Starting /dee2/code/volunteer_pipeline.sh SRR7169014 current disk space = 3058682441728 free memory = 1213518032 SRR7169014 SRAfilesize e209c2b90d7dabd2f09c94794951265e SRR7169014.sra SRR7169014.sra file validated SRR7169014 is paired end SRR7169014 is conventional basespace SRR7169014 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169014_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99225 34.0 34.0 34.0 33.0 34.0 2 33.42175 34.0 34.0 34.0 33.0 34.0 3 33.50475 34.0 34.0 34.0 33.0 34.0 4 33.5695 34.0 34.0 34.0 33.0 34.0 5 33.55325 34.0 34.0 34.0 33.0 34.0 6 37.2875 38.0 38.0 38.0 36.0 38.0 7 37.51625 38.0 38.0 38.0 37.0 38.0 8 37.56675 38.0 38.0 38.0 38.0 38.0 9 37.62175 38.0 38.0 38.0 38.0 38.0 10-14 37.599650000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.58875 38.0 38.0 38.0 38.0 38.0 20-24 37.57215 38.0 38.0 38.0 38.0 38.0 25-29 37.56625 38.0 38.0 38.0 38.0 38.0 30-34 37.53574999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.459050000000005 38.0 38.0 38.0 37.4 38.0 40-44 37.4249 38.0 38.0 38.0 37.0 38.0 45-49 37.35785 38.0 38.0 38.0 37.0 38.0 50-54 37.3165 38.0 38.0 38.0 37.0 38.0 55-59 37.3004 38.0 38.0 38.0 37.0 38.0 60-64 37.2212 38.0 38.0 38.0 37.0 38.0 65-69 37.231199999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.168400000000005 38.0 38.0 38.0 36.6 38.0 75-79 37.08925 38.0 38.0 38.0 36.0 38.0 80-84 37.0065 38.0 38.0 38.0 36.0 38.0 85-89 36.994749999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.88755 38.0 38.0 38.0 35.8 38.0 95-99 36.782650000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.60165000000001 38.0 38.0 38.0 34.6 38.0 105-109 36.496449999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.363150000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.247400000000006 38.0 37.8 38.0 34.0 38.0 120-124 36.1788 38.0 37.8 38.0 33.8 38.0 125-129 35.92065 38.0 37.0 38.0 32.8 38.0 130-134 35.774649999999994 38.0 36.8 38.0 31.8 38.0 135-139 35.572 38.0 36.2 38.0 31.4 38.0 140-144 35.18635 38.0 36.0 38.0 30.4 38.0 145-149 34.56555 38.0 35.0 38.0 28.0 38.0 150-151 31.431125 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 2.0 18 2.0 19 1.0 20 1.0 21 4.0 22 7.0 23 5.0 24 7.0 25 9.0 26 14.0 27 19.0 28 17.0 29 32.0 30 40.0 31 34.0 32 65.0 33 91.0 34 97.0 35 172.0 36 561.0 37 2814.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.62579496311371 12.770287458661919 10.48079369117273 36.12312388705164 2 22.1 16.1 34.225 27.575 3 18.075 22.15 28.050000000000004 31.724999999999998 4 21.099999999999998 30.25 24.6 24.05 5 21.775 34.125 23.375 20.724999999999998 6 17.849999999999998 38.224999999999994 24.45 19.475 7 13.925 26.775 41.425 17.875 8 17.474999999999998 26.325 30.5 25.7 9 16.275000000000002 26.1 33.525 24.099999999999998 10-14 19.759999999999998 29.765000000000004 26.945000000000004 23.53 15-19 19.52 28.92 27.665 23.895 20-24 19.830000000000002 29.555 27.195000000000004 23.419999999999998 25-29 19.875 29.609999999999996 26.75 23.765 30-34 19.96199619961996 29.322932293229325 26.8026802680268 23.912391239123913 35-39 19.47889577915583 30.031006201240245 26.790358071614325 23.6997399479896 40-44 20.131006550327516 29.04145207260363 26.651332566628334 24.17620881044052 45-49 20.205000000000002 29.365000000000002 26.615 23.815 50-54 20.275000000000002 28.549999999999997 27.47 23.705000000000002 55-59 19.85599279963998 28.801440072003597 27.30636531826591 24.036201810090503 60-64 20.115 28.970000000000002 26.875 24.04 65-69 20.080000000000002 28.71 27.150000000000002 24.060000000000002 70-74 20.435 29.054999999999996 26.245 24.265 75-79 19.85 29.21 26.784999999999997 24.154999999999998 80-84 20.56102805140257 28.446422321116057 27.2163608180409 23.77618880944047 85-89 20.101005050252514 28.936446822341118 27.521376068803438 23.44117205860293 90-94 19.985 28.575 27.12 24.32 95-99 20.415 28.205000000000002 26.915 24.465 100-104 21.029999999999998 27.884999999999998 27.534999999999997 23.549999999999997 105-109 20.46 28.585 26.895000000000003 24.060000000000002 110-114 20.34 28.060000000000002 27.865000000000002 23.735 115-119 19.71 28.32 27.29 24.68 120-124 20.445 28.355000000000004 27.534999999999997 23.665 125-129 20.474999999999998 27.83 27.529999999999998 24.165 130-134 20.265 28.68 27.005000000000003 24.05 135-139 20.376018800940045 28.066403320166007 27.87139356967848 23.68618430921546 140-144 20.580000000000002 28.634999999999998 27.334999999999997 23.45 145-149 20.65 28.134999999999998 27.01 24.205 150-151 20.4625 28.512500000000003 26.5125 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 1.0 24 2.0 25 2.5 26 2.0 27 7.0 28 12.0 29 13.0 30 22.0 31 29.0 32 39.0 33 49.5 34 57.0 35 74.0 36 95.0 37 110.0 38 118.0 39 141.0 40 172.5 41 209.0 42 255.5 43 259.5 44 247.5 45 268.0 46 268.0 47 245.0 48 230.0 49 204.0 50 182.0 51 160.5 52 129.5 53 102.0 54 75.0 55 54.0 56 41.0 57 33.5 58 20.5 59 9.0 60 7.5 61 10.0 62 10.5 63 8.5 64 5.5 65 3.0 66 2.5 67 3.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.02 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.7875000000000001 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.0625 0.0 0.0 0.0 0.0 130-131 1.1749999999999998 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.4625 0.0 0.0 0.0 0.0 136-137 1.525 0.0 0.0 0.0 0.0 138-139 1.6124999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGTTG 10 0.006830828 145.0 7 >>END_MODULE SRR7169014 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169014_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.014 33.0 33.0 34.0 32.0 34.0 2 33.0935 34.0 33.0 34.0 32.0 34.0 3 33.0825 34.0 33.0 34.0 32.0 34.0 4 33.07775 34.0 33.0 34.0 33.0 34.0 5 33.0585 34.0 33.0 34.0 32.0 34.0 6 37.284 38.0 38.0 38.0 37.0 38.0 7 37.3 38.0 38.0 38.0 37.0 38.0 8 37.3035 38.0 38.0 38.0 37.0 38.0 9 37.25425 38.0 38.0 38.0 37.0 38.0 10-14 37.182300000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.181349999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.14125 38.0 38.0 38.0 37.0 38.0 25-29 37.1305 38.0 38.0 38.0 36.8 38.0 30-34 37.1302 38.0 38.0 38.0 37.0 38.0 35-39 37.1161 38.0 38.0 38.0 36.6 38.0 40-44 37.10325 38.0 38.0 38.0 36.8 38.0 45-49 37.06515 38.0 38.0 38.0 36.4 38.0 50-54 37.00335 38.0 38.0 38.0 36.0 38.0 55-59 36.9722 38.0 38.0 38.0 36.0 38.0 60-64 36.937850000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.7211 38.0 38.0 38.0 35.0 38.0 70-74 36.74655 38.0 38.0 38.0 35.0 38.0 75-79 36.74975 38.0 38.0 38.0 35.0 38.0 80-84 36.5919 38.0 38.0 38.0 34.8 38.0 85-89 36.47245 38.0 38.0 38.0 34.0 38.0 90-94 36.4092 38.0 38.0 38.0 34.0 38.0 95-99 36.25655 38.0 38.0 38.0 34.0 38.0 100-104 36.11675 38.0 38.0 38.0 33.4 38.0 105-109 36.01495 38.0 37.8 38.0 33.2 38.0 110-114 35.78145 38.0 37.2 38.0 31.8 38.0 115-119 35.554500000000004 38.0 37.0 38.0 31.0 38.0 120-124 35.2174 38.0 36.2 38.0 28.4 38.0 125-129 34.932500000000005 38.0 36.0 38.0 27.6 38.0 130-134 34.6605 38.0 35.2 38.0 27.0 38.0 135-139 34.396950000000004 38.0 35.0 38.0 25.2 38.0 140-144 33.82775 38.0 35.0 38.0 22.6 38.0 145-149 33.165800000000004 38.0 34.2 38.0 17.0 38.0 150-151 28.8825 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 1.0 12 1.0 13 3.0 14 5.0 15 1.0 16 4.0 17 7.0 18 3.0 19 3.0 20 6.0 21 9.0 22 14.0 23 17.0 24 16.0 25 23.0 26 27.0 27 26.0 28 29.0 29 37.0 30 42.0 31 52.0 32 80.0 33 85.0 34 151.0 35 259.0 36 608.0 37 2483.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.925000000000004 20.974999999999998 14.524999999999999 27.575 2 27.3 25.45 29.9 17.349999999999998 3 20.25 29.549999999999997 30.9 19.3 4 23.724999999999998 35.449999999999996 22.625 18.2 5 24.224999999999998 36.025 21.275 18.475 6 19.225 38.5 23.375 18.9 7 20.95 20.275000000000002 38.925 19.85 8 22.7 24.95 26.775 25.575 9 22.35 24.95 28.975 23.724999999999998 10-14 23.405 28.71 26.325 21.560000000000002 15-19 23.810000000000002 27.474999999999998 27.85 20.865000000000002 20-24 23.02 28.299999999999997 27.72 20.96 25-29 23.335 27.98 27.375 21.310000000000002 30-34 22.99 28.21 27.785 21.015 35-39 23.815 27.584999999999997 27.685 20.915 40-44 23.46 28.144999999999996 27.49 20.905 45-49 23.294999999999998 27.68 28.165000000000003 20.86 50-54 23.465 27.839999999999996 28.299999999999997 20.395 55-59 24.15 27.089999999999996 28.065 20.695 60-64 23.61 27.77 28.26 20.36 65-69 23.53 27.185 28.455000000000002 20.830000000000002 70-74 23.515 28.134999999999998 27.650000000000002 20.7 75-79 23.905 27.295 28.360000000000003 20.44 80-84 23.580000000000002 27.0 29.23 20.19 85-89 23.925 27.425 27.889999999999997 20.76 90-94 24.275 27.13 27.875 20.72 95-99 23.635 28.050000000000004 27.810000000000002 20.505000000000003 100-104 23.77 27.584999999999997 27.900000000000002 20.745 105-109 23.43 27.495000000000005 28.065 21.01 110-114 24.025 27.505000000000003 28.03 20.44 115-119 24.21 26.805 28.105000000000004 20.880000000000003 120-124 23.56 27.169999999999998 28.439999999999998 20.830000000000002 125-129 24.295 28.139999999999997 27.54 20.025000000000002 130-134 24.355 27.700000000000003 27.18 20.765 135-139 23.755000000000003 28.02 27.54 20.685000000000002 140-144 24.495 27.055 28.060000000000002 20.39 145-149 24.05 27.650000000000002 27.694999999999997 20.605 150-151 23.7875 26.937499999999996 28.0875 21.1875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 2.0 26 1.0 27 1.0 28 4.0 29 5.5 30 5.5 31 14.0 32 23.0 33 27.5 34 35.5 35 56.5 36 83.0 37 107.0 38 129.0 39 146.0 40 183.0 41 229.5 42 274.0 43 295.5 44 302.0 45 280.5 46 269.5 47 268.0 48 234.5 49 202.0 50 173.5 51 149.0 52 123.5 53 103.5 54 72.5 55 55.0 56 42.5 57 26.0 58 17.5 59 10.5 60 9.5 61 8.0 62 5.5 63 6.5 64 5.0 65 3.5 66 3.0 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.8999999999999999 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.0750000000000002 0.0 0.0 0.0 0.0 130-131 1.15 0.0 0.0 0.0 0.0 132-133 1.3125 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.5 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758335 spots for SRR7169014.sra Written 758335 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra Read 758316 spots for SRR7169014.sra Written 758316 spots for SRR7169014.sra SRR ids: ['SRR7169014.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f3kyixd_ SRR7169014.sra spots: 15166339 blocks: [[1, 758316], [758317, 1516632], [1516633, 2274948], [2274949, 3033264], [3033265, 3791580], [3791581, 4549896], [4549897, 5308212], [5308213, 6066528], [6066529, 6824844], [6824845, 7583160], [7583161, 8341476], [8341477, 9099792], [9099793, 9858108], [9858109, 10616424], [10616425, 11374740], [11374741, 12133056], [12133057, 12891372], [12891373, 13649688], [13649689, 14408004], [14408005, 15166339]] SRR7169014 file size 5117674 SRR7169014 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169014 SRR7169014_1.fastq SRR7169014_2.fastq Input file: SRR7169014_1.fastq Paired file: SRR7169014_2.fastq trimmed: SRR7169014-trimmed-pair1.fastq, SRR7169014-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:08:25 2025 >> started Mon Feb 10 16:08:42 2025 >> done (17.484s) 15166339 read pairs processed; of these: 17245 ( 0.11%) short read pairs filtered out after trimming by size control 13720 ( 0.09%) empty read pairs filtered out after trimming by size control 15135374 (99.80%) read pairs available; of these: 5813116 (38.41%) trimmed read pairs available after processing 9322258 (61.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 4 0.00% 23 6 0.00% 24 0 0.00% 25 4 0.00% 26 2 0.00% 27 2 0.00% 28 4 0.00% 29 5 0.00% 30 7 0.00% 31 6 0.00% 32 5 0.00% 33 3 0.00% 34 5 0.00% 35 5 0.00% 36 6 0.00% 37 5 0.00% 38 8 0.00% 39 6 0.00% 40 9 0.00% 41 7 0.00% 42 10 0.00% 43 11 0.00% 44 8 0.00% 45 10 0.00% 46 10 0.00% 47 12 0.00% 48 17 0.00% 49 18 0.00% 50 21 0.00% 51 24 0.00% 52 24 0.00% 53 25 0.00% 54 21 0.00% 55 34 0.00% 56 34 0.00% 57 40 0.00% 58 42 0.00% 59 37 0.00% 60 43 0.00% 61 64 0.00% 62 59 0.00% 63 74 0.00% 64 105 0.00% 65 74 0.00% 66 114 0.00% 67 126 0.00% 68 122 0.00% 69 174 0.00% 70 192 0.00% 71 201 0.00% 72 217 0.00% 73 240 0.00% 74 269 0.00% 75 318 0.00% 76 342 0.00% 77 327 0.00% 78 430 0.00% 79 470 0.00% 80 544 0.00% 81 640 0.00% 82 747 0.00% 83 846 0.01% 84 1623 0.01% 85 2051 0.01% 86 2157 0.01% 87 2214 0.01% 88 2292 0.02% 89 2402 0.02% 90 2563 0.02% 91 2667 0.02% 92 2860 0.02% 93 2949 0.02% 94 3036 0.02% 95 3360 0.02% 96 3593 0.02% 97 3746 0.02% 98 4069 0.03% 99 4157 0.03% 100 4461 0.03% 101 4735 0.03% 102 5077 0.03% 103 5526 0.04% 104 5728 0.04% 105 6149 0.04% 106 6358 0.04% 107 6733 0.04% 108 7105 0.05% 109 7563 0.05% 110 7781 0.05% 111 8510 0.06% 112 9260 0.06% 113 9890 0.07% 114 10550 0.07% 115 11351 0.07% 116 12105 0.08% 117 12588 0.08% 118 13544 0.09% 119 13773 0.09% 120 14913 0.10% 121 15441 0.10% 122 16609 0.11% 123 17551 0.12% 124 18991 0.13% 125 20428 0.13% 126 21396 0.14% 127 22883 0.15% 128 24108 0.16% 129 25809 0.17% 130 27592 0.18% 131 29583 0.20% 132 31933 0.21% 133 34559 0.23% 134 37222 0.25% 135 40691 0.27% 136 44191 0.29% 137 47470 0.31% 138 51836 0.34% 139 56571 0.37% 140 61595 0.41% 141 69833 0.46% 142 77723 0.51% 143 88769 0.59% 144 104297 0.69% 145 121799 0.80% 146 152423 1.01% 147 205233 1.36% 148 311384 2.06% 149 607703 4.02% 150 3190799 21.08% 151 9322258 61.59% 15135374 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=41 prefix-density=0.21 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=40 fanout-score=134.60 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=16.5 sequence=TCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=32 prefix-density=0.25 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=59.64 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=14.4 sequence=TGTTGGTGGTGG SRR7169014 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:09:30 Started mapping on | Feb 10 16:09:30 Finished on | Feb 10 16:10:47 Mapping speed, Million of reads per hour | 707.63 Number of input reads | 15135374 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14228190 Uniquely mapped reads % | 94.01% Average mapped length | 297.01 Number of splices: Total | 13629100 Number of splices: Annotated (sjdb) | 13417051 Number of splices: GT/AG | 13434201 Number of splices: GC/AG | 157284 Number of splices: AT/AC | 10371 Number of splices: Non-canonical | 27244 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287380 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 44575 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.75% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 636368 636368 636368 N_multimapping 287380 287380 287380 N_noFeature 276868 14074962 339033 N_ambiguous 149525 1137 57579 UnstrandedReadsAssigned:13801797 PositiveStrandReadsAssigned:152091 NegativeStrandReadsAssigned:13831578 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169014 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169014-trimmed-pair1.fastq SRR7169014-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,135,374 reads, 13,717,734 reads pseudoaligned [quant] estimated average fragment length: 272.927 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR7169014.ke.tsv 34699 SRR7169014.se.tsv 87100 total ==> SRR7169014.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.07 284 10.6262 Potri.005G024800.1.v4.1 1035 763.073 42 3.59589 Potri.004G059700.1.v4.1 961 689.145 4 0.379204 Potri.007G009000.2.v4.1 1416 1144.07 0 0 Potri.003G141000.2.v4.1 2943 2671.07 332.046 8.1215 Potri.016G087400.1.v4.1 270 64.0796 1172 1194.9 Potri.015G069301.1.v4.1 564 299.786 0 0 Potri.010G195200.1.v4.1 1773 1501.07 9 0.39171 Potri.012G127500.1.v4.1 977 705.11 5845 541.566 ==> SRR7169014.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1172 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7169014 completed mapping pipeline successfully