Starting /dee2/code/volunteer_pipeline.sh SRR7169015 current disk space = 3058425548800 free memory = 1012929196 SRR7169015 SRAfilesize 45e29dc8126d6320553b08ea9d94207e SRR7169015.sra SRR7169015.sra file validated SRR7169015 is paired end SRR7169015 is conventional basespace SRR7169015 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169015_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.556 34.0 34.0 34.0 33.0 34.0 2 33.71525 34.0 34.0 34.0 33.0 34.0 3 33.752 34.0 34.0 34.0 33.0 34.0 4 33.75875 34.0 34.0 34.0 33.0 34.0 5 33.772 34.0 34.0 34.0 33.0 34.0 6 37.50775 38.0 38.0 38.0 37.0 38.0 7 37.678 38.0 38.0 38.0 38.0 38.0 8 37.704 38.0 38.0 38.0 38.0 38.0 9 37.53575 38.0 38.0 38.0 38.0 38.0 10-14 37.7112 38.0 38.0 38.0 38.0 38.0 15-19 37.718599999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.732299999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.707350000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.68300000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.578199999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.4742 38.0 38.0 38.0 37.6 38.0 45-49 37.45735 38.0 38.0 38.0 37.2 38.0 50-54 37.4314 38.0 38.0 38.0 37.0 38.0 55-59 37.40155 38.0 38.0 38.0 37.0 38.0 60-64 37.32565 38.0 38.0 38.0 37.0 38.0 65-69 37.29855 38.0 38.0 38.0 37.0 38.0 70-74 37.25599999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.18345000000001 38.0 38.0 38.0 37.0 38.0 80-84 37.1561 38.0 38.0 38.0 36.6 38.0 85-89 37.1075 38.0 38.0 38.0 36.0 38.0 90-94 37.00765 38.0 38.0 38.0 36.0 38.0 95-99 36.96975 38.0 38.0 38.0 36.0 38.0 100-104 36.7618 38.0 38.0 38.0 35.2 38.0 105-109 36.714150000000004 38.0 38.0 38.0 35.0 38.0 110-114 36.573499999999996 38.0 38.0 38.0 34.4 38.0 115-119 36.4953 38.0 38.0 38.0 34.2 38.0 120-124 36.28555 38.0 38.0 38.0 34.0 38.0 125-129 36.056650000000005 38.0 37.6 38.0 33.6 38.0 130-134 35.915099999999995 38.0 37.0 38.0 33.0 38.0 135-139 35.812050000000006 38.0 36.8 38.0 33.0 38.0 140-144 35.432750000000006 38.0 36.0 38.0 31.0 38.0 145-149 35.0392 38.0 36.0 38.0 31.0 38.0 150-151 31.767625 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 0.0 11 0.0 12 3.0 13 1.0 14 0.0 15 2.0 16 1.0 17 0.0 18 2.0 19 2.0 20 5.0 21 5.0 22 9.0 23 4.0 24 6.0 25 6.0 26 9.0 27 12.0 28 12.0 29 22.0 30 22.0 31 26.0 32 45.0 33 65.0 34 82.0 35 169.0 36 517.0 37 2971.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.34673366834171 16.130653266331656 10.879396984924623 33.64321608040201 2 21.43035758939735 17.429357339334832 33.60840210052513 27.53188297074269 3 18.2 23.375 29.2 29.225 4 21.05 28.849999999999998 25.55 24.55 5 22.325 34.175 24.325 19.175 6 19.85 35.5 25.25 19.400000000000002 7 15.125 26.8 38.95 19.125 8 18.025 28.125 29.25 24.6 9 17.775 26.35 32.6 23.275000000000002 10-14 19.564999999999998 30.259999999999998 26.695 23.48 15-19 19.1 30.42 27.200000000000003 23.28 20-24 19.220000000000002 29.82 27.845 23.115 25-29 18.915000000000003 29.815 27.625 23.645 30-34 19.555 29.665000000000003 26.97 23.810000000000002 35-39 19.12 29.585 27.46 23.835 40-44 20.23 29.57 26.729999999999997 23.47 45-49 20.080000000000002 28.825 27.355 23.74 50-54 20.035 29.925 26.775 23.265 55-59 19.580000000000002 29.59 27.145000000000003 23.685000000000002 60-64 20.36 28.99 27.07 23.580000000000002 65-69 20.385 29.409999999999997 26.33 23.875 70-74 20.325 29.189999999999998 27.01 23.474999999999998 75-79 20.1 29.28 26.75 23.87 80-84 20.064999999999998 29.025000000000002 27.21 23.7 85-89 19.885 28.884999999999998 27.595 23.635 90-94 20.57 28.849999999999998 26.755000000000003 23.825 95-99 20.945 28.64 27.165 23.25 100-104 20.105 28.62 27.51 23.765 105-109 20.18 28.365000000000002 27.92 23.535 110-114 20.585 28.485 27.139999999999997 23.79 115-119 20.485 28.845 26.974999999999998 23.695 120-124 20.424999999999997 28.49 26.584999999999997 24.5 125-129 20.625 28.51 27.450000000000003 23.415 130-134 21.01 27.67 27.439999999999998 23.880000000000003 135-139 20.72 28.01 27.284999999999997 23.985 140-144 21.295 27.96 27.075 23.669999999999998 145-149 20.345 28.4 27.189999999999998 24.065 150-151 21.462500000000002 27.675 26.0625 24.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 3.0 23 3.5 24 2.5 25 5.5 26 6.0 27 8.0 28 12.5 29 17.5 30 28.5 31 39.5 32 51.0 33 65.0 34 76.0 35 88.5 36 109.0 37 120.5 38 132.0 39 162.0 40 192.5 41 198.0 42 208.5 43 243.0 44 256.0 45 253.5 46 242.0 47 237.0 48 222.5 49 191.0 50 155.0 51 131.5 52 115.0 53 95.5 54 80.0 55 62.5 56 49.5 57 35.0 58 26.5 59 16.5 60 11.0 61 11.0 62 10.5 63 5.5 64 2.0 65 2.5 66 4.0 67 2.5 68 2.0 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.48750000000000004 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.4749999999999996 0.0 0.0 0.0 0.0 138-139 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCTT 10 0.006830828 145.0 5 CCAATCC 10 0.006830828 145.0 3 >>END_MODULE SRR7169015 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169015_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2345 34.0 33.0 34.0 33.0 34.0 2 33.271 34.0 33.0 34.0 33.0 34.0 3 33.25675 34.0 33.0 34.0 33.0 34.0 4 33.244 34.0 33.0 34.0 33.0 34.0 5 33.2705 34.0 33.0 34.0 33.0 34.0 6 37.401 38.0 38.0 38.0 38.0 38.0 7 37.41575 38.0 38.0 38.0 38.0 38.0 8 37.4375 38.0 38.0 38.0 38.0 38.0 9 37.393 38.0 38.0 38.0 38.0 38.0 10-14 37.3996 38.0 38.0 38.0 38.0 38.0 15-19 37.26685 38.0 38.0 38.0 37.6 38.0 20-24 37.3198 38.0 38.0 38.0 38.0 38.0 25-29 37.28705 38.0 38.0 38.0 38.0 38.0 30-34 37.269000000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.21985 38.0 38.0 38.0 37.4 38.0 40-44 37.207550000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.15225 38.0 38.0 38.0 37.0 38.0 50-54 37.0904 38.0 38.0 38.0 37.0 38.0 55-59 37.072799999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.0495 38.0 38.0 38.0 36.8 38.0 65-69 36.967099999999995 38.0 38.0 38.0 37.0 38.0 70-74 36.86065 38.0 38.0 38.0 36.2 38.0 75-79 36.81125 38.0 38.0 38.0 36.0 38.0 80-84 36.76395 38.0 38.0 38.0 36.0 38.0 85-89 36.666450000000005 38.0 38.0 38.0 35.6 38.0 90-94 36.62385 38.0 38.0 38.0 35.4 38.0 95-99 36.46925 38.0 38.0 38.0 35.0 38.0 100-104 36.32725000000001 38.0 38.0 38.0 34.2 38.0 105-109 36.2072 38.0 38.0 38.0 34.0 38.0 110-114 36.082100000000004 38.0 38.0 38.0 33.8 38.0 115-119 35.88595 38.0 38.0 38.0 33.2 38.0 120-124 35.4183 38.0 36.8 38.0 30.4 38.0 125-129 35.2363 38.0 36.4 38.0 29.2 38.0 130-134 34.97855 38.0 36.2 38.0 29.2 38.0 135-139 34.5982 38.0 35.8 38.0 27.0 38.0 140-144 33.96315 38.0 34.2 38.0 23.4 38.0 145-149 33.173700000000004 38.0 33.0 38.0 17.0 38.0 150-151 28.930374999999998 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 3.0 5 3.0 6 0.0 7 2.0 8 3.0 9 2.0 10 0.0 11 2.0 12 3.0 13 2.0 14 2.0 15 0.0 16 4.0 17 6.0 18 2.0 19 6.0 20 7.0 21 5.0 22 11.0 23 13.0 24 12.0 25 15.0 26 20.0 27 20.0 28 24.0 29 27.0 30 31.0 31 36.0 32 65.0 33 71.0 34 96.0 35 194.0 36 571.0 37 2729.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.65 22.35 13.975000000000001 23.025000000000002 2 27.625 27.325 27.700000000000003 17.349999999999998 3 20.875 31.4 29.825000000000003 17.9 4 22.925 34.825 23.0 19.25 5 23.95 36.125 22.475 17.45 6 20.925 36.95 23.45 18.675 7 20.424999999999997 20.775 37.95 20.849999999999998 8 22.5 26.275 25.45 25.775 9 23.125 26.25 27.55 23.075000000000003 10-14 24.165 28.560000000000002 25.75 21.525 15-19 23.72 28.075 27.02 21.185000000000002 20-24 23.380000000000003 28.03 27.29 21.3 25-29 23.535 28.335 26.865 21.265 30-34 23.155 28.375 27.169999999999998 21.3 35-39 23.45 28.244999999999997 27.165 21.14 40-44 24.224999999999998 28.205000000000002 26.76 20.810000000000002 45-49 23.580000000000002 27.860000000000003 27.279999999999998 21.279999999999998 50-54 23.57 27.994999999999997 27.435 21.0 55-59 23.755000000000003 27.839999999999996 27.605 20.8 60-64 23.794999999999998 27.61 28.165000000000003 20.43 65-69 24.610000000000003 27.015 27.644999999999996 20.73 70-74 23.915 27.655 27.495000000000005 20.935000000000002 75-79 23.735 27.24 27.994999999999997 21.029999999999998 80-84 23.825 27.88 27.505000000000003 20.79 85-89 23.455000000000002 27.495000000000005 27.77 21.279999999999998 90-94 23.46 27.595 27.334999999999997 21.61 95-99 23.28 27.694999999999997 27.96 21.065 100-104 24.22 27.650000000000002 27.055 21.075 105-109 23.13 27.505000000000003 28.1 21.265 110-114 24.27 27.52 27.935 20.275000000000002 115-119 23.885 27.91 27.58 20.625 120-124 24.03 28.49 27.16 20.32 125-129 24.02 27.694999999999997 27.57 20.715 130-134 23.69 27.68 27.839999999999996 20.79 135-139 24.165 27.925 27.725 20.185 140-144 23.865 27.855 27.93 20.349999999999998 145-149 24.545 27.089999999999996 28.15 20.215 150-151 23.9375 27.250000000000004 29.075 19.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 1.0 26 2.5 27 3.5 28 6.5 29 8.0 30 10.5 31 14.0 32 14.5 33 22.5 34 41.0 35 57.0 36 73.5 37 103.0 38 121.5 39 142.5 40 195.5 41 239.5 42 248.0 43 249.0 44 264.5 45 292.0 46 276.0 47 244.5 48 235.0 49 216.0 50 201.0 51 161.5 52 119.0 53 96.0 54 75.0 55 63.5 56 48.5 57 40.0 58 26.5 59 13.0 60 14.0 61 11.5 62 9.5 63 7.5 64 5.5 65 6.0 66 4.0 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.4000000000000004 0.0 0.0 0.0 0.0 138-139 2.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739858 spots for SRR7169015.sra Written 739858 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra Read 739842 spots for SRR7169015.sra Written 739842 spots for SRR7169015.sra SRR ids: ['SRR7169015.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s8r9w8o8 SRR7169015.sra spots: 14796856 blocks: [[1, 739842], [739843, 1479684], [1479685, 2219526], [2219527, 2959368], [2959369, 3699210], [3699211, 4439052], [4439053, 5178894], [5178895, 5918736], [5918737, 6658578], [6658579, 7398420], [7398421, 8138262], [8138263, 8878104], [8878105, 9617946], [9617947, 10357788], [10357789, 11097630], [11097631, 11837472], [11837473, 12577314], [12577315, 13317156], [13317157, 14056998], [14056999, 14796856]] SRR7169015 file size 4992468 SRR7169015 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169015 SRR7169015_1.fastq SRR7169015_2.fastq Input file: SRR7169015_1.fastq Paired file: SRR7169015_2.fastq trimmed: SRR7169015-trimmed-pair1.fastq, SRR7169015-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:31:03 2025 >> started Mon Feb 10 16:31:20 2025 >> done (16.316s) 14796856 read pairs processed; of these: 28119 ( 0.19%) short read pairs filtered out after trimming by size control 19816 ( 0.13%) empty read pairs filtered out after trimming by size control 14748921 (99.68%) read pairs available; of these: 5858325 (39.72%) trimmed read pairs available after processing 8890596 (60.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 14 0.00% 20 6 0.00% 21 8 0.00% 22 17 0.00% 23 10 0.00% 24 14 0.00% 25 10 0.00% 26 9 0.00% 27 17 0.00% 28 7 0.00% 29 9 0.00% 30 14 0.00% 31 9 0.00% 32 11 0.00% 33 5 0.00% 34 14 0.00% 35 7 0.00% 36 10 0.00% 37 12 0.00% 38 8 0.00% 39 20 0.00% 40 16 0.00% 41 10 0.00% 42 13 0.00% 43 15 0.00% 44 17 0.00% 45 13 0.00% 46 26 0.00% 47 20 0.00% 48 20 0.00% 49 17 0.00% 50 34 0.00% 51 20 0.00% 52 22 0.00% 53 27 0.00% 54 38 0.00% 55 34 0.00% 56 35 0.00% 57 55 0.00% 58 48 0.00% 59 53 0.00% 60 62 0.00% 61 63 0.00% 62 73 0.00% 63 92 0.00% 64 97 0.00% 65 101 0.00% 66 117 0.00% 67 151 0.00% 68 169 0.00% 69 245 0.00% 70 257 0.00% 71 214 0.00% 72 264 0.00% 73 308 0.00% 74 324 0.00% 75 381 0.00% 76 384 0.00% 77 426 0.00% 78 514 0.00% 79 569 0.00% 80 674 0.00% 81 769 0.01% 82 900 0.01% 83 1054 0.01% 84 2173 0.01% 85 3042 0.02% 86 3087 0.02% 87 3185 0.02% 88 3372 0.02% 89 3460 0.02% 90 3508 0.02% 91 3586 0.02% 92 3799 0.03% 93 3970 0.03% 94 4248 0.03% 95 4609 0.03% 96 4679 0.03% 97 4886 0.03% 98 5189 0.04% 99 5450 0.04% 100 5757 0.04% 101 6174 0.04% 102 6582 0.04% 103 7167 0.05% 104 7743 0.05% 105 8098 0.05% 106 8543 0.06% 107 8876 0.06% 108 9286 0.06% 109 9760 0.07% 110 10271 0.07% 111 11062 0.08% 112 11675 0.08% 113 12865 0.09% 114 13294 0.09% 115 14041 0.10% 116 14730 0.10% 117 15651 0.11% 118 15667 0.11% 119 16639 0.11% 120 17096 0.12% 121 18050 0.12% 122 19568 0.13% 123 20575 0.14% 124 22252 0.15% 125 23728 0.16% 126 25049 0.17% 127 26289 0.18% 128 27069 0.18% 129 29019 0.20% 130 30428 0.21% 131 32303 0.22% 132 34871 0.24% 133 37902 0.26% 134 40697 0.28% 135 45140 0.31% 136 48364 0.33% 137 52404 0.36% 138 55048 0.37% 139 58862 0.40% 140 63707 0.43% 141 68746 0.47% 142 76115 0.52% 143 85490 0.58% 144 98794 0.67% 145 119124 0.81% 146 145032 0.98% 147 193693 1.31% 148 296470 2.01% 149 578700 3.92% 150 3182635 21.58% 151 8890596 60.28% 14748921 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=34 prefix-density=0.21 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=320.72 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=18.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=39 prefix-density=0.19 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=243.85 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=25.6 sequence=GAAGAAGAAGAAA SRR7169015 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:32:20 Started mapping on | Feb 10 16:32:20 Finished on | Feb 10 16:34:29 Mapping speed, Million of reads per hour | 411.60 Number of input reads | 14748921 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13587930 Uniquely mapped reads % | 92.13% Average mapped length | 296.33 Number of splices: Total | 12482360 Number of splices: Annotated (sjdb) | 12276561 Number of splices: GT/AG | 12298426 Number of splices: GC/AG | 145822 Number of splices: AT/AC | 10544 Number of splices: Non-canonical | 27568 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264931 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 36122 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.78% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 919321 919321 919321 N_multimapping 264931 264931 264931 N_noFeature 284722 13434188 349169 N_ambiguous 143557 884 53745 UnstrandedReadsAssigned:13159651 PositiveStrandReadsAssigned:152858 NegativeStrandReadsAssigned:13185016 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169015 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169015-trimmed-pair1.fastq SRR7169015-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,748,921 reads, 13,137,544 reads pseudoaligned [quant] estimated average fragment length: 253.555 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR7169015.ke.tsv 34699 SRR7169015.se.tsv 87100 total ==> SRR7169015.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.45 254 9.02788 Potri.005G024800.1.v4.1 1035 782.445 26 2.08509 Potri.004G059700.1.v4.1 961 708.469 5 0.442849 Potri.007G009000.2.v4.1 1416 1163.45 0 0 Potri.003G141000.2.v4.1 2943 2690.45 208 4.85116 Potri.016G087400.1.v4.1 270 68.9839 1652.2 1502.87 Potri.015G069301.1.v4.1 564 315.793 0 0 Potri.010G195200.1.v4.1 1773 1520.45 21 0.866672 Potri.012G127500.1.v4.1 977 724.451 6952 602.153 ==> SRR7169015.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 839 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 249 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169015 completed mapping pipeline successfully