Starting /dee2/code/volunteer_pipeline.sh SRR7169013 current disk space = 3058764550144 free memory = 1463429608 SRR7169013 SRAfilesize a96f2fc645a02dc705464c00162189e0 SRR7169013.sra SRR7169013.sra file validated SRR7169013 is paired end SRR7169013 is conventional basespace SRR7169013 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169013_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5735 34.0 33.0 34.0 32.0 34.0 2 33.06575 34.0 33.0 34.0 32.0 34.0 3 33.139 34.0 33.0 34.0 32.0 34.0 4 33.1405 34.0 33.0 34.0 32.0 34.0 5 33.17625 34.0 33.0 34.0 32.0 34.0 6 36.92525 38.0 37.0 38.0 36.0 38.0 7 37.2345 38.0 38.0 38.0 36.0 38.0 8 37.36325 38.0 38.0 38.0 37.0 38.0 9 37.42275 38.0 38.0 38.0 37.0 38.0 10-14 37.44645 38.0 38.0 38.0 37.0 38.0 15-19 37.33435 38.0 38.0 38.0 37.0 38.0 20-24 37.2062 38.0 38.0 38.0 36.4 38.0 25-29 37.145950000000006 38.0 38.0 38.0 36.0 38.0 30-34 37.060500000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.955200000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.75365 38.0 38.0 38.0 34.8 38.0 45-49 36.79535 38.0 38.0 38.0 34.8 38.0 50-54 36.78575 38.0 38.0 38.0 34.8 38.0 55-59 36.50185 38.0 38.0 38.0 34.0 38.0 60-64 36.598499999999994 38.0 38.0 38.0 34.0 38.0 65-69 36.546850000000006 38.0 38.0 38.0 34.0 38.0 70-74 36.55905 38.0 38.0 38.0 34.0 38.0 75-79 36.41415 38.0 37.6 38.0 34.0 38.0 80-84 35.7708 38.0 36.8 38.0 31.4 38.0 85-89 35.6659 38.0 37.0 38.0 30.2 38.0 90-94 35.369749999999996 38.0 36.4 38.0 29.6 38.0 95-99 35.405950000000004 38.0 36.6 38.0 29.8 38.0 100-104 35.152499999999996 38.0 36.0 38.0 28.4 38.0 105-109 35.2099 38.0 36.2 38.0 28.8 38.0 110-114 34.731700000000004 38.0 35.2 38.0 26.2 38.0 115-119 34.3558 38.0 34.8 38.0 24.4 38.0 120-124 33.99705 37.8 34.2 38.0 22.8 38.0 125-129 33.15675 37.4 33.4 38.0 18.2 38.0 130-134 32.4873 37.4 32.0 38.0 14.8 38.0 135-139 33.10075 38.0 33.6 38.0 17.4 38.0 140-144 32.92005 38.0 33.2 38.0 15.6 38.0 145-149 31.817899999999998 36.6 32.0 38.0 11.2 38.0 150-151 27.003 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 1.0 11 2.0 12 0.0 13 0.0 14 2.0 15 2.0 16 2.0 17 2.0 18 6.0 19 11.0 20 12.0 21 6.0 22 11.0 23 11.0 24 14.0 25 24.0 26 36.0 27 46.0 28 44.0 29 58.0 30 76.0 31 104.0 32 110.0 33 176.0 34 256.0 35 424.0 36 918.0 37 1643.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.5687276443536 16.27491057741441 11.037301992846194 31.119059785385794 2 22.175 16.7 32.725 28.4 3 19.375 24.099999999999998 27.325 29.2 4 20.849999999999998 30.775000000000002 25.324999999999996 23.05 5 21.66624968726545 34.125594195646734 24.69352014010508 19.514635976982735 6 20.25 34.599999999999994 24.8 20.349999999999998 7 14.475 27.150000000000002 39.425 18.95 8 18.95 25.474999999999998 29.475 26.1 9 17.349999999999998 25.324999999999996 31.674999999999997 25.650000000000002 10-14 19.86 30.220000000000002 26.445 23.474999999999998 15-19 19.38 30.255 26.740000000000002 23.625 20-24 19.665 29.580000000000002 27.07 23.685000000000002 25-29 19.314999999999998 29.54 27.425 23.72 30-34 20.18 29.755 26.36 23.705000000000002 35-39 20.22202220222022 29.52795279527953 26.57765776577658 23.672367236723673 40-44 19.915 29.354999999999997 27.11 23.62 45-49 20.135 28.955 27.229999999999997 23.68 50-54 20.13 29.595 26.479999999999997 23.794999999999998 55-59 20.080000000000002 29.770000000000003 26.395000000000003 23.755000000000003 60-64 19.805 29.035 27.279999999999998 23.880000000000003 65-69 20.345 28.799999999999997 26.939999999999998 23.915 70-74 19.661966196619662 29.68296829682968 26.367636763676366 24.287428742874287 75-79 20.18 27.965 27.189999999999998 24.665 80-84 19.794073329984933 28.598694123556 27.152184831742844 24.455047714716223 85-89 20.477267018337102 28.575734740015076 26.937955287616177 24.00904295403165 90-94 20.494930227888766 28.952916373858045 26.955124987451057 23.597028410802128 95-99 20.596519464842572 28.618851222211045 26.979177145156424 23.805452167789962 100-104 20.949132136048963 28.89535467041236 26.728203070131435 23.427310123407246 105-109 20.34340797268802 28.160457877296917 27.39230846470529 24.103825685309772 110-114 20.71439321727788 28.405157276877542 27.35664475994582 23.52380474589876 115-119 20.566236634707096 28.206415340595353 26.705486672355804 24.52186135234175 120-124 20.56102805140257 28.531426571328566 26.866343317165857 24.041202060103007 125-129 20.73390816121917 28.11810707840385 27.13555243633447 24.01243232404251 130-134 20.5989294010706 28.542571457428544 26.795273204726794 24.063225936774064 135-139 21.05980317940954 28.397678526368914 26.878627302548573 23.663890991672975 140-144 21.242665864299685 28.097888771877038 26.77398325058924 23.88546211323404 145-149 21.259009122524066 27.987500630008565 26.8030845219495 23.950405725517868 150-151 20.63511986946153 28.103426634868832 26.672524162168948 24.58892933350069 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 2.5 23 1.5 24 1.5 25 2.0 26 3.5 27 10.0 28 18.5 29 22.5 30 25.0 31 32.5 32 41.0 33 53.0 34 62.0 35 86.0 36 108.5 37 115.5 38 130.0 39 150.0 40 173.0 41 197.0 42 224.0 43 235.5 44 243.5 45 247.5 46 252.0 47 239.5 48 218.0 49 192.0 50 163.5 51 148.0 52 128.0 53 114.5 54 85.0 55 60.0 56 51.0 57 39.0 58 25.5 59 18.0 60 15.5 61 12.0 62 11.5 63 10.0 64 5.5 65 3.0 66 2.5 67 2.5 68 3.5 69 3.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.44999999999999996 85-89 0.475 90-94 0.38999999999999996 95-99 0.59 100-104 0.33 105-109 0.41000000000000003 110-114 0.335 115-119 0.395 120-124 0.005 125-129 0.26 130-134 0.9900000000000001 135-139 0.9249999999999999 140-144 0.295 145-149 0.795 150-151 0.41250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5032712632108707 1.0 3 0.0754906894816306 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.5375 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.7875 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.4125 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.8875000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATCTC 10 0.0068963906 144.5375 8 AGACAGA 10 0.0068963906 144.5375 9 AAAAAAA 170 0.007224361 7.651985 120-124 >>END_MODULE SRR7169013 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169013_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91475 33.0 33.0 34.0 32.0 34.0 2 32.95425 34.0 33.0 34.0 32.0 34.0 3 32.91625 34.0 33.0 34.0 32.0 34.0 4 32.7885 34.0 33.0 34.0 32.0 34.0 5 32.75875 34.0 33.0 34.0 32.0 34.0 6 36.72025 38.0 38.0 38.0 36.0 38.0 7 36.60675 38.0 38.0 38.0 36.0 38.0 8 36.293 38.0 38.0 38.0 36.0 38.0 9 36.56825 38.0 38.0 38.0 35.0 38.0 10-14 35.75495 38.0 38.0 38.0 32.0 38.0 15-19 35.47625000000001 38.0 38.0 38.0 32.6 38.0 20-24 35.8945 38.0 38.0 38.0 33.4 38.0 25-29 36.226299999999995 38.0 38.0 38.0 34.4 38.0 30-34 36.2221 38.0 38.0 38.0 35.0 38.0 35-39 36.2309 38.0 38.0 38.0 35.0 38.0 40-44 36.22705 38.0 38.0 38.0 35.2 38.0 45-49 36.2429 38.0 38.0 38.0 35.4 38.0 50-54 35.55135 38.0 38.0 38.0 32.4 38.0 55-59 34.517700000000005 38.0 38.0 38.0 24.4 38.0 60-64 34.731700000000004 38.0 38.0 38.0 27.4 38.0 65-69 35.16365 38.0 38.0 38.0 30.2 38.0 70-74 34.8713 38.0 38.0 38.0 27.8 38.0 75-79 34.7316 38.0 37.8 38.0 27.6 38.0 80-84 34.908249999999995 38.0 38.0 38.0 28.2 38.0 85-89 34.971650000000004 38.0 38.0 38.0 28.8 38.0 90-94 34.8375 38.0 38.0 38.0 28.2 38.0 95-99 34.698550000000004 38.0 37.6 38.0 27.2 38.0 100-104 34.149 38.0 37.0 38.0 22.2 38.0 105-109 34.143600000000006 38.0 37.0 38.0 22.0 38.0 110-114 34.00195 38.0 36.6 38.0 20.0 38.0 115-119 33.92215 38.0 36.4 38.0 21.0 38.0 120-124 33.9906 38.0 36.0 38.0 20.6 38.0 125-129 33.72925 38.0 36.0 38.0 16.2 38.0 130-134 33.380700000000004 38.0 34.8 38.0 16.0 38.0 135-139 32.7979 38.0 34.2 38.0 14.0 38.0 140-144 32.58625 38.0 34.4 38.0 13.4 38.0 145-149 31.60775 38.0 33.6 38.0 4.2 38.0 150-151 28.270249999999997 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 39.0 4 8.0 5 3.0 6 5.0 7 11.0 8 15.0 9 6.0 10 24.0 11 38.0 12 16.0 13 2.0 14 5.0 15 4.0 16 6.0 17 9.0 18 8.0 19 7.0 20 10.0 21 15.0 22 11.0 23 17.0 24 33.0 25 19.0 26 29.0 27 36.0 28 33.0 29 54.0 30 57.0 31 52.0 32 70.0 33 83.0 34 135.0 35 203.0 36 459.0 37 2458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.575 21.95 12.35 22.125 2 27.500000000000004 26.200000000000003 28.4 17.9 3 20.025000000000002 30.525000000000002 30.0 19.45 4 22.35 35.4 23.7 18.55 5 25.437718859429715 34.667333666833414 21.335667833916958 18.55927963981991 6 22.799097065462753 34.88838725859042 22.849260095309756 19.46325558063707 7 21.654929577464788 20.950704225352112 36.54426559356137 20.85010060362173 8 22.453644907289817 25.222250444500887 25.552451104902207 26.77165354330709 9 22.523200401304237 25.909204915976925 28.969149736644095 22.598444946074743 10-14 24.220108417715043 27.984044185332923 25.994681395110973 21.801166001841054 15-19 23.276888819843613 28.041012894205373 27.35228626171612 21.329812024234894 20-24 23.91989427671038 27.67103791806445 27.157670021347975 21.2513977838772 25-29 23.964081468847194 27.6111166850607 27.099428112772152 21.325373733319957 30-34 23.851911794456807 28.105401577989074 26.98765931620473 21.055027311349384 35-39 23.834719072814313 27.97682035777274 26.74729150919627 21.44116906021668 40-44 24.22991745520435 27.768270585866723 27.159251056976043 20.84256090195289 45-49 23.80137847763747 27.97705891231071 26.930623333501032 21.290939276550787 50-54 23.519753719856336 27.408927655207798 28.004104669061057 21.06721395587481 55-59 23.708637054905868 27.966857202789868 27.4791546489066 20.84535109339766 60-64 23.600439077936333 27.907584548638336 27.431916784276826 21.0600595891485 65-69 23.97172565691748 27.470163397018897 27.3728422885827 21.185268657480922 70-74 24.154864054584927 27.540576863434303 27.220097177711157 21.084461904269617 75-79 23.5809661287828 27.07635201319792 28.231169768520903 21.111512089498376 80-84 24.036924346346243 27.388994894538705 27.358052704863077 21.21602805425197 85-89 23.846193336413574 27.953180348067146 27.362800965141947 20.83782535037733 90-94 23.98592715231788 27.224751655629138 27.964610927152318 20.824710264900663 95-99 23.829003886275313 27.403354469216605 27.66925751687462 21.098384127633462 100-104 23.981782012354728 27.604439325725057 27.60967437964611 20.804104282274107 105-109 23.7960047488773 27.027306044494914 28.46229288184587 20.714396324781916 110-114 24.08546117769672 26.920270974465865 28.269932256383534 20.724335591453883 115-119 24.018032956783088 27.61944242926728 27.598714892735 20.763809721214635 120-124 23.805647417959808 27.748664461968964 27.94199949122361 20.503688628847623 125-129 24.041403222516827 27.921680603712012 27.712624923516216 20.324291250254948 130-134 24.36862179156788 26.99206267395114 27.445624162457477 21.1936913720235 135-139 24.36206808029984 27.114031935102943 27.601786722801254 20.922113261795964 140-144 24.256350689359124 27.129942932175144 27.6905206807737 20.923185697692034 145-149 24.722405313593267 27.08005881458196 27.941996653653096 20.255539218171677 150-151 24.398053278688526 27.228483606557376 28.060963114754102 20.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 2.5 8 3.0 9 3.0 10 5.5 11 4.5 12 5.5 13 7.0 14 7.0 15 6.5 16 5.0 17 6.5 18 6.0 19 4.5 20 7.5 21 8.5 22 6.5 23 5.5 24 4.5 25 5.0 26 5.0 27 6.0 28 10.5 29 13.5 30 15.0 31 19.5 32 19.5 33 21.0 34 28.0 35 40.0 36 55.0 37 76.0 38 119.5 39 149.0 40 172.5 41 205.0 42 225.5 43 250.5 44 273.0 45 282.5 46 279.0 47 274.0 48 260.0 49 228.0 50 175.5 51 135.5 52 127.5 53 103.5 54 76.0 55 62.0 56 46.0 57 35.5 58 29.0 59 21.0 60 16.5 61 11.0 62 7.0 63 6.0 64 3.5 65 2.0 66 1.5 67 1.0 68 1.0 69 2.5 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.325 7 0.6 8 1.575 9 0.325 10-14 2.23 15-19 3.4450000000000003 20-24 1.63 25-29 0.33 30-34 1.1400000000000001 35-39 0.775 40-44 0.66 45-49 0.615 50-54 2.55 55-59 4.655 60-64 4.345000000000001 65-69 2.385 70-74 3.27 75-79 3.015 80-84 3.045 85-89 2.605 90-94 3.36 95-99 2.22 100-104 4.49 105-109 3.1350000000000002 110-114 4.05 115-119 3.51 120-124 1.725 125-129 1.94 130-134 2.9899999999999998 135-139 2.6149999999999998 140-144 0.9950000000000001 145-149 1.385 150-151 2.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.5375 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.9 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.1375000000000002 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.4625 0.0 0.0 0.0 0.0 138-139 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCCT 10 0.007184122 142.575 3 AGTGGAG 10 0.007184122 142.575 4 TCCCTAA 10 0.007184122 142.575 5 ATCCCTA 10 0.007184122 142.575 4 >>END_MODULE Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990593 spots for SRR7169013.sra Written 990593 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra Read 990581 spots for SRR7169013.sra Written 990581 spots for SRR7169013.sra SRR ids: ['SRR7169013.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9qo_8i5o SRR7169013.sra spots: 19811632 blocks: [[1, 990581], [990582, 1981162], [1981163, 2971743], [2971744, 3962324], [3962325, 4952905], [4952906, 5943486], [5943487, 6934067], [6934068, 7924648], [7924649, 8915229], [8915230, 9905810], [9905811, 10896391], [10896392, 11886972], [11886973, 12877553], [12877554, 13868134], [13868135, 14858715], [14858716, 15849296], [15849297, 16839877], [16839878, 17830458], [17830459, 18821039], [18821040, 19811632]] SRR7169013 file size 6691811 SRR7169013 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169013 SRR7169013_1.fastq SRR7169013_2.fastq Input file: SRR7169013_1.fastq Paired file: SRR7169013_2.fastq trimmed: SRR7169013-trimmed-pair1.fastq, SRR7169013-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:51:34 2025 >> started Mon Feb 10 15:51:56 2025 >> done (22.650s) 19811632 read pairs processed; of these: 72488 ( 0.37%) short read pairs filtered out after trimming by size control 42832 ( 0.22%) empty read pairs filtered out after trimming by size control 19696312 (99.42%) read pairs available; of these: 8694641 (44.14%) trimmed read pairs available after processing 11001671 (55.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 9 0.00% 21 3 0.00% 22 9 0.00% 23 8 0.00% 24 12 0.00% 25 14 0.00% 26 10 0.00% 27 11 0.00% 28 13 0.00% 29 16 0.00% 30 12 0.00% 31 16 0.00% 32 15 0.00% 33 16 0.00% 34 13 0.00% 35 19 0.00% 36 14 0.00% 37 19 0.00% 38 22 0.00% 39 15 0.00% 40 17 0.00% 41 18 0.00% 42 30 0.00% 43 23 0.00% 44 22 0.00% 45 36 0.00% 46 30 0.00% 47 29 0.00% 48 26 0.00% 49 32 0.00% 50 36 0.00% 51 45 0.00% 52 53 0.00% 53 53 0.00% 54 63 0.00% 55 73 0.00% 56 68 0.00% 57 70 0.00% 58 89 0.00% 59 114 0.00% 60 102 0.00% 61 112 0.00% 62 132 0.00% 63 138 0.00% 64 172 0.00% 65 178 0.00% 66 215 0.00% 67 221 0.00% 68 256 0.00% 69 299 0.00% 70 293 0.00% 71 327 0.00% 72 411 0.00% 73 398 0.00% 74 474 0.00% 75 600 0.00% 76 599 0.00% 77 695 0.00% 78 759 0.00% 79 849 0.00% 80 1047 0.01% 81 1178 0.01% 82 1362 0.01% 83 1723 0.01% 84 4002 0.02% 85 5149 0.03% 86 5169 0.03% 87 5164 0.03% 88 5425 0.03% 89 5292 0.03% 90 5280 0.03% 91 5456 0.03% 92 5802 0.03% 93 5755 0.03% 94 6073 0.03% 95 6214 0.03% 96 6421 0.03% 97 6709 0.03% 98 7340 0.04% 99 7171 0.04% 100 8270 0.04% 101 8610 0.04% 102 9042 0.05% 103 9221 0.05% 104 9685 0.05% 105 10355 0.05% 106 11060 0.06% 107 11141 0.06% 108 11822 0.06% 109 12479 0.06% 110 13029 0.07% 111 14064 0.07% 112 14954 0.08% 113 15819 0.08% 114 16910 0.09% 115 17727 0.09% 116 18903 0.10% 117 19623 0.10% 118 20282 0.10% 119 20991 0.11% 120 22177 0.11% 121 23731 0.12% 122 25356 0.13% 123 26951 0.14% 124 28862 0.15% 125 31141 0.16% 126 32954 0.17% 127 33818 0.17% 128 35921 0.18% 129 37798 0.19% 130 40624 0.21% 131 43096 0.22% 132 46647 0.24% 133 49908 0.25% 134 54235 0.28% 135 58700 0.30% 136 63329 0.32% 137 67753 0.34% 138 74053 0.38% 139 80776 0.41% 140 87500 0.44% 141 98114 0.50% 142 110789 0.56% 143 128601 0.65% 144 153535 0.78% 145 184262 0.94% 146 232444 1.18% 147 321712 1.63% 148 485151 2.46% 149 944401 4.79% 150 4690150 23.81% 151 11001671 55.86% 19696312 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=38 prefix-density=0.25 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=73.39 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=11.0 sequence=AAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=118.67 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=13.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169013 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:52:57 Started mapping on | Feb 10 15:52:57 Finished on | Feb 10 15:55:29 Mapping speed, Million of reads per hour | 466.49 Number of input reads | 19696312 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18054419 Uniquely mapped reads % | 91.66% Average mapped length | 296.18 Number of splices: Total | 15981986 Number of splices: Annotated (sjdb) | 15708690 Number of splices: GT/AG | 15751093 Number of splices: GC/AG | 181898 Number of splices: AT/AC | 13340 Number of splices: Non-canonical | 35655 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366584 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 64509 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.09% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1324473 1324473 1324473 N_multimapping 366584 366584 366584 N_noFeature 367285 17837729 447308 N_ambiguous 210465 948 73249 UnstrandedReadsAssigned:17476669 PositiveStrandReadsAssigned:215742 NegativeStrandReadsAssigned:17533862 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169013 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169013-trimmed-pair1.fastq SRR7169013-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,696,312 reads, 17,486,375 reads pseudoaligned [quant] estimated average fragment length: 254.87 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7169013.ke.tsv 34699 SRR7169013.se.tsv 87100 total ==> SRR7169013.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.13 281 7.20032 Potri.005G024800.1.v4.1 1035 781.13 52 3.00923 Potri.004G059700.1.v4.1 961 707.162 2 0.127846 Potri.007G009000.2.v4.1 1416 1162.13 0 0 Potri.003G141000.2.v4.1 2943 2689.13 261 4.38738 Potri.016G087400.1.v4.1 270 66.9946 1730.27 1167.48 Potri.015G069301.1.v4.1 564 314.132 0 0 Potri.010G195200.1.v4.1 1773 1519.13 16 0.476103 Potri.012G127500.1.v4.1 977 723.146 7341 458.887 ==> SRR7169013.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1278 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 413 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169013 completed mapping pipeline successfully