 498.0 37 2402.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.320281124497996 21.636546184738954 15.261044176706829 26.782128514056225 2 28.25595984943538 25.06900878293601 29.284818067754077 17.390213299874528 3 20.351317440401505 28.983688833124216 31.19196988707654 19.47302383939774 4 22.73525721455458 34.027603513174405 24.466750313676286 18.77038895859473 5 24.617314930991217 34.85570890840653 22.082810539523212 18.444165621079048 6 21.8937875751503 36.09719438877755 23.79759519038076 18.211422845691384 7 21.387427998998245 20.56098171800651 37.94139744552968 20.110192837465565 8 22.57014028056112 26.20240480961924 25.97695390781563 25.250501002004004 9 22.52004008016032 24.9248496993988 29.458917835671343 23.09619238476954 10-14 23.87917647648149 28.222211090517458 26.504032460051096 21.394579972949956 15-19 23.51202404809619 28.071142284569138 26.95390781563126 21.462925851703407 20-24 23.43186372745491 28.476953907815634 26.92885771543086 21.162324649298597 25-29 23.68117829768048 27.77415961124192 27.31827062772406 21.22639146335354 30-34 23.365562847552727 27.764140073142627 27.66895446119934 21.201342618105308 35-39 23.552104208416832 28.036072144288575 27.364729458917836 21.047094188376754 40-44 23.34552377135414 27.653925154050395 27.69901307549722 21.30153799909824 45-49 23.305105977852385 27.749661772811546 27.243573683419353 21.70165856591672 50-54 23.50583638094284 27.248133861029007 27.41345623966735 21.832573518360803 55-59 24.31362725450902 28.13627254509018 26.973947895791582 20.57615230460922 60-64 23.52440124260948 27.597955706984667 27.658081972141495 21.219561078264356 65-69 23.816204840406876 27.72460790700005 27.09826126171268 21.360925990880393 70-74 23.956506488951245 27.930049606654308 27.223530590770157 20.88991331362429 75-79 23.38410662391021 27.612987273273877 27.76330293616595 21.239603166649964 80-84 23.747243936660652 27.736019242333132 27.20485067147725 21.311886149528963 85-89 24.099223252317714 27.802555750438486 27.29140566274117 20.80681533450263 90-94 23.88874968679529 27.607116011024807 27.546980706589828 20.95715359559008 95-99 23.89495840432996 27.578430389896763 27.588453442918713 20.938157762854566 100-104 24.354798296166376 27.141067401653725 27.857679779503886 20.646454522676024 105-109 24.00280617358188 28.061735818801363 27.35017037482461 20.58528763279214 110-114 24.1669589617678 27.4740692488851 27.213509044445555 21.14546274490154 115-119 24.45123784704821 27.347900170391902 27.2877618522602 20.91310013029969 120-124 23.778501628664493 27.732397895264345 27.56201453269857 20.92708594337259 125-129 24.313489677290036 27.49047905391862 27.480457005411907 20.715574263379434 130-134 24.205673048010425 27.8340182419565 27.428084594567505 20.53222411546557 135-139 24.290868998697004 27.262704219705324 28.039490828906484 20.406935952691192 140-144 24.718087505638252 27.178870345311484 27.188893900666567 20.9141482483837 145-149 25.05136557253821 27.637183663242293 27.035830618892508 20.275620145326986 150-151 24.683940418074855 28.27638002253098 26.874452372011515 20.16522718738265 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 2.0 28 6.0 29 7.0 30 5.0 31 7.0 32 12.0 33 19.0 34 24.5 35 35.5 36 61.5 37 96.5 38 121.5 39 144.0 40 176.0 41 215.0 42 252.0 43 286.5 44 296.5 45 304.0 46 297.5 47 270.0 48 253.5 49 229.0 50 195.5 51 161.0 52 122.0 53 88.5 54 71.0 55 59.0 56 48.0 57 33.5 58 23.5 59 16.5 60 12.0 61 8.5 62 6.0 63 4.0 64 3.0 65 2.5 66 1.5 67 1.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.375 3 0.375 4 0.375 5 0.375 6 0.2 7 0.17500000000000002 8 0.2 9 0.2 10-14 0.185 15-19 0.2 20-24 0.2 25-29 0.19499999999999998 30-34 0.19499999999999998 35-39 0.2 40-44 0.19499999999999998 45-49 0.215 50-54 0.19499999999999998 55-59 0.2 60-64 0.21 65-69 0.215 70-74 0.215 75-79 0.21 80-84 0.22 85-89 0.22499999999999998 90-94 0.22499999999999998 95-99 0.22999999999999998 100-104 0.22499999999999998 105-109 0.22 110-114 0.215 115-119 0.22999999999999998 120-124 0.22499999999999998 125-129 0.22 130-134 0.22999999999999998 135-139 0.22999999999999998 140-144 0.23500000000000001 145-149 0.22499999999999998 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37027707808565 98.625 2 0.5793450881612091 1.15 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025188916876574305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 0.9624999999999999 0.0 0.0 0.0 0.0 124-125 1.075 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.5875 0.0 0.0 0.0 0.0 132-133 1.7000000000000002 0.0 0.0 0.0 0.0 134-135 1.85 0.0 0.0 0.0 0.0 136-137 2.0375 0.0 0.0 0.0 0.0 138-139 2.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAATTT 10 0.006830828 145.0 8 >>END_MODULE Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra Read 1021503 spots for SRR7169011.sra Written 1021503 spots for SRR7169011.sra Read 1021489 spots for SRR7169011.sra Written 1021489 spots for SRR7169011.sra SRR ids: ['SRR7169011.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m6bzoehp SRR7169011.sra spots: 20429794 blocks: [[1, 1021489], [1021490, 2042978], [2042979, 3064467], [3064468, 4085956], [4085957, 5107445], [5107446, 6128934], [6128935, 7150423], [7150424, 8171912], [8171913, 9193401], [9193402, 10214890], [10214891, 11236379], [11236380, 12257868], [12257869, 13279357], [13279358, 14300846], [14300847, 15322335], [15322336, 16343824], [16343825, 17365313], [17365314, 18386802], [18386803, 19408291], [19408292, 20429794]] SRR7169011 file size 6901286 SRR7169011 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169011 SRR7169011_1.fastq SRR7169011_2.fastq Input file: SRR7169011_1.fastq Paired file: SRR7169011_2.fastq trimmed: SRR7169011-trimmed-pair1.fastq, SRR7169011-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:42:34 2025 >> started Mon Feb 10 15:42:58 2025 >> done (24.383s) 20429794 read pairs processed; of these: 31836 ( 0.16%) short read pairs filtered out after trimming by size control 82472 ( 0.40%) empty read pairs filtered out after trimming by size control 20315486 (99.44%) read pairs available; of these: 9644079 (47.47%) trimmed read pairs available after processing 10671407 (52.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 7 0.00% 25 4 0.00% 26 2 0.00% 27 4 0.00% 28 4 0.00% 29 8 0.00% 30 6 0.00% 31 6 0.00% 32 7 0.00% 33 6 0.00% 34 11 0.00% 35 10 0.00% 36 17 0.00% 37 13 0.00% 38 9 0.00% 39 11 0.00% 40 13 0.00% 41 18 0.00% 42 17 0.00% 43 21 0.00% 44 20 0.00% 45 24 0.00% 46 21 0.00% 47 29 0.00% 48 36 0.00% 49 38 0.00% 50 25 0.00% 51 46 0.00% 52 47 0.00% 53 47 0.00% 54 68 0.00% 55 58 0.00% 56 92 0.00% 57 92 0.00% 58 102 0.00% 59 113 0.00% 60 115 0.00% 61 149 0.00% 62 170 0.00% 63 161 0.00% 64 164 0.00% 65 232 0.00% 66 248 0.00% 67 268 0.00% 68 292 0.00% 69 342 0.00% 70 395 0.00% 71 414 0.00% 72 466 0.00% 73 490 0.00% 74 556 0.00% 75 654 0.00% 76 677 0.00% 77 828 0.00% 78 928 0.00% 79 1027 0.01% 80 1162 0.01% 81 1321 0.01% 82 1551 0.01% 83 1827 0.01% 84 2961 0.01% 85 3680 0.02% 86 3788 0.02% 87 3818 0.02% 88 4198 0.02% 89 4084 0.02% 90 4331 0.02% 91 4558 0.02% 92 5097 0.03% 93 5135 0.03% 94 5643 0.03% 95 5792 0.03% 96 6091 0.03% 97 6511 0.03% 98 7022 0.03% 99 7393 0.04% 100 7836 0.04% 101 8481 0.04% 102 9103 0.04% 103 9814 0.05% 104 10345 0.05% 105 11500 0.06% 106 11771 0.06% 107 12296 0.06% 108 13312 0.07% 109 13986 0.07% 110 14652 0.07% 111 16029 0.08% 112 16848 0.08% 113 18285 0.09% 114 19371 0.10% 115 20895 0.10% 116 22280 0.11% 117 23206 0.11% 118 24585 0.12% 119 25537 0.13% 120 26948 0.13% 121 28449 0.14% 122 30272 0.15% 123 32667 0.16% 124 35041 0.17% 125 37045 0.18% 126 39696 0.20% 127 42069 0.21% 128 45007 0.22% 129 47451 0.23% 130 50542 0.25% 131 53952 0.27% 132 57275 0.28% 133 61864 0.30% 134 66389 0.33% 135 72035 0.35% 136 77476 0.38% 137 83557 0.41% 138 90018 0.44% 139 98928 0.49% 140 108267 0.53% 141 120851 0.59% 142 135117 0.67% 143 155819 0.77% 144 180897 0.89% 145 220051 1.08% 146 275331 1.36% 147 373278 1.84% 148 568238 2.80% 149 1097946 5.40% 150 4925866 24.25% 151 10671407 52.53% 20315486 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=36 prefix-density=0.29 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=254.64 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=43 prefix-density=0.26 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=57.96 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.4 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169011 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:43:59 Started mapping on | Feb 10 15:44:00 Finished on | Feb 10 15:46:02 Mapping speed, Million of reads per hour | 599.47 Number of input reads | 20315486 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19229133 Uniquely mapped reads % | 94.65% Average mapped length | 295.88 Number of splices: Total | 17769478 Number of splices: Annotated (sjdb) | 17485509 Number of splices: GT/AG | 17525507 Number of splices: GC/AG | 197422 Number of splices: AT/AC | 13629 Number of splices: Non-canonical | 32920 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394790 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 39446 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 714526 714526 714526 N_multimapping 394790 394790 394790 N_noFeature 374765 18993509 456815 N_ambiguous 230418 1013 76179 UnstrandedReadsAssigned:18623950 PositiveStrandReadsAssigned:234611 NegativeStrandReadsAssigned:18696139 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169011 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169011-trimmed-pair1.fastq SRR7169011-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,315,486 reads, 18,644,017 reads pseudoaligned [quant] estimated average fragment length: 255.188 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR7169011.ke.tsv 34699 SRR7169011.se.tsv 87100 total ==> SRR7169011.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.81 309 8.29395 Potri.005G024800.1.v4.1 1035 780.812 42 2.54659 Potri.004G059700.1.v4.1 961 706.818 3 0.200941 Potri.007G009000.2.v4.1 1416 1161.81 0 0 Potri.003G141000.2.v4.1 2943 2688.81 304 5.35264 Potri.016G087400.1.v4.1 270 67.4362 1873.51 1315.28 Potri.015G069301.1.v4.1 564 313.603 0 0 Potri.010G195200.1.v4.1 1773 1518.81 21 0.654592 Potri.012G127500.1.v4.1 977 722.818 3184 208.545 ==> SRR7169011.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1279 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7169011 completed mapping pipeline successfully