Starting /dee2/code/volunteer_pipeline.sh SRR7169012 current disk space = 3058666676224 free memory = 1170485116 SRR7169012 SRAfilesize 59ddaab9652d208e1c9e0f4328880233 SRR7169012.sra SRR7169012.sra file validated SRR7169012 is paired end SRR7169012 is conventional basespace SRR7169012 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169012_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.21725 34.0 34.0 34.0 33.0 34.0 2 33.482 34.0 34.0 34.0 33.0 34.0 3 33.4885 34.0 34.0 34.0 33.0 34.0 4 33.535 34.0 34.0 34.0 33.0 34.0 5 33.53475 34.0 34.0 34.0 33.0 34.0 6 37.11175 38.0 37.0 38.0 36.0 38.0 7 37.32025 38.0 38.0 38.0 37.0 38.0 8 37.4695 38.0 38.0 38.0 37.0 38.0 9 37.5415 38.0 38.0 38.0 38.0 38.0 10-14 37.536150000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.52290000000001 38.0 38.0 38.0 37.8 38.0 20-24 37.53634999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.4865 38.0 38.0 38.0 38.0 38.0 30-34 37.46335 38.0 38.0 38.0 37.8 38.0 35-39 37.39175 38.0 38.0 38.0 37.2 38.0 40-44 37.2565 38.0 38.0 38.0 37.0 38.0 45-49 37.20575 38.0 38.0 38.0 36.8 38.0 50-54 37.156549999999996 38.0 38.0 38.0 36.4 38.0 55-59 37.143449999999994 38.0 38.0 38.0 36.2 38.0 60-64 37.12845 38.0 38.0 38.0 36.0 38.0 65-69 37.0946 38.0 38.0 38.0 36.0 38.0 70-74 37.091300000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.022149999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.90554999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.8469 38.0 38.0 38.0 35.4 38.0 90-94 36.7341 38.0 38.0 38.0 35.0 38.0 95-99 36.68325 38.0 38.0 38.0 34.8 38.0 100-104 36.59415 38.0 38.0 38.0 34.4 38.0 105-109 36.4867 38.0 38.0 38.0 34.0 38.0 110-114 36.2701 38.0 38.0 38.0 34.0 38.0 115-119 36.21939999999999 38.0 37.6 38.0 33.8 38.0 120-124 36.08835 38.0 37.4 38.0 33.6 38.0 125-129 35.79514999999999 38.0 37.0 38.0 32.2 38.0 130-134 35.65535 38.0 36.8 38.0 31.4 38.0 135-139 35.430899999999994 38.0 36.0 38.0 31.0 38.0 140-144 34.9191 38.0 35.8 38.0 28.4 38.0 145-149 34.637649999999994 38.0 35.6 38.0 28.0 38.0 150-151 31.891 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 1.0 11 0.0 12 2.0 13 1.0 14 0.0 15 2.0 16 1.0 17 1.0 18 2.0 19 3.0 20 3.0 21 5.0 22 5.0 23 9.0 24 12.0 25 10.0 26 18.0 27 18.0 28 29.0 29 15.0 30 33.0 31 54.0 32 58.0 33 74.0 34 120.0 35 184.0 36 556.0 37 2782.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.309866262932125 14.55967701236437 8.327024981074944 32.803431743628565 2 22.45 16.45 33.425 27.675 3 18.65 21.3 27.150000000000002 32.9 4 22.15 27.450000000000003 24.775 25.624999999999996 5 23.175 30.7 23.775 22.35 6 19.900000000000002 33.925 25.974999999999998 20.200000000000003 7 14.524999999999999 29.475 38.275 17.724999999999998 8 17.299999999999997 28.125 29.975 24.6 9 16.775000000000002 25.974999999999998 34.050000000000004 23.200000000000003 10-14 19.3 29.770000000000003 27.245 23.685000000000002 15-19 19.835 29.235 27.555000000000003 23.375 20-24 20.115 29.049999999999997 27.450000000000003 23.385 25-29 19.685 29.535 26.88 23.9 30-34 19.917987698154725 29.514427164074615 26.819022853428017 23.74856228434265 35-39 19.985 29.2 26.87 23.945 40-44 19.72 28.955 27.415 23.91 45-49 19.79 28.49 27.47 24.25 50-54 19.865 28.54 27.72 23.875 55-59 20.165 28.599999999999998 27.700000000000003 23.535 60-64 20.24 28.294999999999998 27.42 24.044999999999998 65-69 20.580000000000002 27.955000000000002 27.6 23.865 70-74 19.915 28.999999999999996 27.395000000000003 23.69 75-79 20.525 29.15 26.91 23.415 80-84 20.1 28.355000000000004 27.26 24.285 85-89 20.19 28.17 26.91 24.73 90-94 20.64 28.505000000000003 26.815 24.04 95-99 20.200000000000003 28.444999999999997 27.445000000000004 23.91 100-104 20.91 29.035 26.58 23.474999999999998 105-109 20.169999999999998 28.165000000000003 27.495000000000005 24.169999999999998 110-114 20.01 28.199999999999996 27.189999999999998 24.6 115-119 20.54 27.99 27.075 24.395 120-124 20.7 27.76 27.005000000000003 24.535 125-129 20.28 28.349999999999998 27.37 24.0 130-134 20.345 27.560000000000002 27.76 24.335 135-139 21.175 27.575 27.229999999999997 24.02 140-144 21.395 27.485 26.86 24.26 145-149 20.9 27.99 27.250000000000004 23.86 150-151 21.4 27.962500000000002 26.224999999999998 24.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 0.5 21 0.5 22 1.0 23 1.5 24 2.5 25 4.0 26 5.0 27 5.5 28 15.0 29 19.5 30 20.5 31 31.5 32 47.5 33 50.5 34 55.5 35 78.0 36 88.5 37 101.5 38 128.5 39 143.5 40 153.0 41 187.5 42 233.5 43 259.5 44 264.5 45 270.0 46 254.0 47 248.5 48 237.0 49 193.5 50 174.5 51 160.0 52 135.5 53 108.0 54 75.0 55 55.0 56 44.5 57 35.0 58 29.5 59 18.5 60 12.5 61 11.0 62 10.5 63 8.0 64 5.0 65 2.5 66 0.0 67 2.0 68 4.0 69 2.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.9125000000000001 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.6749999999999998 0.0 0.0 0.0 0.0 128-129 1.8875 0.0 0.0 0.0 0.0 130-131 2.125 0.0 0.0 0.0 0.0 132-133 2.3499999999999996 0.0 0.0 0.0 0.0 134-135 2.5125 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGTGA 10 0.006832588 144.9875 9 GAAGAAT 10 0.006832588 144.9875 2 ACCAGTG 10 0.006832588 144.9875 8 >>END_MODULE SRR7169012 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169012_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9585 33.0 33.0 34.0 32.0 34.0 2 33.078 34.0 33.0 34.0 32.0 34.0 3 33.07325 34.0 33.0 34.0 33.0 34.0 4 32.98275 34.0 33.0 34.0 33.0 34.0 5 33.048 34.0 33.0 34.0 33.0 34.0 6 37.293 38.0 38.0 38.0 37.0 38.0 7 37.33575 38.0 38.0 38.0 37.0 38.0 8 37.3535 38.0 38.0 38.0 37.0 38.0 9 37.3545 38.0 38.0 38.0 37.0 38.0 10-14 37.3494 38.0 38.0 38.0 37.2 38.0 15-19 37.2744 38.0 38.0 38.0 37.0 38.0 20-24 37.1844 38.0 38.0 38.0 37.0 38.0 25-29 37.1803 38.0 38.0 38.0 37.0 38.0 30-34 37.1522 38.0 38.0 38.0 37.0 38.0 35-39 37.20275 38.0 38.0 38.0 37.0 38.0 40-44 37.10755 38.0 38.0 38.0 37.0 38.0 45-49 37.076499999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.07765 38.0 38.0 38.0 36.8 38.0 55-59 37.081450000000004 38.0 38.0 38.0 37.0 38.0 60-64 36.9828 38.0 38.0 38.0 36.2 38.0 65-69 36.945299999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.82355 38.0 38.0 38.0 35.8 38.0 75-79 36.84665 38.0 38.0 38.0 36.0 38.0 80-84 36.77035 38.0 38.0 38.0 35.6 38.0 85-89 36.710950000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.57854999999999 38.0 38.0 38.0 34.8 38.0 95-99 36.4822 38.0 38.0 38.0 34.0 38.0 100-104 36.3374 38.0 38.0 38.0 34.0 38.0 105-109 36.20825 38.0 38.0 38.0 34.0 38.0 110-114 36.0295 38.0 37.8 38.0 33.2 38.0 115-119 35.8623 38.0 37.2 38.0 32.6 38.0 120-124 35.703250000000004 38.0 37.0 38.0 31.8 38.0 125-129 35.40775000000001 38.0 36.2 38.0 31.0 38.0 130-134 35.06595 38.0 36.0 38.0 28.4 38.0 135-139 34.60465000000001 38.0 35.4 38.0 26.6 38.0 140-144 34.282349999999994 38.0 35.0 38.0 25.0 38.0 145-149 33.867599999999996 38.0 35.0 38.0 23.0 38.0 150-151 30.444249999999997 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 3.0 6 2.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 3.0 15 0.0 16 2.0 17 7.0 18 5.0 19 5.0 20 5.0 21 11.0 22 6.0 23 17.0 24 16.0 25 12.0 26 21.0 27 16.0 28 24.0 29 29.0 30 38.0 31 39.0 32 56.0 33 91.0 34 140.0 35 212.0 36 593.0 37 2636.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.35 22.825 12.2 26.625 2 27.070302727045288 28.471353515136354 28.121090818113586 16.337252939704776 3 20.696567276371837 30.468554247055874 29.215735404660485 19.6191430719118 4 23.696088264794383 34.80441323971915 22.893681043129387 18.60581745235707 5 23.277374091706342 37.334001503382616 21.373089451265347 18.015534953645705 6 22.025 38.574999999999996 21.349999999999998 18.05 7 21.075 21.85 36.4 20.674999999999997 8 22.25 26.424999999999997 26.474999999999998 24.85 9 22.875 25.650000000000002 29.349999999999998 22.125 10-14 24.546227311365566 28.546427321366068 25.27626381319066 21.631081554077706 15-19 24.22195536875813 27.579305513859705 27.073951766236366 21.1247873511458 20-24 24.281070267566893 27.76694173543386 26.076519129782444 21.875468867216803 25-29 23.727118135440634 28.273482044613385 26.72801840552166 21.27138141442433 30-34 23.892167650295086 27.95838751625488 27.058117435230567 21.091327398219466 35-39 24.031201560078003 27.36136806840342 27.2013600680034 21.406070303515175 40-44 24.13982796559312 28.070614122824566 26.26525305061012 21.524304860972194 45-49 24.451222561128056 27.796389819490976 26.781339066953347 20.97104855242762 50-54 24.412441244124413 27.752775277527753 26.94269426942694 20.89208920892089 55-59 24.565 27.400000000000002 26.825 21.21 60-64 24.046202310115504 27.616380819040952 27.27636381819091 21.061053052652632 65-69 24.59245924592459 27.85778577857786 26.982698269826983 20.567056705670566 70-74 25.025 27.474999999999998 27.015 20.485 75-79 24.466223311165557 27.69138456922846 27.096354817740888 20.746037301865094 80-84 24.253638045706857 27.549132369855478 27.529129369405407 20.668100215032254 85-89 24.895 27.71 27.41 19.985 90-94 24.275 27.3 28.155 20.27 95-99 23.995 27.47 27.52 21.015 100-104 24.46 28.050000000000004 27.150000000000002 20.34 105-109 24.205 27.805000000000003 26.905 21.085 110-114 24.695 27.439999999999998 27.47 20.395 115-119 24.836241812090602 27.951397569878495 26.826341317065854 20.386019300965046 120-124 24.098614792218832 28.029204380657095 27.33410011501725 20.538080712106815 125-129 24.01 28.000000000000004 27.450000000000003 20.54 130-134 24.104999999999997 27.58 27.134999999999998 21.18 135-139 24.94 28.310000000000002 26.33 20.419999999999998 140-144 24.34 28.055000000000003 27.389999999999997 20.215 145-149 24.98 27.834999999999997 27.279999999999998 19.905 150-151 24.8625 27.6125 27.05 20.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 1.5 28 2.5 29 7.0 30 10.0 31 10.0 32 12.0 33 15.0 34 19.0 35 32.0 36 54.5 37 78.0 38 100.5 39 139.0 40 168.0 41 205.0 42 250.0 43 271.0 44 292.5 45 292.5 46 287.5 47 298.5 48 273.0 49 219.5 50 195.5 51 170.5 52 133.0 53 117.0 54 99.0 55 64.5 56 43.0 57 38.0 58 33.0 59 23.5 60 15.5 61 8.5 62 4.0 63 2.0 64 1.5 65 2.0 66 2.5 67 2.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.22499999999999998 4 0.3 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.06999999999999999 20-24 0.025 25-29 0.03 30-34 0.03 35-39 0.005 40-44 0.02 45-49 0.005 50-54 0.01 55-59 0.0 60-64 0.005 65-69 0.01 70-74 0.0 75-79 0.005 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.2 0.0 0.0 0.0 0.0 134-135 2.4000000000000004 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138-139 3.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAAAC 10 0.006830828 145.0 1 AGCTGTG 10 0.006830828 145.0 7 >>END_MODULE Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674407 spots for SRR7169012.sra Written 674407 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra Read 674405 spots for SRR7169012.sra Written 674405 spots for SRR7169012.sra SRR ids: ['SRR7169012.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_amznoxx7 SRR7169012.sra spots: 13488102 blocks: [[1, 674405], [674406, 1348810], [1348811, 2023215], [2023216, 2697620], [2697621, 3372025], [3372026, 4046430], [4046431, 4720835], [4720836, 5395240], [5395241, 6069645], [6069646, 6744050], [6744051, 7418455], [7418456, 8092860], [8092861, 8767265], [8767266, 9441670], [9441671, 10116075], [10116076, 10790480], [10790481, 11464885], [11464886, 12139290], [12139291, 12813695], [12813696, 13488102]] SRR7169012 file size 4548974 SRR7169012 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169012 SRR7169012_1.fastq SRR7169012_2.fastq Input file: SRR7169012_1.fastq Paired file: SRR7169012_2.fastq trimmed: SRR7169012-trimmed-pair1.fastq, SRR7169012-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:12:09 2025 >> started Mon Feb 10 16:12:32 2025 >> done (23.238s) 13488102 read pairs processed; of these: 15712 ( 0.12%) short read pairs filtered out after trimming by size control 10029 ( 0.07%) empty read pairs filtered out after trimming by size control 13462361 (99.81%) read pairs available; of these: 5359014 (39.81%) trimmed read pairs available after processing 8103347 (60.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 5 0.00% 21 6 0.00% 22 9 0.00% 23 5 0.00% 24 8 0.00% 25 6 0.00% 26 2 0.00% 27 4 0.00% 28 6 0.00% 29 8 0.00% 30 8 0.00% 31 7 0.00% 32 8 0.00% 33 2 0.00% 34 9 0.00% 35 18 0.00% 36 4 0.00% 37 12 0.00% 38 7 0.00% 39 6 0.00% 40 9 0.00% 41 9 0.00% 42 10 0.00% 43 11 0.00% 44 6 0.00% 45 14 0.00% 46 14 0.00% 47 12 0.00% 48 18 0.00% 49 19 0.00% 50 14 0.00% 51 18 0.00% 52 25 0.00% 53 32 0.00% 54 30 0.00% 55 25 0.00% 56 39 0.00% 57 40 0.00% 58 34 0.00% 59 30 0.00% 60 57 0.00% 61 73 0.00% 62 58 0.00% 63 92 0.00% 64 77 0.00% 65 87 0.00% 66 111 0.00% 67 117 0.00% 68 131 0.00% 69 155 0.00% 70 204 0.00% 71 206 0.00% 72 218 0.00% 73 267 0.00% 74 282 0.00% 75 327 0.00% 76 366 0.00% 77 410 0.00% 78 460 0.00% 79 528 0.00% 80 610 0.00% 81 694 0.01% 82 797 0.01% 83 950 0.01% 84 1616 0.01% 85 1994 0.01% 86 2101 0.02% 87 2322 0.02% 88 2562 0.02% 89 2597 0.02% 90 2741 0.02% 91 3036 0.02% 92 3184 0.02% 93 3454 0.03% 94 3660 0.03% 95 4084 0.03% 96 4239 0.03% 97 4509 0.03% 98 4902 0.04% 99 4977 0.04% 100 5482 0.04% 101 5881 0.04% 102 6411 0.05% 103 6941 0.05% 104 7122 0.05% 105 8120 0.06% 106 8409 0.06% 107 8621 0.06% 108 9142 0.07% 109 9812 0.07% 110 10402 0.08% 111 11023 0.08% 112 11718 0.09% 113 12709 0.09% 114 13836 0.10% 115 14128 0.10% 116 15275 0.11% 117 16369 0.12% 118 17069 0.13% 119 17732 0.13% 120 18352 0.14% 121 19743 0.15% 122 20534 0.15% 123 22221 0.17% 124 23983 0.18% 125 25107 0.19% 126 26860 0.20% 127 27857 0.21% 128 29352 0.22% 129 31009 0.23% 130 32527 0.24% 131 34539 0.26% 132 36665 0.27% 133 39309 0.29% 134 41411 0.31% 135 44967 0.33% 136 47911 0.36% 137 51387 0.38% 138 55300 0.41% 139 59568 0.44% 140 64133 0.48% 141 70449 0.52% 142 76578 0.57% 143 86400 0.64% 144 98836 0.73% 145 116468 0.87% 146 141444 1.05% 147 186536 1.39% 148 276314 2.05% 149 534189 3.97% 150 2743051 20.38% 151 8103347 60.19% 13462361 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=34 prefix-density=0.28 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=110.74 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.1 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=43 prefix-density=0.28 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=42 fanout-score=78.67 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.4 sequence=CACCACCACTGGTAACAAGGACATCATCATGGTTGATCACATGAGGAAGATGAAGAACAATGCCATTGTCTGCAACATCGGTCACTTCGATAATGAAATCGACATGCTTGGACTTGAGACCTTCCCTGGCGTGAAGCGCATCACCATCAAGCCCCAAACTGACAGGTGGGTCTTCCCTGACACCAACTCCGGCATCATTGTCCTGGCTGAGGGACGTCTCATGAACCTGGG SRR7169012 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:13:17 Started mapping on | Feb 10 16:13:17 Finished on | Feb 10 16:14:40 Mapping speed, Million of reads per hour | 583.91 Number of input reads | 13462361 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12706995 Uniquely mapped reads % | 94.39% Average mapped length | 296.15 Number of splices: Total | 11416538 Number of splices: Annotated (sjdb) | 11229058 Number of splices: GT/AG | 11255756 Number of splices: GC/AG | 127128 Number of splices: AT/AC | 10536 Number of splices: Non-canonical | 23118 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234206 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 24989 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 533590 533590 533590 N_multimapping 234206 234206 234206 N_noFeature 232059 12538932 300373 N_ambiguous 152068 1021 51544 UnstrandedReadsAssigned:12322868 PositiveStrandReadsAssigned:167042 NegativeStrandReadsAssigned:12355078 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169012 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169012-trimmed-pair1.fastq SRR7169012-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,462,361 reads, 12,301,833 reads pseudoaligned [quant] estimated average fragment length: 242.998 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR7169012.ke.tsv 34699 SRR7169012.se.tsv 87100 total ==> SRR7169012.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776 189 7.31449 Potri.005G024800.1.v4.1 1035 793.002 23 1.99351 Potri.004G059700.1.v4.1 961 719.028 5 0.477958 Potri.007G009000.2.v4.1 1416 1174 0 0 Potri.003G141000.2.v4.1 2943 2701 201 5.1149 Potri.016G087400.1.v4.1 270 72.4866 1555 1474.48 Potri.015G069301.1.v4.1 564 325.283 0 0 Potri.010G195200.1.v4.1 1773 1531 10 0.448942 Potri.012G127500.1.v4.1 977 735.015 3912 365.821 ==> SRR7169012.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1437 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169012 completed mapping pipeline successfully